Advances in Hematology / 2009 / Article / Tab 1

Case Report

-Thalassaemia Major in a Spanish Patient due to a Compound Heterozygosity for CD39 /−28

Table 1

Oligonucleotide primers used in this work.

Primers Sequence ( )Gene Use

BF1SenseTCCAGGCAGAAACAGTTAGATG -GlobinAmplification and Sequencing
BF2SenseGAAGAGCCAAGGACAGGTAC -GlobinSequencing
BF3SenseTGGCTCACCTGGACAACCTC -GlobinSequencing
BF4SenseTCAGGGCAATAATGATACAA -GlobinSequencing
BR1AntisenseATGCACTGACCTCCCACATTC -GlobinSequencing
BR2AntisenseCCAGCCTTATCCCAACCATAAA -GlobinSequencing
BR3AntisenseTCACAGTGCAGCTCACTCAGT -GlobinSequencing
BR4AntisenseCAACTTCATCCACGTTCACC -GlobinAmplification and Sequencing

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.