Anemia

Anemia / 2012 / Article
Special Issue

A Molecular, Genetic, and Diagnostic Spotlight on Fanconi Anemia

View this Special Issue

Research Article | Open Access

Volume 2012 |Article ID 603253 | https://doi.org/10.1155/2012/603253

Johan J. P. Gille, Karijn Floor, Lianne Kerkhoven, Najim Ameziane, Hans Joenje, Johan P. de Winter, "Diagnosis of Fanconi Anemia: Mutation Analysis by Multiplex Ligation-Dependent Probe Amplification and PCR-Based Sanger Sequencing", Anemia, vol. 2012, Article ID 603253, 13 pages, 2012. https://doi.org/10.1155/2012/603253

Diagnosis of Fanconi Anemia: Mutation Analysis by Multiplex Ligation-Dependent Probe Amplification and PCR-Based Sanger Sequencing

Academic Editor: Stefan Meyer
Received22 Dec 2011
Accepted21 Mar 2012
Published21 Jun 2012

Abstract

Fanconi anemia (FA) is a rare inherited disease characterized by developmental defects, short stature, bone marrow failure, and a high risk of malignancies. FA is heterogeneous: 15 genetic subtypes have been distinguished so far. A clinical diagnosis of FA needs to be confirmed by testing cells for sensitivity to cross-linking agents in a chromosomal breakage test. As a second step, DNA testing can be employed to elucidate the genetic subtype of the patient and to identify the familial mutations. This knowledge allows preimplantation genetic diagnosis (PGD) and enables prenatal DNA testing in future pregnancies. Although simultaneous testing of all FA genes by next generation sequencing will be possible in the near future, this technique will not be available immediately for all laboratories. In addition, in populations with strong founder mutations, a limited test using Sanger sequencing and MLPA will be a cost-effective alternative. We describe a strategy and optimized conditions for the screening of FANCA, FANCB, FANCC, FANCE, FANCF, and FANCG and present the results obtained in a cohort of 54 patients referred to our diagnostic service since 2008. In addition, the follow up with respect to genetic counseling and carrier screening in the families is discussed.

1. Introduction

Fanconi anemia (FA) is a rare inherited syndrome with diverse clinical symptoms including developmental defects, short stature, bone marrow failure, and a high risk of malignancies. Fifteen genetic subtypes have been distinguished: FA-A, -B, -C, -D1, -D2, -E, -F, -G, -I, -J, -L, -M, -N, -O, and -P. [14]. The majority of patients (~85%) belong to the subtypes A (~60%), C (~10–15%), or G (~10%), while a minority (~15%) is distributed over the remaining 12 subtypes, with relative prevalences between <1 and 5%. These percentages may differ considerably within certain ethnic groups, due to founder effects. All subtypes seem to fit within a “classical” FA phenotype, except for D1 and N (mutated in BRCA2/FANCD1 and PALB2/FANCN), which are associated with a distinct, more severe, syndromic association. The mode of inheritance for all subtypes is autosomal recessive, except for FA-B, which is X-linked. These two different modes of inheritance have important consequences for the counseling of FA families. The relative prevalence of FA-B amongst unselected FA patients is estimated at 1.6% [5]. For all genetic subtypes disease genes have been identified (Table 1). Many mutations found in the various subtypes are private, but recurrent mutations are known, particularly in specific ethnic backgrounds (Table 2).


GroupGene symbol(s)aCytogenetic locationProtein (amino acids)Domain structure (references)

AFANCA16q24.31455HEAT repeats [8]
BFANCBXp22.31859
CFANCC9q22.3558HEAT repeats [8]
D1 bBRCA213q12.33418RAD51- and DNA-binding motifs [9]
D2FANCD23p25.31451
EFANCE6p21.3536
FFANCF11p15374
GFANCG9p13622Tetratricopeptide repeats (TPR) [10]
IFANCI15q26.11328
J bBRIP117q221249DNA helicase [11, 12]
LFANCL2p16.1375RING finger motif (E3 ligase) [7, 8]
MFANCM14q21.32014DNA helicase, nuclease [13]
N bPALB216p12.11186
O b RAD51C17q25.1376
P bSLX416p13.31834Endonuclease scaffold [3, 4]

aFor gene nomenclature see http://www.genenames.org/.
bThe proteins defective in groups D1, J, N, O, and P (boldface) act downstream or independent of the monoubiquitination of FANCD2; all other FA proteins act upstream of this process.

GeneMutation*Geographic/ethnic backgroundCommentReferences

FANCAc.3788_3790del (p.Phe1263del)European, BrazilianRelatively mild[14, 15]
c.1115_1118delTTGG (p.Val372fs)EuropeanRelatively mild[16]
Exon 12–17del
Exon 12–31del
South-AfricanRelatively common in Afrikaners[17]
c.295C>T (p.Gln99X)Spanish Gypsy populationWorldwide highest prevalence of mutant FANCA allele[18]
FANCCc.711+4A>T (originally reported as IVS4+4A>T)Homozygous in 80% of Ashkenazi Jewish FA; relatively common in Japan.Severe phenotype in Jews, milder in Japanese.[1922]
c.67delG (originally reported as 322delG)Homozygous in approx. 50% of Dutch FA patientsLike other exon 1 mutations, relatively mild phenotype.[19, 2325]
FANCD2c.1948-16T>GTurkishFounder mutation[26]
FANCGc.313G>T (p.Glu105X)European44% of mutated FANCG alleles in Germany.[27]
c.1077-2A>GPortuguese/BrazilianFounder mutation[27, 28]
c.1480+1G>CFrench-CanadianFounder mutation[28]
c.307+1G>CJapaneseFounder mutation[28, 29]
c.1794_1803del (p.Trp599fs)European[28]
c.637_643del (p.Tyr213fs)Sub-Saharan Africa82% of all black FA patients[30]
FANCJc.2392C>T (p.Arg798X)Found in ca. 50% of FA-J patients of diverse ancestry; ancient mutation or hot spot.[11, 12]

Nucleotide numbering based on ATG = +1.
Published sequence variations in FA genes, with their descriptions conforming to the current nomenclature rules, are listed at http://www.rockefeller.edu/fanconi/.

Most FA genes encode orphan proteins with no known molecular function. At least eight FA proteins (FANCA, -B, -C, -E, -F, -G, -L, and -M) assemble into a nuclear multiprotein core complex, which is required to activate FANCD2 and FANCI by monoubiquitination [6]. FANCL, which carries a RING finger domain, is supposed to represent the ubiquitin E3 ligase in this activation [7]. FANCM probably acts as a sensor of DNA damage and recruits the FA core complex to the site of damage, but FANCM also interacts with other proteins including Blm [6]. Monoubiquitination of FANCD2 and FANCI directs these proteins to areas of damaged chromatin where they interact with other proteins, resulting in repair of the damage [6]. The remaining FA proteins function downstream of or parallel to the FANCD2 activation step [6]. The exact nature of the DNA damage response, which when defective causes FA, remains to be defined. FANCJ/BRIP1 and FANCM possess DNA helicase motifs, which strongly suggests that the FA pathway acts through a direct interaction with DNA, presumably to resolve or remodel blocked DNA replication forks resulting from DNA interstrand cross-link damage [6]. This idea is strengthened by the recent extension of the FA pathway with SLX4, a scaffold protein for structure-specific endonucleases involved in unhooking the DNA cross-link [3, 4].

2. Laboratory Diagnostics in FA

Cells derived from FA patients are—by definition—hypersensitive to chromosomal breakage induced by DNA cross-linking agents such as mitomycin C (MMC) or diepoxybutane (DEB) [31]. This cellular phenotype is ascertained using stimulated blood T lymphocytes. The indications for FA laboratory testing are rather broad [32]. As a consequence, in only a small proportion of patients (about 10%) the chromosomal breakage test is positive, and an FA diagnosis is established. Since mutation testing by Sanger sequencing and MLPA is rather laborious, time consuming and therefore expensive, a positive chromosomal breakage test is a prerequisite for starting mutation screening. Confirmation of the FA diagnosis at the DNA level is important in patients in whom the chromosomal breakage test was inconclusive. Furthermore, knowledge about the FA subtype is relevant for the treatment and prognosis of the patients. In addition, identification of mutations allows carrier testing in the family and will enable prenatal DNA testing and preimplantation genetic diagnosis (PGD) in future pregnancies. Finally, this information can be used to rule out FA in potential donors for bone marrow transplantation.

Although simultaneous testing of all FA genes by next generation sequencing will be possible in the near future, this technique will not be available immediately for all laboratories worldwide. In addition, in populations with strong founder mutations, a limited test using Sanger sequencing and MLPA will be a cost-effective alternative [33]. The strategy outlined below has been developed at our DNA diagnostics laboratory to provide a molecular diagnosis of FA. It is recognized that mutations in FANCA account for 60–70% of all FA cases and that about 15–20% of the mutations in this gene are large deletions [33, 34]. Therefore, DNA testing usually starts with a screen for deletions in FANCA. However, depending on the circumstances strategies may differ from case to case.

2.1. Materials

Genomic DNA (from e.g., leukocytes or fibroblasts derived from the proband or the parents) is adequate for most mutation screening assays. Screening on cDNA is more efficient but has several drawbacks: for high-quality cDNA, growing cells (stimulated leukocytes, lymphoblastoid cell lines, or fibroblasts) are necessary. In addition, common alternative splice variants will hamper the evaluation of DNA sequences. Therefore, screening on gDNA is the preferred method for mutation screening. However, during the diagnostic process, growing cells from the proband will be helpful in a couple of situations. Growing cells are indispensable for studying the effect of unclassified variants on splicing or to verify the disease gene by functional complementation of the cellular phenotype with a construct expressing a wild type copy of the suspected gene [3537]. Finally, if no mutations can be de detected, growing cells can be used to reconfirm the diagnosis FA by checking MMC sensitivity in cell growth or G2-arrest assays [38, 39].

2.2. Mutation Screening Strategy
2.2.1. Hints from Ethnic Background or Phenotype

Information on the ethnic background of the proband may provide a clue for a specific pathogenic mutation that most likely causes the disease, such as c.711 + 4A > T (IVS4 + 4A > T) in FANCC, a mutation present in homozygous state in 80% of all FA cases of Ashkenazi Jewish ancestry, and c.295C > T in FANCA, which was present homozygously in all 40 FA cases of Spanish Gypsy ancestry so far investigated. More examples of recurrent mutations are shown in Table 3. The distinct clinical phenotype of D1 and N patients (severely affected, often combined with leukemia or solid tumors below the age of 5 years) may provide a clue to favor BRCA2/FANCD1 and PALB2/FANCN as the first gene to be screened [4044]. This is especially worthwhile if confirmed by the cellular phenotype: in contrast to cells from all other known FA subtypes, cells from D1, N and O patients are unable to form RAD51 foci upon exposure to X rays or MMC [4345].


Allele 1Allele 2
Country of origin1GeneDNA changeEffectNumber of database entriesDNA changeEffectNumber of database entries

1ESFANCAex16_17deldel12xc.1115_1118delp.Val372fs62x
2PTFANCAc.718C>Tp.Gln240X2xc.2870G>AW957X1x
3NLFANCAex15deldel3xex15deldel3x
4NLFANCAc.3788_3790delp.Phe1263del215xc.3788_3790delp.Phe1263del215x
5CAFANCAc.718C>TpGlnx240X2xc.1085T>Cp.Leu362Pronovel
6PTFANCAc.3788_3790delp.Phe1263del215xc.4130C>Gp.Ser1377X1x
7IEFANCAc.2812_2830dupp.Asp944fs3xc.2812_2830dupp.Asp944fs3x
8AUFANCAc.2303T>Cp.Leu768Pro5xc.2303T>Cp.Leu768Pro5x
9NLFANCAc.862G>Tp.Glu288X1xc.862G>Tp.Glu288X1x
10NLFANCAex11_33deldel1xc.2121delCp.Asn707fsnovel
11DKFANCAex1_8deldel1xc.3788_3790delp.Phe1263del215x
12UKFANCAc.337_338delp.Ala114fs1xc.3349A>Gp.Arg1117Gly2x
13UKFANCAc.3568C>Tp.Gln1190Xnovelc.3568C>Tp.Gln1190Xnovel
14NLFANCAc.487delCp.Arg163fs1xc.2851C>Tp.Arg951Trp11x
15SEFANCAc.88delGp.Val30fsnovelc.100A>Tp.Lys34X2x
16NLFANCAc.862G>Tp.Glu288X9xc.1771C>Tp.Arg591X9x
17PTFANCAc.1709_1715+4delp.Glu570fsnovelc.3430C>Tp.Arg1144Trpnovel
18NOFANCAc.100A>Tp.Lys34X2xc.1378C>Tp.Arg460Xnovel
19PTFANCAex15_17deldel2xex15_17deldel2x
20NLFANCAc.2982-192A>Gsplice2novelex7_31deldel
21AUFANCAc.427-8_427-5delsplicenovelc.1771C>Tp.Arg591X9x
22AUFANCAc.3491C>Tp.Pro1164Leunovelc.3491C>Tp.Pro1164Leunovel
23CAFANCAex4_29deldelnovelex31deldel6x
24NLFANCAc.3391A>Gp.Thr1131Ala15xc.3391A>Gp.Thr1131Ala15x
25GRFANCAc.2T>Cp.Met1?1xc.3788_3790delp.Phe1263del215x
26IEFANCAc.851dupp.Val285fsnovelc.2534T>Cp.Leu845Pro4x
27NLFANCAc.2852G>Ap.Arg951Gln6xc.3624C>Tp.= (splice)2x
28AUFANCAc.331_334dupp.Leu112fsnovelex22_29deldelnovel
29NLFANCAc.862G>Tp.Glu288X9xc.3920delAp.Gln1307fs2x
30IRFANCAex21deldelnovelex21deldelnovel
31SEFANCAex1_12deldelnovelex22_29deldelnovel
32NLFANCBc.755_767delp.Leu252fsnovel
33NLFANCCc.67delGp.Asp23fs50xc.553C>Tp.Arg185X14x
34NLFANCCc.67delGp.Asp23fs50xc.67delGp.Asp23fs50x
35CAFANCCc.67delGp.Asp23fs50xc.553C>Tp.Arg185X14x
36NLFANCCc.67delGp.Asp23fs50xc.1155-1G>Csplicenovel
37NLFANCCc.67delGp.Asp23fs50xc.67delGp.Asp23fs50x
38NLFANCCc.67delGp.Asp23fs50xc.467delCp.Ser156fsnovel
39PTFANCEc.1111C>Tp.Arg371Trp6xc.1111C>Tp.Arg371Trp6x
40UKFANCFc.496C>Tp.Gln166X4xc.496C>Tp.Gln166X4x
41UKFANCGc.307+2delTsplicenovelc.307+2delTsplicenovel
42UKFANCGc.1471_1473delinsGp.Lys491fsnovelc.1471_1473delinsGp.Lys491fsnovel
43NLFANCGc.65G>Cp.Arg22Pro6xc.65G>C;p.Arg22Pro6x
44IRFANCGc.307+1G>Csplice21xc.307+1G>Csplice21x
45NLFANCGc.85-1G>Asplicenovelc.85-1G>Asplicenovel

1Country of origins: AU: Australia; CA: Canada; DK: Denmark; ES: Spain; GR: Greece; IE: Ireland; IR: Iran; NL: Netherlands; PT: Portugal; SE: Sweden; UK: United Kingdom
Number of database entries refers to the FA database at: http://www.rockefeller.edu/fanconi/.
The pathogenic state of novel missense mutations is based upon in silico prediction algorithms (SIFT, POLYPHEN2, Align GVGD), the presence of a second clearly pathogenic mutation in the same gene and segregation in the family.
2Effect c.2982-192A>G: by studying cDNA it was shown that the mutation created a new splice donor site resulting in an aberrant mRNA.
2.2.2. No Clues Available
(1)In the absence of any clue to the disease gene, mutation screening starts with a search for deletions in FANCA, as this type of mutation accounts for 40% of all mutant FANCA alleles. The quantitative multiplex ligation-dependent probe amplification (MLPA) method [46] is used for this initial screen, which identifies FANCA as the most likely disease gene in 1 out of 4 patients by the detection of a—usually hemizygous-deletion. In parallel, the FANCA gene is completely sequenced. The combination of these two approaches identifies 60–70% of all FA patients as FA-A.(2)Next, FANCC, -E, -F, and -G are screened by DNA sequencing.(3)Only if the proband is a male, FANCB is screened by MLPA and DNA sequencing,

In Table 4, optimized conditions are provided for the PCR amplification of FANCA, -C, -E, -F, -G, and -B. Most PCRs can be performed under standard conditions. The PCR primers have M13 extensions which allow sequencing of all fragments with universal sequencing primers. MLPA was performed according to the instructions of the supplier. Detailed information about the sequences of the MLPA probes is available from the website of the supplier (http://www.mlpa.com). In a well-equipped laboratory with sufficient dedicated personal, testing of FANCA, -C, -E, -F, -G and -B can be completed within 1-2 weeks.

(a)

FANCA
Primer nameSequence (5′ > 3′)Product length (bp)

FANCA_ex1Fgtaaaacgacggccag GCGCCTCCCCCAGGACCAACA362
FANCA_ex1Rcaggaaacagctatga AGGCTCTGGCGGGAAGGGATCGG
FANCA_ex2Fgtaaaacgacggccag CTCTTCGGGAGGGTGTCGCTGGT328
FANCA_ex2Rcaggaaacagctatga CTCTTCGGGAGGGTGTCGCTGGT
FANCA_ex3Fgtaaaacgacggccag GCCTGGCCTGGAGCTTGAAT392
FANCA_ex3Rcaggaaacagctatga CGCAGGTTGAATCAGACGCTGTT
FANCA_ex4Fgtaaaacgacggccag TAAGGCATTTTAAACAGCAAGTC430
FANCA_ex4Rcaggaaacagctatga TGCCAATAAATACTGAGCAAACT
FANCA_ex5Fgtaaaacgacggccag AGTATTGTTTCAGGTAATTTGTT356
FANCA_ex5Rcaggaaacagctatga TGAAGGTACTTCTTTCCAATCCA
FANCA_ex6Fgtaaaacgacggccag AGATGTGTTTCAGGCTCTAAGTT402
FANCA_ex6Rcaggaaacagctatga GCAATGCAATCTAGTCTAGTACA
FANCA_ex7Fgtaaaacgacggccag TGGGATTTAGTTGAGCCTTACGTCTGC421
FANCA_ex7RcaggaaacagctatgaAAGGTGAATGGAAACACTTAAACTCATGTCA
FANCA_ex8Fgtaaaacgacggccag GTGGTCAGGTGAGCAGTAACTTC401
FANCA_ex8Rcaggaaacagctatga TAAATAGGTACAAACAGCACGTT
FANCA_ex9Fgtaaaacgacggccag TTCTCTTGTGTGATGCAGGTATC332
FANCA_ex9Rcaggaaacagctatga TGACCCACAGATTCATGAGGTAT
FANCA_ex10Fgtaaaacgacggccag TTTTGATTAAGGCCTACAGATTG406
FANCA_ex10Rcaggaaacagctatga CCTCCTCCTCACGCACGTTATCG
FANCA_ex11Fgtaaaacgacggccag TTTCAAGTCTGTGGTTATAGTGG410
FANCA_ex11Rcaggaaacagctatga AGACGTAAAAGAGGTCCTAGAAT
FANCA_ex12Fgtaaaacgacggccag CTGTGGGGCTGGTCCTTAACAAA236
FANCA_ex12Rcaggaaacagctatga AGGCAGCATGACAAGTACTAGGC
FANCA_ex13Fgtaaaacgacggccag ACATTGGTTTGCTTGGATATTGA377
FANCA_ex13Rcaggaaacagctatga CTGACAAAGAATGTTCCATCGAC
FANCA_ex14Fgtaaaacgacggccag TGCTGTAATTGCTGTGTAGTCTT411
FANCA_ex14Rcaggaaacagctatga ACTCACATGACAGAGAATCAGGT
FANCA_ex15Fgtaaaacgacggccag ACTACAGCAGCCGCCCGGACACT430
FANCA_ex15Rcaggaaacagctatga GCAGATCTGCAGGAGGCTCTTGG
FANCA_ex16Fgtaaaacgacggccag TCCCAGGCAGTTCCCAGACTAAC312
FANCA_ex16Rcaggaaacagctatga AGCTGATGACAAATCCTCGTAGA
FANCA_ex17Fgtaaaacgacggccag ACCGCTCCCTCCTCACAGACTAC334
FANCA_ex17Rcaggaaacagctatga AAGGCTGAAAAACTCAACTCAAG
FANCA_ex18Fgtaaaacgacggccag GCGCACAGCATGTGGGCCTTTAC397
FANCA_ex18Rcaggaaacagctatga GCAGCTGCTAGAGGCCTTTTCGG
FANCA_ex19Fgtaaaacgacggccag GTGCACAAGAAGACTTCATAATG284
FANCA_ex19Rcaggaaacagctatga AGTCCTTGCTTTCTACACAACTG
FANCA_ex20Fgtaaaacgacggccag CTTCTCTGTGTTGCAGCATATTC298
FANCA_ex20Rcaggaaacagctatga AGAAGAAACCTGGAAGTAGTCAT
FANCA_ex21Fgtaaaacgacggccag ATAATAGATTTGGGGATTGTAAT255
FANCA_ex21Rcaggaaacagctatga CAACAGACACTCAAGGTTAGGAA
FANCA_ex22Fgtaaaacgacggccag TGCAGTGAAGAGTCCTGTTGAGT305
FANCA_ex22Rcaggaaacagctatga ACACACCAGCCTGATGTCACTAT
FANCA_ex23Fgtaaaacgacggccag CAGTCAGCAGGATCCGTGGAATC416
FANCA_ex23Rcaggaaacagctatga GGCCCTGGAACATCTGATACGAC
FANCA_ex24Fgtaaaacgacggccag CCTTCCTGCTGCTCCCGTCC229
FANCA_ex24Rcaggaaacagctatga CAGACTTGGCCCAGCAAGAG
FANCA_ex25Fgtaaaacgacggccag CCGCTGGTGGTTGGATTAGCTGT296
FANCA_ex25Rcaggaaacagctatga TTTCCAGGGCACTGAAGACGAAT
FANCA_ex26Fgtaaaacgacggccag AGCTTGGAAGAGGGCAGTCTGCT347
FANCA_ex26Rcaggaaacagctatga CTCTTCTAATTTTATCAAACGAG
FANCA_ex27Fgtaaaacgacggccag AGACTGTCTCACAACAAACGAAC356
FANCA_ex27Rcaggaaacagctatga CGGTCCGAAAGCTGCGTAAAC
FANCA_ex28Fgtaaaacgacggccag GTTGATGGTCTGTTTCCACCTGA401
FANCA_ex28Rcaggaaacagctatga GAAGGAACGGTCACCTACGTGCT
FANCA_ex29Fgtaaaacgacggccag GACATGGAGGACTGCGTATGAGA411
FANCA_ex29Rcaggaaacagctatga GTGGCTGTGATGACTGGAACGTG
FANCA_ex30Fgtaaaacgacggccag CCCGAGCCGCCAGTCTCAACCCA411
FANCA_ex30Rcaggaaacagctatga AAAGGCAGACCCACCCTAAGCTA
FANCA_ex31Fgtaaaacgacggccag GATAAGCCTCCTTGGTCATGGTA406
FANCA_ex31Rcaggaaacagctatga TGGCAATAAATATCTTAATAGCA
FANCA_ex32Fgtaaaacgacggccag TTCCTGTGCCAGCATACTGCTCT359
FANCA_ex32Rcaggaaacagctatga GGGTGGGGACACACAGACAAGTA
FANCA_ex33Fgtaaaacgacggccag TGGGTTTCAGGGTGGTGGTTGCT356
FANCA_ex33Rcaggaaacagctatga GAACCCTTTCCTCAGTAATTCAC
FANCA_ex34Fgtaaaacgacggccag CGCCCAGGGAAGCCGTTAAGTTT333
FANCA_ex34Rcaggaaacagctatga GCGTTCTGAGAAGGCCACGAGAG
FANCA_ex35Fgtaaaacgacggccag TTCCTTCACTCTACTAGTTGTGG311
FANCA_ex35Rcaggaaacagctatga TGAGATGGTAACACCCGTGATGG
FANCA_ex36Fgtaaaacgacggccag CCATCTCAGCCACCCTCATCTGT350
FANCA_ex36Rcaggaaacagctatga AGGCGCCCACCACCACGAGAACT
FANCA_ex37Fgtaaaacgacggccag GACTTGGTTTCTATGGCGTGGTT310
FANCA_ex37Rcaggaaacagctatga CCCAGAGAAATAGCACTGATTGA
FANCA_ex38Fgtaaaacgacggccag GTTTTCTAAGATCCACTTAAAGG362
FANCA_ex38Rcaggaaacagctatga CTCACTCACACTTCCGCAAACAC
FANCA_ex39Fgtaaaacgacggccag CTGTCCAGAGGCCCAGTATTACC387
FANCA_ex39Rcaggaaacagctatga AGGAGGGCTCGTTCTTAACCATT
FANCA_ex40Fgtaaaacgacggccag GGTGTCCCCAGCACTGATAATAG353
FANCA_ex40Rcaggaaacagctatga AGACATAGTGACAAATGGCTACA
FANCA_ex41Fgtaaaacgacggccag CCCTTGGCATCACCTGCTACCTT403
FANCA_ex41Rcaggaaacagctatga AACAGGCAAACTCACAGGTTAGA
FANCA_ex42Fgtaaaacgacggccag ACCAGCCCTGTTTCTGTATGTCT248
FANCA_ex42Rcaggaaacagctatga ACATGGCCCAGGCAGCTGTCAAT
FANCA_ex43Fgtaaaacgacggccag TGTGGGGGACATGAGAATTGACA378
FANCA_ex43Rcaggaaacagctatga GTAATCCACTTTTTAGTGCAACA
FANCAIVS10Fgtaaaacgacggccag TTTACATGTGCATCAGTTAGCTT184
FANCAIVS10Rcaggaaacagctatga CATGAAGACACAGAAAAAGTAGGT

(b)

FANCC
Primer nameSequence (5′ > 3′)Product length (bp)

FANCC_ex1F
FANCC_ex1R
gtaaaacgacggccag ACCATTTCCTTCAGTGCTGGACA
caggaaacagctatga CCATCGGCACTTCAGTCAATACC
378
FANCC_ex2F
FANCC_ex2R
gtaaaacgacggccag CTAAACAAGAAGCATTCACGTTC
caggaaacagctatga GGAGAAAGGTTCATAATGTAAGC
303
FANCC_ex3F
FANCC_ex3R
gtaaaacgacggccag TCAGCAGAAAGAGAATGTGCAAA
caggaaacagctatga AACATCATAGAACTGGATTCCAC
405
FANCC_ex4F
FANCC_ex4R
gtaaaacgacggccag TGTACATAAAAGGCACTTGCATT
caggaaacagctatga TCCCATCTCACATTTCTTCCGTA
380
FANCC_ex5F
FANCC_ex5R
gtaaaacgacggccag AGAACTGATGTAATCCTGTTTGC
caggaaacagctatga TTACTGCTCTGTGAGAGTTGAGA
367
FANCC_ex6F
FANCC_ex6R
gtaaaacgacggccag GTCTTTGACCTTTTTAGCATGAA
caggaaacagctatga AACGTTTGGACACTGCTGTCGTA
387
FANCC_ex7F
FANCC_ex7R
gtaaaacgacggccag ATTAGTGATTGCATTTTGAACTT
caggaaacagctatga CAAAAATAAAATGTAAATACACG
422
FANCC_ex8F
FANCC_ex8R
gtaaaacgacggccag CTCCTTTGGCTGATAATAGCAAG
caggaaacagctatga CTGATTTTTGAGTTTTTACCTCT
336
FANCC_ex9F
FANCC_ex9R
gtaaaacgacggccag ATACTGCTGAAGCTTATGGCACA
caggaaacagctatga TAACCTTTGTTGGGGCACTCATT
400
FANCC_ex10F
FANCC_ex10R
gtaaaacgacggccag TATGAGGTTATTGGGAGCTTATT
caggaaacagctatga CTGTCTCCCTCATGCTGTAGATA
382
FANCC_ex11F
FANCC_ex11R
gtaaaacgacggccag GAACCAGAAGTAAAGGGCGTCTC
caggaaacagctatga CTGACCTGCTCCAAGCCATCCGT
416
FANCC_ex12F
FANCC_ex12R
gtaaaacgacggccag AAGTACAATTTAAGCCAACCGTT
caggaaacagctatga AGGTTGCCATGACATATGCCATC
451
FANCC_ex13F
FANCC_ex13R
gtaaaacgacggccag CCTCTCTCAGGGGCCAGTGCTTA
caggaaacagctatga AGACCCTCGGACAGGTAACCCAC
435
FANCC_ex14F
FANCC_ex14R
gtaaaacgacggccag ACTTGCTATGCTAATCACCTTGC
caggaaacagctatga AATGCGTGGCCACAGGTCATCAC
437

(c)

FANCE
Primer nameSequence (5′ > 3′)Product length (bp)

FANCE_ex1F
FANCE_ex1R
gtaaaacgacggccag CGCCTCCCTCCTTCCCTTTC
caggaaacagctatga CCCGCCTCCCATACCTGCTAA
540
FANCE_ex2aF
FANCE_ex2aR
gtaaaacgacggccag GCTCTGCCCAGTCTGCCTTGTGC
caggaaacagctatga CTCTGAGTCCTTTCTGCGTTTCC
469
FANCE_ex2bF
FANCE_ex2bR
gtaaaacgacggccag GCCAGAGACAGCTCCAAAGTCTA
caggaaacagctatga CAGCCTTCCCCATGGATAAAGCC
479
FANCE_ex3F
FANCE_ex3R
gtaaaacgacggccag GCCTCTTGACTTTCTTGAATCAT
caggaaacagctatga ACTGTCCTCAGACCTTTACTCCA
352
FANCE_ex4F
FANCE_ex4R
gtaaaacgacggccag TTGAACCAAGTGTAGACTTACCA
caggaaacagctatga GGGAAGGAACCAAGGGCTAAAAG
436
FANCE_ex5F
FANCE_ex5R
gtaaaacgacggccag GTATCTTTTAGCCCTTGGTTCCT
caggaaacagctatga GAATCCCCTCTCTCAAGTACCAC
431
FANCE_ex6F
FANCE_ex6R
gtaaaacgacggccag TTTCCTTTGTAACATGTATCATC
caggaaacagctatga AGCAGAAAGCAGGGAGGCGGTAA
433
FANCE_ex7F
FANCE_ex7R
gtaaaacgacggccag ACAGGCTGGGCATTCTGTTACCG
caggaaacagctatga AGTGAGACACAAGGATCCCCTAA
425
FANCE_ex8F
FANCE_ex8R
gtaaaacgacggccag TTGGAGCAGCAGATAGATACTCA
caggaaacagctatga AGAGGTGGAGCTGAAGTGACCAT
380
FANCE_ex9F
FANCE_ex9R
gtaaaacgacggccag GTTACCTGCCCAGGGTCACCTAG
caggaaacagctatga CTGGCCAGCACTCAGGGTTTTAT
388
FANCE_ex10F
FANCE_ex10R
gtaaaacgacggccag TGGCCTCCTCTCTCCTCAATAGA
caggaaacagctatga AACAGGGAGGCAGTTGCAATCTG
369

(d)

FANCF
Primer nameSequence (5′ > 3′)Product length (bp)

FANCF_ex1aF
FANCF_ex1aR
gtaaaacgacggccag TTTCGCGGATGTTCCAATCAGTA
caggaaacagctatga CTGCACCAGGTGGTAACGAGCTG
449
FANCF_ex1bF
FANCF_ex1bR
gtaaaacgacggccag AGTGGAGGCAAGAGGGCGGCTTT
caggaaacagctatga GCTATCACCTTCAGGAAGTTGTT
456
FANCF_ex1cF
FANCF_ex1cR
gtaaaacgacggccag CCCAAATCTCCAGGAGGACTCTC
caggaaacagctatga TTTCTGAAGGTCATAGTGCAAAC
444
FANCF_ex1dF
FANCF_ex1dR
gtaaaacgacggccag GCTTTTGACTTTAGTGACTAGCC
caggaaacagctatga ATTTGGTGAGAACATTGTAATTT
456

(e)

FANCG
Primer nameSequence (5′ > 3′)Product length (bp)

FANCG_ex1F
FANCG_ex1R
gtaaaacgacggccag AGCCTGGGCGGGTGGATTGGGAC
caggaaacagctatga TCATTTCTGGCTCTTTGGTCAAG
389
FANCG_ex2F
FANCG_ex2R
gtaaaacgacggccag CAGGCCAAGGTAACACGGTTGCT
caggaaacagctatga CCAGTCTCCTCTGTGCCTTAAAC
460
FANCG_ex3F
FANCG_ex3R
gtaaaacgacggccag TATTGTAGCTGTTTTGGTTGGAG
caggaaacagctatga GGTGACAGATGTTGTTTATCCTC
362
FANCG_ex4F
FANCG_ex4R
gtaaaacgacggccag GGAGATGGAGGATGAGGTGCTAC
caggaaacagctatga CGACCACCAACCCAGCCGCCTGT
411
FANCG_ex5F
FANCG_ex5R
gtaaaacgacggccag AGATGGAGATAGGAGAAGACGAG
caggaaacagctatga GCTTCATGAAGGCTGCTTAGTGC
454
FANCG_ex6F
FANCG_ex6R
gtaaaacgacggccag CAGTTCCATGGGCTTCTTAGACC
caggaaacagctatga TCAGGGCTGCAACCAAGTACAAC
393
FANCG_ex7F
FANCG_ex7R
gtaaaacgacggccag GCACTGGGGTCCTGTCACCGTAA
caggaaacagctatga ATAATCTTTGGGAGCCATACTTC
418
FANCG_ex8F
FANCG_ex8R
gtaaaacgacggccag GCTTGTGATGGGGTGACTTGACT
caggaaacagctatga AGTTCAGGTCTAGAAGCAAGGTA
438
FANCG_ex9F
FANCG_ex9R
gtaaaacgacggccag CCTCCTCAGGGCCCATGAACATC
caggaaacagctatga GCAGTGTCTTGAAAGGCATGAGC
400
FANCG_ex10F
FANCG_ex10R
gtaaaacgacggccag CAGGACTCTGCATGGTACCAG
caggaaacagctatga CCAATCAGAAAATCATCCCTC
460
FANCG_ex11F
FANCG_ex11R
gtaaaacgacggccag AGCTCCATGTTCACCTACTTACC
caggaaacagctatga CAGTGCCGCATCTGACTTACATC
397
FANCG_ex12F
FANCG_ex12R
gtaaaacgacggccag AGGATTTGGGGTTTTGGTGACTG
caggaaacagctatga AACTCTTGGGAGCCCTGCATACA
445
FANCG_ex13F
FANCG_ex13R
gtaaaacgacggccag CCGCTTCCATATGTGAGTGTAGG
caggaaacagctatgaC CACAATAGGTCCAAGGACTCTA
340
FANCG_ex14F
FANCG_ex14R
gtaaaacgacggccag CCAAACTAAGGGGTCACATGAAG
caggaaacagctatga GATGGTGAAGCAGAAAGCCCTCC
405

(f)

FANCB
Primer nameSequence (5′ > 3′)Product length (bp)

FANCB_ex3AF
FANCB_ex3AR
gtaaaacgacggccag GATATGGTTATTTGAATTCTTAGCAcaggaaacagctatga GCCATCCTTCATCTCATAGCCTAGT721
FANCB_ex3BF
FANCB_ex3BR
gtaaaacgacggccag ATTAACCTCCCTTACATTGTGATAGcaggaaacagctatga CAATAAGACTCCAGAATGAACTCTA811
FANCB_ex4F
FANCB_ex4R
gtaaaacgacggccag TTTACAAATGACAACTACATGAcaggaaacagctatga TTAAGTATAAAACCACCAATAT391
FANCB_ex5F
FANCB_ex5R
gtaaaacgacggccag ACTGCATCTGGCCTATAGTTcaggaaacagctatga AATACCATTTTTACCCAAGC411
FANCB_ex6F
FANCB_ex6R
gtaaaacgacggccag GTATTTCCTGAATTATTGGTATGTC
caggaaacagctatga CATAAAAGTCCACCATTATAACCTC
395
FANCB_ex7F
FANCB_ex7R
gtaaaacgacggccag TGTTTGGGCCATAAGCCCTA
caggaaacagctatga TTCTGGAGCATCAAGACAGT
355
FANCB_ex8F
FANCB_ex8R
gtaaaacgacggccag GTTGTTTGTATGACATTTAATCATC
caggaaacagctatga ATCATTAAACTCTGCCCATTATCAG
636
FANCB_ex9F
FANCB_ex9R
gtaaaacgacggccag AGGTAATTTTGTTGGCACTT
caggaaacagctatga ATGCGTTCATTCATGCTAGG
531
FANCB_ex10F
FANCB_ex10R
gtaaaacgacggccag AATTGGTTCTGTTTATCATTATGGT
caggaaacagctatga CTACTACAGTAAGCCTCGGTGTTTA
686

PCR conditions:
PCR was performed in Applied Biosystems PE9700 system using 96-well plates. PCR reactions (final volume 25  l) contained 0.5 units Platinum Taq polymerase (Invitrogen), 1,5 mM MgCl2, 0.2 mM NTPs (Invitrogen), and 10 pmol primer.
For the large majority of amplicons, standard PCR conditions were used: preheat 95°C, 5 min, denaturation 95°C, 30 sec, annealing 60°C, 30 sec., elongation 72°C, 1 min, number of cycles: 33.
Fragments with a different annealing temperature were FANCA exons 5, 7, 13, 21, 26, 31, and 38, FANCC exon 7, FANCF fragment 1d and FANCE exon 1 : 55°C; FANCA exon 1 : 64°C. For FANCE exon 1 the PCR mix was supplemented with 10% DMSO.
For FANCB different PCR conditions were used: preheat 95°C, 5 min, denaturation 95°C, 1 min, annealing 50°C, 1 min., elongation 72°C, 1 min., number of cycles 30. For FANCB exon 7 and 9 the annealing temperature was 55°C. For sequencing of exon 7 forward, a special sequencing primer was used: 5′-TTTTTAGAAGGAATGTCTTG-3′.
FA gene specific part of the primer is indicated in capitals. Primers are extended with M13 sequence (indicated in normal letter type), which is used for the sequencing reaction.

After screening FANCA, -C, -E, -F, -G, and –B, a molecular diagnosis is obtained for ~85% of the patients [34]. In our cohort of 54 patients, referred to our diagnostic service since 2008, mutations were detected in 45 patients (83%). FANCA mutations were found in 31 of the patients (57%), FANCC mutations in 6 patients (11%), and FANCG mutations in 5 patients (9%). FANCB, FANCE, and FANCF mutations were found in single families (Table 3). In the small group of patients without mutations no complementation analysis or FANCD2 western blotting was performed. Therefore, we do not know if we missed FANCA, -C, -E, -F, -G, and -B mutations in these patients or that these patients have mutations in other FA genes. Table 3 does not include prenatal cases, because prenatal testing is only offered in couples in which the FA-causing mutations are already established. Testing was offered as a diagnostic service for which a fee was charged.

For the patients negative for FANCA, -C, -E, -F, -G, and -B mutations, next generation sequencing can be used to analyze all other FA genes. If this technique is not available, further analysis will depend on the availability of growing cells from the proband. In that case a western blot should reveal whether both FANCD2 isoforms are present at normal levels.(1)If both FANCD2 bands are absent or very weak, FANCD2 is sequenced. Because of the presence of FANCD2 pseudogene sequences in the genome, this testing must be performed on cDNA or gDNA using specially designed primers [26].(2)If only the short isoform of FANCD2 is present, FANCL and FANCM are sequenced. If no mutations are found, the patient may be mutated in FANCI or in another unidentified FA gene acting upstream of FANCD2.(3)If both isoforms are present, and if the clinical phenotype is compatible with FA-D1 or FA-N, BRCA2/FANCD1 and PALB2/FANCN are screened by MLPA and DNA sequencing.(4)If negative, BRIP1/FANCJ, PALB2/FANCN, RAD51C/FANCO, and SLX4/FANCP are sequenced.(5)If negative again, the patient should be screened for mutations in NBS1, ESCO2 and DDX11 to test for Nijmegen breakage syndrome, Roberts syndrome and Warsaw Breakage syndrome, respectively [47, 48]. The latter two syndromes can also be excluded by analyzing metaphase spreads for sister chromatid cohesion defects. If again negative, the patient is likely to be mutated in a novel FA gene acting downstream of FANCD2 ubiquitination.

3. Notes

3.1. Mutation Screening in Mosaic Patients

If an available lymphoblastoid cell line from an FA patient is phenotypically normal due to genetic reversion at the disease locus, mutation screening is still possible in the reverted cell line, since at least one mutation will be present [4951]. The second mutation may be identified through investigating the parents.

3.2. Unclassified Variants

Missense mutations or in-frame deletions or insertions should be judged using in silico prediction algorithms (SIFT, POLYPHEN2, Align GVGD). Alternatively, they can be tested for pathogenicity in a cellular transfection assay to check the ability of the variant gene product to complement the cellular FA defect in a deficient cell line (see e.g., [10, 35, 52]). Generally, these tests are only feasible in a setting where a diagnostic laboratory is equipped with a research laboratory with all necessary technology.

3.3. Functional Assignment to Genetic Subtypes

Retroviral constructs have been used to identify the FA subtype by functional complementation, as an intermediate step before a mutation screen is undertaken [36]. Although knowing the disease gene facilitates mutation screening, retroviral transduction has some drawbacks in comparison to direct mutation screening: (i) growing, MMC-sensitive cells either from a cell line or fresh blood sample are required, which are not always easy to obtain; (ii) overexpression of some FA proteins (e.g., FANCM and FANCP) may be toxic for cells; (iii) novel genetic subtypes that emerge after all known groups have been excluded and cannot be readily distinguished from false negatives, that is, transductions that for some unknown reason have failed to cause complementation; (iv) the method requires relatively advanced laboratory facilities and technology. However, functional assignment of complementation group can rapidly be provided by laboratories with capability for this type of analysis [37], which has greatly facilitated reliable genotyping for over 95% of FA patients for which viral constructs are available.

3.4. Genetic Counseling

All patients with a diagnosis of FA confirmed by mutation analysis should be referred for genetic counselling, together with their parents and siblings. Mutation testing should be performed in all sibs regardless of any clinical symptoms. A complete pedigree, including a cancer history anamnesis, should be prepared. Mutation carriers might be at increased cancer risk (see Section 3.7) whose aspect should be included in the counseling (see Section 3.7).

FA patients themselves usually have decreased fertility. Women usually have late menarche, irregular menses, and early menopause. However, pregnancies in women with FA have been described, and therefore women should be adequately informed about the risks for their offspring, which is mainly related to an increase in pregnancy-related complications [53].

Sibs of the parents of an FA patient often request carrier screening to assess their risk of getting a child with FA. If a sib appears to be carrier, this risk is still minimal because of the very low carrier frequency in the population. In the US the carrier frequency has been estimated to be about 1 in 181 [54]. The risk of a proven carrier to get a child with FA is therefore about 1 in 724. However, in small communities or in consanguineous couples this risk is much higher, and mutation screening in spouses of proven carriers may be indicated.

3.5. Prenatal Diagnosis

Prenatal diagnosis of FA is relatively straightforward after the pathogenic mutations in a given family have been identified. Fetal cells can be obtained by chorionic villus sampling (CVS) during weeks 10–12 of the pregnancy or by amniocentesis, which is performed between weeks 14 and 16. However, CVS may be preferred as the diagnosis will be known at an earlier stage. If the mutation is not known, a chromosomal breakage test on fetal material may be performed [55], but this test may be considered less reliable than screening for mutations in the fetal material. Alternatively, flow cytometric testing of MMC sensitivity in amniotic cell cultures might be an option; however this technique is only available in a limited number of specialized laboratories [56]. Occasionally, FA may be suspected by fetal ultrasound imaging and confirmed by parental carrier testing when the family is not yet known to carry a risk for FA [57].

3.6. Genotype-Phenotype Correlation

FA is considered as one disease, and the question may be raised whether all fifteen genetic subtypes equally conform to the clinical FA phenotype. Genotype-phenotype correlation studies comparing the 3 most common groups A, C, and G indicated modest phenotypic differences, which were rather correlated with the relative severity of the mutations [23]. However, bias due to the ethnic distribution of the studied population is very well possible. Other studies reported significant differences between FA-A/G versus FA-C [58]. Cases in group FA-D1 (mutated in BRCA2) and FA-N (mutated in PALB2) present with a distinct, relatively severe, phenotype that is characterized by the development of leukemia at very young age (median 2.2 years) and by pediatric cancers such as nephroblastoma (Wilms tumor) or medulloblastoma [4044]. The observations that one of the pathogenic mutations in BRCA2 in FA-D1 patients is hypomorphic and that mice with biallelic null alleles in Brca2 are embryonic lethals suggest that the BRCA2 protein serves a function that is essential for survival.

Different mutations in the same gene may be associated with divergent phenotypes, as illustrated by the two FANCC mutations, c.711+4A>T and c.67delG. The former (splice-site) mutation is associated with a relatively severe phenotype in Ashkenazi Jewish people [19] although the associated phenotype was reportedly less severe in patients of Japanese ancestry [20]. The carrier frequency for this mutation in the Ashkenazi population is relatively high (1 in 87), which has led to the recommendation of carrier detection to prevent disease [59]. In the Netherlands more than 50% of FA cases are homozygous for the FANCC frameshift mutation c.67delG. The phenotype associated with this mutation, like other exon 1 mutations, seems relatively mild, as these patients rarely have skeletal abnormalities and show a relatively late age of onset of their marrow failure [24]. Awareness of such genetically determined phenotypic differences may help in clinical decision making, including the counselling of patients and families.

3.7. Cancer Risk in Heterozygous Mutation Carriers

An important issue is whether FA mutation carriers are at increased risk to develop cancer or other types of disease. Overall, there is no increased risk for cancer among FA heterozygotes [60, 61]. However, the situation is different in some of the less prevalent FA subtypes. The FA-D1 subtype is caused by mutations in BRCA2 [62] which is a well-known breast and ovarian cancer predisposition gene [63]. In FA-D1 one of the mutations will be hypomorphic because biallelic “severe” mutations are supposed to be lethal [26]. Therefore, one of the parents of a FA-D1 patient will be a heterozygous carrier of a “severe” inactivating BRCA2 mutation and may thus have an increased risk for breast cancer and other BRCA2-associated cancers. Whether the parent with the hypomorphic mutation is also at increased risk is unknown: in breast cancer families these hypomorphic mutations are considered as variants with unknown clinical significance. Two other genes involved in FA and related to breast or ovarian cancer predisposition are PALB2/FANCN [64, 65] and RAD51C/FANCO [66]. Although cancer patients have been identified with germ-line mutations in these genes, an accurate estimate of the relative cancer risk for mutation carriers is still lacking.

Another special case is represented by female FANCB mutation carriers, who are supposed to consist of 50% FA-like cells due to silenced expression of the wild type FANCB allele by the random process of X inactivation that occurs during early embryonic development. Nevertheless, in the few female FANCB mutation carriers studied so far, inactivation appeared strongly skewed towards the mutated allele [67]. This suggests that FA cells have a poor chance to survive next to unaffected cells in the same tissue, and these FA cells may therefore not give an increased cancer risk. However, the data are scarce at present so that no firm conclusions can be drawn regarding the cancer risk of female FANCB mutation carriers [60].

Conflict of Interests

The authors do not declare any conflict of interests related to this study.

Acknowledgments

The authors thank the Fanconi Anemia Research Fund, Inc., Eugene, OR, the Netherlands Organization for Health and Development, and the Dutch Cancer Society, for financial support.

References

  1. J. P. de Winter and H. Joenje, “The genetic and molecular basis of Fanconi anemia,” Mutation Research, vol. 668, no. 1-2, pp. 11–19, 2009. View at: Publisher Site | Google Scholar
  2. F. Vaz, H. Hanenberg, B. Schuster et al., “Mutation of the RAD51C gene in a Fanconi anemia-like disorder,” Nature Genetics, vol. 42, no. 5, pp. 406–409, 2010. View at: Publisher Site | Google Scholar
  3. C. Stoepker, K. Hain, B. Schuster et al., “SLX4, a coordinator of structure-specific endonucleases, is mutated in a new Fanconi anemia subtype,” Nature Genetics, vol. 43, no. 2, pp. 138–141, 2011. View at: Publisher Site | Google Scholar
  4. Y. Kim, F. P. Lach, R. Desetty, H. Hanenberg, A. D. Auerbach, and A. Smogorzewska, “Mutations of the SLX4 gene in Fanconi anemia,” Nature Genetics, vol. 43, no. 2, pp. 142–146, 2011. View at: Publisher Site | Google Scholar
  5. M. Levitus, H. Joenje, and J. P. de Winter, “The Fanconi anemia pathway of genomic maintenance,” Cellular Oncology, vol. 28, no. 1-2, pp. 3–29, 2006. View at: Google Scholar
  6. A. J. Deans and S. C. West, “DNA interstrand crosslink repair and cancer,” Nature Reviews Cancer, vol. 11, no. 7, pp. 467–480, 2011. View at: Publisher Site | Google Scholar
  7. A. R. Meetei, J. P. de Winter, A. L. Medhurst et al., “A novel ubiquitin ligase is deficient in Fanconi anemia,” Nature Genetics, vol. 35, no. 2, pp. 165–170, 2003. View at: Publisher Site | Google Scholar
  8. E. Blom, “Evolutionary clues to the molecular function of Fanconi anemia genes,” in Thesis, VU University Medical Center, Amsterdam, The Netherlands, 2006. View at: Google Scholar
  9. S. C. West, “Molecular views of recombination proteins and their control,” Nature Reviews Molecular Cell Biology, vol. 4, no. 6, pp. 435–445, 2003. View at: Publisher Site | Google Scholar
  10. E. Blom, H. J. van de Vrugt, Y. de Vries, J. P. de Winter, F. Arwert, and H. Joenje, “Multiple TPR motifs characterize the Fanconi anemia FANCG protein,” DNA Repair, vol. 3, no. 1, pp. 77–84, 2004. View at: Publisher Site | Google Scholar
  11. M. Levitus, Q. Waisfisz, B. C. Godthelp et al., “The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J,” Nature Genetics, vol. 37, no. 9, pp. 934–935, 2005. View at: Publisher Site | Google Scholar
  12. O. Levran, C. Attwooll, R. T. Henry et al., “The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia,” Nature Genetics, vol. 37, no. 9, pp. 931–933, 2005. View at: Publisher Site | Google Scholar
  13. A. R. Meetei, A. L. Medhurst, C. Ling et al., “A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M,” Nature Genetics, vol. 37, no. 9, pp. 958–963, 2005. View at: Publisher Site | Google Scholar
  14. O. Levran, T. Erlich, N. Magdalena et al., “Sequence variation in the Fanconi anemia gene FAA,” Proceedings of the National Academy of Sciences of the United States of America, vol. 94, no. 24, pp. 13051–13056, 1997. View at: Publisher Site | Google Scholar
  15. N. Magdalena, D. V. Pilonetto, M. A. Bitencourt et al., “Frequency of Fanconi anemia in Brazil and efficacy of screening for the FANCA 3788-3790del mutation,” Brazilian Journal of Medical and Biological Research, vol. 38, no. 5, pp. 669–673, 2005. View at: Google Scholar
  16. O. Levran, R. Diotti, K. Pujara, S. D. Batish, H. Hanenberg, and A. D. Auerbach, “Spectrum of sequence variations in the FANCA gene: an International Fanconi Anemia Registry (IFAR) study,” Human Mutation, vol. 25, no. 2, pp. 142–149, 2005. View at: Publisher Site | Google Scholar
  17. A. J. Tipping, T. Pearson, N. V. Morgan et al., “Molecular and genealogical evidence for a founder effect in Fanconi anemia families of the Afrikaner population of South Africa,” Proceedings of the National Academy of Sciences of the United States of America, vol. 98, no. 10, pp. 5734–5739, 2001. View at: Publisher Site | Google Scholar
  18. E. Callen, J. A. Casado, M. D. Tischkowitz et al., “A common founder mutation in FANCA underlies the world's highest prevalence of Fanconi anemia in Gypsy families from Spain,” Blood, vol. 105, no. 5, pp. 1946–1949, 2005. View at: Google Scholar
  19. A. P. Gillio, P. C. Verlander, S. D. Batish, P. F. Giampietro, and A. D. Auerbach, “Phenotypic consequences of mutations in the Fanconi anemia FAC gene: an international Fanconi anemia registry study,” Blood, vol. 90, no. 1, pp. 105–110, 1997. View at: Google Scholar
  20. M. Futaki, T. Yamashita, H. Yagasaki et al., “The IVS4 + 4A to T mutation of the Fanconi anemia gene FANCC is not associated with a severe phenotype in Japanese patients,” Blood, vol. 95, no. 4, pp. 1493–1498, 2000. View at: Google Scholar
  21. M. A. Whitney, H. Saito, P. M. Jakobs, R. A. Gibson, R. E. Moses, and M. Grompe, “A common mutation in the FACC gene causes Fanconi anaemia in Ashkenazi Jews,” Nature Genetics, vol. 4, no. 2, pp. 202–205, 1993. View at: Publisher Site | Google Scholar
  22. D. Kutler and A. Auerbach, “Fanconi anemia in Ashkenazi Jews,” Familial Cancer, vol. 3, no. 3-4, pp. 241–248, 2004. View at: Publisher Site | Google Scholar
  23. L. Faivre, P. Guardiola, C. Lewis et al., “Association of complementation group and mutation type with clinical outcome in Fanconi anemia,” Blood, vol. 96, no. 13, pp. 4064–4070, 2000. View at: Google Scholar
  24. T. Yamashita, N. Wu, G. Kupfer et al., “Clinical variability of Fanconi anemia (type C) results from expression of an amino terminal truncated Fanconi anemia complementation group C polypeptide with partial activity,” Blood, vol. 87, no. 10, pp. 4424–4432, 1996. View at: Google Scholar
  25. H. Joenje, “Fanconi anaemia complementation groups in Germany and the Netherlands,” Human Genetics, vol. 97, no. 3, pp. 280–282, 1996. View at: Publisher Site | Google Scholar
  26. R. Kalb, K. Neveling, H. Hoehn et al., “Hypomorphic mutations in the gene encoding a key Fanconi anemia protein, FANCD2, sustain a significant group of FA-D2 patients with severe phenotype,” American Journal of Human Genetics, vol. 80, no. 5, pp. 895–910, 2007. View at: Publisher Site | Google Scholar
  27. I. Demuth, M. Wlodarski, A. J. Tipping et al., “Spectrum of mutations in the Fanconi anaemia group G gene, FANCG/XRCC9,” European Journal of Human Genetics, vol. 8, no. 11, pp. 861–868, 2000. View at: Publisher Site | Google Scholar
  28. A. D. Auerbach, J. Greenbaum, K. Pujara et al., “Spectrum of sequence variation in the FANCG gene: an International Fanconi Anemia Registry (IFAR) study,” Human Mutation, vol. 21, no. 2, pp. 158–168, 2003. View at: Publisher Site | Google Scholar
  29. H. Yagasaki, T. Oda, D. Adachi et al., “Two common founder mutations of the fanconi anemia group G gene FANCG/XRCC9 in the Japanese population,” Human mutation, vol. 21, no. 5, p. 555, 2003. View at: Google Scholar
  30. N. V. Morgan, F. Essop, I. Demuth et al., “A common Fanconi anemia mutation in black populations of sub-Saharan Africa,” Blood, vol. 105, no. 9, pp. 3542–3544, 2005. View at: Publisher Site | Google Scholar
  31. J. Rosendorff and R. Bernstein, “Fanconi's anemia—chromosome breakage studies in homozygotes and heterozygotes,” Cancer Genetics and Cytogenetics, vol. 33, no. 2, pp. 175–183, 1988. View at: Google Scholar
  32. B. P. Alter, “Diagnostic evaluation of FA,” in Fanconi Anemia: Guidelines for Diagnosis and Management, M. E. Eiler et al., Ed., pp. 33–48, Fanconi Anemia Research Fund, Eugene, Ore, USA, 2008. View at: Google Scholar
  33. M. Castella, R. Pujol, E. Callen et al., “Origin, functional role, and clinical impact of Fanconi anemia FANCA mutations,” Blood, vol. 117, no. 14, pp. 3759–3769, 2011. View at: Google Scholar
  34. N. Ameziane, A. Errami, F. Léveillé et al., “Genetic subtyping of Fanconi anemia by comprehensive mutation screening,” Human Mutation, vol. 29, no. 1, pp. 159–166, 2008. View at: Publisher Site | Google Scholar
  35. J. R. Lo Ten Foe, M. T. Barel, P. Thuß, M. Digweed, F. Arwert, and H. Joenje, “Sequence variations in the Fanconi anaemia gene, FAC: pathogenicity of 1806insA and R548X and recognition of D195V as a polymorphic variant,” Human Genetics, vol. 98, no. 5, pp. 522–523, 1996. View at: Publisher Site | Google Scholar
  36. H. Hanenberg, S. D. Batish, K. E. Pollok et al., “Phenotypic correction of primary Fanconi anemia T cells with retroviral vectors as a diagnostic tool,” Experimental Hematology, vol. 30, no. 5, pp. 410–420, 2002. View at: Publisher Site | Google Scholar
  37. S. Chandra, O. Levran, I. Jurickova et al., “A rapid method for retrovirus-mediated identification of complementation groups in Fanconi anemia patients,” Molecular Therapy, vol. 12, no. 5, pp. 976–984, 2005. View at: Publisher Site | Google Scholar
  38. T. N. Kaiser, A. Lojewski, C. Dougherty, L. Juergens, E. Sahar, and S. A. Latt, “Flow cytometric characterization of the response of Fanconi's anemia cells to mitomycin C treatment,” Cytometry, vol. 2, no. 5, pp. 291–297, 1982. View at: Google Scholar
  39. F. O. Pinto, T. Leblanc, D. Chamousset et al., “Diagnosis of Fanconi anemia in patients with bone marrow failure,” Haematologica, vol. 94, no. 4, pp. 487–495, 2009. View at: Publisher Site | Google Scholar
  40. B. Hirsch, A. Shimamura, L. Moreau et al., “Association of biallelic BRCA2/FANCD1 mutations with spontaneous chromosomal instability and solid tumors of childhood,” Blood, vol. 103, no. 7, pp. 2554–2559, 2004. View at: Publisher Site | Google Scholar
  41. J. E. Wagner, J. Tolar, O. Levran et al., “Germline mutations in BRCA2: shared genetic susceptibility to breast cancer, early onset leukemia, and Fanconi anemia,” Blood, vol. 103, no. 8, pp. 3226–3229, 2004. View at: Publisher Site | Google Scholar
  42. K. Offit, O. Levran, B. Mullaney et al., “Shared genetic susceptibility to breast cancer, brain tumors, and Fanconi anemia,” Journal of the National Cancer Institute, vol. 95, no. 20, pp. 1548–1551, 2003. View at: Google Scholar
  43. S. Reid, D. Schindler, H. Hanenberg et al., “Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer,” Nature Genetics, vol. 39, no. 2, pp. 162–164, 2007. View at: Publisher Site | Google Scholar
  44. B. Xia, J. C. Dorsman, N. Ameziane et al., “Fanconi anemia is associated with a defect in the BRCA2 partner PALB2,” Nature Genetics, vol. 39, no. 2, pp. 159–161, 2007. View at: Publisher Site | Google Scholar
  45. K. Somyajit, S. Subramanya, and G. Nagaraju, “RAD51C: a novel cancer susceptibility gene is linked to Fanconi anemia and breast cancer,” Carcinogenesis, vol. 31, no. 12, pp. 2031–2038, 2010. View at: Publisher Site | Google Scholar
  46. J. P. Schouten, C. J. McElgunn, R. Waaijer, D. Zwijnenburg, F. Diepvens, and G. Pals, “Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification,” Nucleic acids research, vol. 30, no. 12, p. e57, 2002. View at: Google Scholar
  47. A. R. Gennery, M. A. Slatter, A. Bhattacharya et al., “The clinical and biological overlap between Nijmegen Breakage syndrome and Fanconi anemia,” Clinical Immunology, vol. 113, no. 2, pp. 214–219, 2004. View at: Publisher Site | Google Scholar
  48. P. van der Lelij, A. B. Oostra, M. A. Rooimans, H. Joenje, and J. P. de Winter, “Diagnostic overlap between Fanconi anemia and the cohesinopathies: roberts syndrome and Warsaw Breakage syndrome,” Anemia, vol. 2010, Article ID 565268, 7 pages, 2010. View at: Publisher Site | Google Scholar
  49. J. R. Lo Ten Foe, M. L. Kwee, M. A. Rooimans et al., “Somatic mosaicism in Fanconi anemia: molecular basis and clinical significance,” European Journal of Human Genetics, vol. 5, no. 3, pp. 137–148, 1997. View at: Google Scholar
  50. Q. Waisfisz, N. V. Morgan, M. Savino et al., “Spontaneous functional correction of homozygous Fanconi anaemia alleles reveals novel mechanistic basis for reverse mosaicism,” Nature Genetics, vol. 22, no. 4, pp. 379–383, 1999. View at: Publisher Site | Google Scholar
  51. B. P. Alter, H. Joenje, A. B. Oostra, and G. Pals, “Fanconi anemia: adult head and neck cancer and hematopoietic mosaicism,” Archives of Otolaryngology, vol. 131, no. 7, pp. 635–639, 2005. View at: Publisher Site | Google Scholar
  52. A. L. Medhurst, E. H. Laghmani, J. Steltenpool et al., “Evidence for subcomplexes in the Fanconi anemia pathway,” Blood, vol. 108, no. 6, pp. 2072–2080, 2006. View at: Publisher Site | Google Scholar
  53. B. P. Alter, C. L. Frissora, D. S. Halperin et al., “Fanconi's anaemia and pregnancy,” British Journal of Haematology, vol. 77, no. 3, pp. 410–418, 1991. View at: Google Scholar
  54. P. S. Rosenberg, H. Tamary, and B. P. Alter, “How high are carrier frequencies of rare recessive syndromes? Contemporary estimates for Fanconi anemia in the United States and Israel,” American Journal of Medical Genetics A, vol. 155, no. 8, pp. 1877–1883, 2011. View at: Publisher Site | Google Scholar
  55. A. D. Auerbach, “Fanconi anemia,” in Diagnosis and Treatment of the Unborn Child, M. I. New, Ed., pp. 27–35, Idelson-Gnocchi, Naples, Italy, 1999. View at: Google Scholar
  56. A. Bechtold, R. Kalb, K. Neveling et al., “Prenatal diagnosis of Fanconi anemia: functional and molecular testing,” in Fanconi Anemia. A Paradigmatic Disease for the Understanding of Cancer and Aging, D. Schindler and H. Hoehn, Eds., Monographs in Human Genetics, pp. 131–148, Karger, Basel, Switzerland, 2007. View at: Google Scholar
  57. A. Merrill, L. Rosenblum-Vos, D. A. Driscoll, K. Daley, and K. Treat, “Prenatal diagnosis of Fanconi anemia (Group C) subsequent to abnormal sonographic findings,” Prenatal Diagnosis, vol. 25, no. 1, pp. 20–22, 2005. View at: Publisher Site | Google Scholar
  58. D. I. Kutler, B. Singh, J. Satagopan et al., “A 20-year perspective on the International Fanconi Anemia Registry (IFAR),” Blood, vol. 101, no. 4, pp. 1249–1256, 2003. View at: Publisher Site | Google Scholar
  59. P. C. Verlander, A. Kaporis, Q. Liu, Q. Zhang, U. Seligsohn, and A. D. Auerbach, “Carrier frequency of the IVS4 + 4 A—> T mutation of the Fanconi anemia gene FAC in the Ashkenazi Jewish population,” Blood, vol. 86, no. 11, pp. 4034–4038, 1995. View at: Google Scholar
  60. M. Berwick, J. M. Satagopan, L. Ben-Porat et al., “Genetic heterogeneity among Fanconi anemia heterozygotes and risk of cancer,” Cancer Research, vol. 67, no. 19, pp. 9591–9596, 2007. View at: Publisher Site | Google Scholar
  61. M. Tischkowitz, D. F. Easton, J. Ball, S. V. Hodgson, and C. G. Mathew, “Cancer incidence in relatives of British Fanconi anaemia patients,” BMC Cancer, vol. 8, article 257, 2008. View at: Publisher Site | Google Scholar
  62. N. G. Howlett, T. Taniguchi, S. Olson et al., “Biallelic inactivation of BRCA2 in Fanconi anemia,” Science, vol. 297, no. 5581, pp. 606–609, 2002. View at: Publisher Site | Google Scholar
  63. E. Levy-Lahad and E. Friedman, “Cancer risks among BRCA1 and BRCA2 mutation carriers,” British Journal of Cancer, vol. 96, no. 1, pp. 11–15, 2007. View at: Publisher Site | Google Scholar
  64. N. Rahman, S. Seal, D. Thompson et al., “PALB2, which encodes a BRCA2-interacting protein, is a breast cancer susceptibility gene,” Nature Genetics, vol. 39, no. 2, pp. 165–167, 2007. View at: Publisher Site | Google Scholar
  65. M. J. Garcia, V. Fernandez, A. Osorio et al., “Analysis of FANCB and FANCN/PALB2 Fanconi anemia genes in BRCA1/2-negative Spanish breast cancer families,” Breast Cancer Research and Treatment, vol. 113, no. 3, pp. 545–551, 2009. View at: Google Scholar
  66. A. Meindl, H. Hellebrand, C. Wiek et al., “Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene,” Nature Genetics, vol. 42, no. 5, pp. 410–414, 2010. View at: Publisher Site | Google Scholar
  67. A. R. Meetei, M. Levitus, Y. Xue et al., “X-linked inheritance of Fanconi anemia complementation group B,” Nature Genetics, vol. 36, no. 11, pp. 1219–1224, 2004. View at: Publisher Site | Google Scholar

Copyright © 2012 Johan J. P. Gille et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views3990
Downloads1614
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.