Advances in Hematology

Advances in Hematology / 2009 / Article

Case Report | Open Access

Volume 2009 |Article ID 476342 | 3 pages | https://doi.org/10.1155/2009/476342

-Thalassaemia Major in a Spanish Patient due to a Compound Heterozygosity for CD39 /−28

Academic Editor: Giuseppe G. Saglio
Received12 Oct 2008
Revised01 Feb 2009
Accepted23 Jun 2009
Published28 Jul 2009

Abstract

A Spanish male patient with -thalassaemia major was studied. Compound heterozygosity was found for one of the most common -globin gene mutations in the Spanish population (codon 39 ) and for a mutation in the TATA box element of the -globin gene promoter ( mutation). To our knowledge this is the first report of a CD39 and change association and the first report of the substitution in a Spanish patient.

1. Introduction

-thalassaemia is a hereditary and heterogeneous group of disorders caused by mutations in the -globin gene that result in the reduced or nonproduction of -globin chains. The inheritance of one mutated allele is usually asymptomatic ( -thalassaemia trait), but the inheritance of two defective alleles (homozygote or compound heterozygote) would produce -thalassaemia major (BTM) or intermedia (BTI) [1]. The severity of the symptoms of -thalassaemia depends in part on the combination of -globin gene mutations. However, predicting clinical phenotype based on the -globin genotype is not always straightforward since there are other genetic factors than can ameliorate or worsen the -thalassaemia phenotype [26]. Hence, clinical classification is based in the necessity to enroll a particular patient in a regular transfusion program (BTM) or not (BTI).

The mutations causing -thalassaemia can be found in the -globin gene exons, in the splice consensus sequences or in the transcription factor binding sites within the promoter region, resulting in a reduced efficiency of transcription initiation [1, 7]. Within each population, a small number of mutations are found. For example, in the Spanish population, a total of 86.6% of the alleles identified can be grouped into only five different mutations [8].

Here we describe a patient of Spanish descent with BTM (transfusion-dependent) who is compound heterozygous for one of the most common -globin gene mutation in Spanish population (CD39 C T) [8, 9] and an A to C substitution at position relative to the transcription start site. This mutation, first described in Kurdish Jew descendents, affects the TATA box element in the -globin gene promoter reducing mRNA amounts [10, 11]. To our knowledge this is the first report of a CD39 C T and A C mutations association and the first report of the A C substitution in a Spanish patient.

2. Materials and Patients

2.1. Case History

A Spanish male patient and his family were studied. The propositus is 21-year-old and was diagnosed to have -thalassaemia major 20 years ago. He is transfusion-dependent each three weeks, to maintain a haemoglobin concentration ([Hb]) of 10 gr/dL. A blood count showed marked microcytic hypochromic anaemia with [Hb] 6.5 g/dL, mean corpuscular volume (MCV) of 64 fL and mean corpuscular haemoglobin (MCH) of 20 pg. Haemoglobin (Hb) analysis showed levels of HbA2 of 5.1% and HbF of 1.0%. In 1999 he was cholecystectomized due to an acute cholelithiasis, and in 2000 he was splenectomized. Actually he has been diagnosed of hemochromatosis due to iron overload, and he is in a program of iron chelation with desferrioxamine. Both parents are Spanish and both showed a thalassaemia minor phenotype. The mother showed minimal anaemia ([Hb] 11.6 g/dL) with slightly hypochromic and microcytic (MCV 69 fL, MCH 21.8 pg) and increased HbA2 4.8% and HbF 1.9%. The father showed milder anaemia with [Hb] 13.4 g/dL, MCV 71 fL, MCH 23 pg, HbA2 5.6%, and HbF 1.0%.

2.2. DNA Isolation

DNA was extracted from peripheral EDTA anticoagulated whole blood using the MagNA Pure LC automated system (Roche Applied Science, Manheim, Germany) following the manufacturer’s instructions.

2.3. β-Globin Gene Analysis

The propositus and his parents were studied for the most frequent -thalassaemia mutations in the Mediterranean area by procedures based upon real-time PCR and specific fluorescent labeled hybridization probes including: IVSI-II-745 C G, CD5 (-CT), CD6 (-A), CD8 (-AA), CD39 C T, CD37 G A, IVSI-I G A, IVSI-6 T C, and IVSI-110 G A [12, 13]. The full coding, the and the sequences of -globin gene (GenBank accession no. U01317) were amplified and sequenced to discard other mutations. Primers sequences are displayed in Table 1. The amplifications were performed in a 25  L volume, containing 25 mM Cl2Mg, 200  M of each dNTP (Promega, Madrid, Spain), 2.5 U Expand Long Template PCR System (Roche), 0.6  M each primer, and 100 ng DNA. Amplification was performed in a PTC- thermal cycler (MJ Research INC, Madrid, Spain) for one cycle of 10 minutes at and then for 35 cycles of 20 seconds at , 20 seconds at , and 1 minute at , followed by one final cycle similar to the previous one but with 10 minutes at . The PCR products were analyzed by electrophoresis.


Primers Sequence ( )Gene Use

BF1SenseTCCAGGCAGAAACAGTTAGATG -GlobinAmplification and Sequencing
BF2SenseGAAGAGCCAAGGACAGGTAC -GlobinSequencing
BF3SenseTGGCTCACCTGGACAACCTC -GlobinSequencing
BF4SenseTCAGGGCAATAATGATACAA -GlobinSequencing
BR1AntisenseATGCACTGACCTCCCACATTC -GlobinSequencing
BR2AntisenseCCAGCCTTATCCCAACCATAAA -GlobinSequencing
BR3AntisenseTCACAGTGCAGCTCACTCAGT -GlobinSequencing
BR4AntisenseCAACTTCATCCACGTTCACC -GlobinAmplification and Sequencing

2.4. DNA Sequencing

PCR products were purified using ExoSAP-IT (GE Healthcare, Little Chalfont, UK). The PCR fragments were sequenced by the BigDye terminator V3.1 Cycle Sequencing ready reaction system (Applied Biosystems, Ca, USA) according to the manufacturer's instructions. Sequencing primers are displayed in Table 1. Sequence analysis was performed on an ABI Prism 3100-Avant DNA sequencer (Applied Biosystems).

2.5. Analysis of α-Globin Genes as Secondary Modifiers of the β-Thalassemia Clinical Phenotype.

-thalassemia clinical manifestations could be alter by concomitant -thalassemia or by extra copies of the -globin genes [6, 14]. In order to evaluate this fact, the most frequent Mediterranean -thalassemia deletions ( ) and the presence of extra copies of the -globin gene were determined in the proband and in his parents by PCR-GAP [15].

3. Results and Discussion

We have studied a Spanish patient with a BTM phenotype due to a compound heterozygous genotype never published before, a -globin exon gene mutation (C T transition at CD39 position) and a -globin TATA box mutation (A C mutation in the position). The first nucleotide substitution was inherited paternally while the TATA box mutation was inherited maternally. The CD39 C T mutation is one of the most common mutations in Mediterranean countries causing up to 64% of all the Spanish -thalassaemias [9]. On the other hand, the A C mutation had been barely described in the scientific literature. The first report describing this allele was published in 1982 where two Kurdish Jews siblings with BTM were studied [10]. In a follow-up paper, the same group established that the patients were compound heterozygotes for this TATA box mutation [11]. In 1992, Basak et al. [16] studied the mutations in the -globin gene in a group of Turkish patients exhibiting BTI and BTM. In this population the A C mutation was rare but the authors did not establish the genotype (homozygous or compound heterozygous) or the phenotype linked with the mutation. In 1996, Perea et al. [17] described a Mexican mestizo family with BTM due to a A C mutation and a CD11 –T frame shift compound heterozygosity. The TATA box mutation in this family was linked to the same haplotype as described previously for the Kurdish Jews siblings [11]. In 2005, two molecular epidemiological reports were published studying Middle East populations where the A C mutation appears to be a rare allele. Adekile et al. [14] described an Iraqi patient who was a compound heterozygote for the A C and the IVS-II-1 G A mutations. This patient showed a BTI phenotype. The mild clinical manifestation was linked to a C T polymorphism of the -globin gene promoter with elevated Hb F together with -gene deletion. In the same year, Darwish et al. [18] report 1 patient harboring the A C mutation in homozygosis out of 148 Palestine -thalassemia patients studied. Unfortunately, the phenotype of this patient was not mentioned. Turning to our patient, the BTM phenotype is consistent with the clinical manifestation observed in the other compound heterozygous patients described so far. Moreover, our patient and his family showed no -thalassemia deletions ( ), extra copies of -globin genes, or HbF elevation. Thus, the propositus BTM phenotype could be related strictly to the -globin mutations described here.

Acknowledgments

The authors thank Dr. Steven Cagas for English revision of the manuscript and an anonymous reviewer for helpful suggestions. This project was supported by Grants FIS 03/821 from the Spanish Ministry of Health and Consumption and CAM GR/SAL 0340 (Comunidad Autonoma de Madrid) to F. Gilsanz.

References

  1. D. J. Weatherall and J. B. Clegg, The Thalassaemia Syndromes, Blackwell Science, Oxford, UK, 4th edition, 2001.
  2. I. Agouti, C. Badens, A. Abouyoub et al., “Genotypic correlation between six common ß-thalassemia mutations and the XmnI polymorphism in the moroccan population,” Hemoglobin, vol. 31, no. 2, pp. 141–149, 2007. View at: Publisher Site | Google Scholar
  3. C. Camaschella, A. C. Kattamis, D. Petroni et al., “Different hematological phenotypes caused by the interaction of triplicated a-globin genes and heterozygous 13-thalassemia,” American Journal of Hematology, vol. 55, no. 2, pp. 83–88, 1997. View at: Publisher Site | Google Scholar
  4. R. Kukreti, D. Dash, K. E. Vineetha et al., “Spectrum of ß-thalassemia mutations and their association with allelic sequence polymorphisms at the ß-globin gene cluster in an Eastern Indian population,” American Journal of Hematology, vol. 70, no. 4, pp. 269–277, 2002. View at: Publisher Site | Google Scholar
  5. T. Merghoub, B. Perichon, M. Maier-Redelsperger et al., “Dissection of the association status of two polymorphisms in the ß-globin gene cluster with variations in F-cell number in non-anemic individuals,” American Journal of Hematology, vol. 56, no. 4, pp. 239–243, 1997. View at: Google Scholar
  6. I. Panigrahi and S. Agarwal, “Genetic determinants of phenotype in beta-thalassemia,” Hematology, vol. 13, no. 4, pp. 247–252, 2008. View at: Publisher Site | Google Scholar
  7. A. E. Kulozik, A. Bellan-Koch, S. Bail, E. Kohne, and E. Kleihauer, “Thalassemia intermedia: moderate reduction of beta globin gene transcriptional activity by a novel mutation of the proximal CACCC promoter element,” Blood, vol. 77, no. 9, pp. 2054–2058, 1991. View at: Google Scholar
  8. A. Villegas, P. Ropero, F. A. Gonzalez, E. Anguita, and D. Espinós, “The thalassemia syndromes: molecular characterization in the spanish population,” Hemoglobin, vol. 25, no. 3, pp. 273–283, 2001. View at: Publisher Site | Google Scholar
  9. I. Moreno, G. P. Bolufer, and S. M. Perez, “The molecular changes in thalassemias in Spain. A review of existing studies,” Medicina Clinica, vol. 113, no. 20, pp. 789–794, 1999. View at: Google Scholar
  10. M. Poncz, M. Ballantine, D. Solowiejczyk, I. Barak, E. Schwartz, and S. Surrey, “β-thalassemia in a Kurdish Jew. Single base changes in the T-A-T-A box,” The Journal of Biological Chemistry, vol. 257, no. 11, pp. 5994–5996, 1982. View at: Google Scholar
  11. S. Surrey, K. Delgrosso, P. Malladi, and E. Schwartz, “Functional analysis of a β-globin gene containing a TATA box mutation from a Kurdish Jew with β thalassemia,” The Journal of Biological Chemistry, vol. 260, no. 11, pp. 6507–6510, 1985. View at: Google Scholar
  12. I. Moreno, P. Bolufer, M. L. Perez, E. Barragan, and M. A. Sanz, “Rapid detection of the major Mediterranean β-thalassaemia mutations by real-time polymerase chain reaction using fluorophore-labelled hybridization probes,” British Journal of Haematology, vol. 119, no. 2, pp. 554–557, 2002. View at: Publisher Site | Google Scholar
  13. C. Vrettou, J. Traeger-Synodinos, M. Tzetis, G. Malamis, and E. Kanavakis, “Rapid screening of multiple β-globin gene mutations by real-time PCR on the LightCycler: application to carrier screening and prenatal diagnosis of thalassemia syndromes,” Clinical Chemistry, vol. 49, no. 5, pp. 769–776, 2003. View at: Publisher Site | Google Scholar
  14. A. Adekile, M. Haider, and F. Kutlar, “Mutations associated with beta-thalassemia intermedia in Kuwait,” Medical Principles and Practice, vol. 14, supplement 1, pp. 69–72, 2005. View at: Publisher Site | Google Scholar
  15. Y. T. Liu, J. M. Old, K. Miles, C. A. Fisher, D. J. Weatherall, and J. B. Clegg, “Rapid detection of α-thalassaemia deletions and α-globin gene triplication by multiplex polymerase chain reactions,” British Journal of Haematology, vol. 108, no. 2, pp. 295–299, 2000. View at: Publisher Site | Google Scholar
  16. A. N. Basak, H. Ozcelik, A. Ozer et al., “The molecular basis of ß-thalassemia in Turkey,” Human Genetics, vol. 89, no. 3, pp. 315–318, 1992. View at: Google Scholar
  17. F. J. Perea, M. A. Esparza, A. R. Villalobos-Arambula, B. Ibarra, and J. M. Old, “Haplotype analysis of the Mexican frameshift Cd 11 (-T) and 28ACβ-thalassemia alleles,” American Journal of Hematology, vol. 51, no. 3, pp. 240–242, 1996. View at: Publisher Site | Google Scholar
  18. H. M. Darwish, F. F. El-Khatib, and S. Ayesh, “Spectrum of β-globin gene mutations among thalassemia patients in the West Bank Region of Palestine,” Hemoglobin, vol. 29, no. 2, pp. 119–132, 2005. View at: Publisher Site | Google Scholar

Copyright © 2009 Soledad Gamarra et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

892 Views | 988 Downloads | 1 Citation
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.