BioMed Research International / 2008 / Article / Tab 2

Research Article

Proteome-Level Responses of Escherichia coli to Long-Chain Fatty Acids and Use of Fatty Acid Inducible Promoter in Protein Production

Table 2

List of primers used in PCR experiments.

PrimerPrimer sequenceaGene to be amplifiedTemplate

Primer 1aaaaccgttgatatctttgcaaacgggcatgactcctgacttttaldA promoterE. coli W3110 chromosome
Primer 2aaaaccgttgaattcctcctgtgatttatatgtttgttttc
Primer 3aaaaccgttgatatctgcagaatgaagggtgatttatgtgatttgudp promoterE. coli W3110 chromosome
Primer 4aaaaccgttgaattcctcctctgtgaatcggtttagtcaga
Primer 5ggaattcatgagtaaaggagaagaacttt GFP pGFPuv
Primer 6cccaagcttttatttgatgagctcatcc

aRestriction enzyme sites are shown in bold.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.