BioMed Research International

BioMed Research International / 2013 / Article

Research Article | Open Access

Volume 2013 |Article ID 190382 |

Norma Dominguez-Avila, Gabriel Ruiz-Castañeda, Javier González-Ramírez, Nora Fernandez-Jaramillo, Jorge Escoto, Fausto Sánchez-Muñoz, Ricardo Marquez-Velasco, Rafael Bojalil, Román Espinosa-Cervantes, Fausto Sánchez, "Over, and Underexpression of Endothelin 1 and TGF-Beta Family Ligands and Receptors in Lung Tissue of Broilers with Pulmonary Hypertension", BioMed Research International, vol. 2013, Article ID 190382, 7 pages, 2013.

Over, and Underexpression of Endothelin 1 and TGF-Beta Family Ligands and Receptors in Lung Tissue of Broilers with Pulmonary Hypertension

Academic Editor: Coline van Moorsel
Received30 Apr 2013
Revised13 Jul 2013
Accepted10 Sep 2013
Published28 Oct 2013


Transforming growth factor beta (TGFβ) is a family of genes that play a key role in mediating tissue remodeling in various forms of acute and chronic lung disease. In order to assess their role on pulmonary hypertension in broilers, we determined mRNA expression of genes of the TGFβ family and endothelin 1 in lung samples from 4-week-old chickens raised either under normal or cold temperature conditions. Both in control and cold-treated groups of broilers, endothelin 1 mRNA expression levels in lungs from ascitic chickens were higher than levels from healthy birds ( ), whereas levels in animals with cardiac failure were intermediate. Conversely, TGFβ2 and TGFβ3 gene expression in lungs were higher in healthy animals than in ascitic animals in both groups ( ). TGFβ1, TβRI, and TβRII mRNA gene expression among healthy, ascitic, and chickens with cardiac failure showed no differences ( ). BAMBI mRNA gene expression was lowest in birds with ascites only in the control group as compared with the values from healthy birds ( ).

1. Introduction

Endothelin-1 is a peptide mainly produced by endothelial cells with increased expression in pulmonary hypertension. Its action is first by a powerful vasoconstrictor effect and second as a potent mitogen that can induce proliferation in multiple cell types, including vascular smooth muscle cells, leading to remodeling of pulmonary arteries [1]. In endothelial cells, TGFβ induces endothelin-1 expression through the activation of the ALK5/Smad3 pathway [2, 3], and both participate in pulmonary artery smooth muscle hypertrophy [4]. An increased endothelin-1 mRNA level in the lungs of broilers is a common feature of natural or induced pulmonary hypertension [58].

In contrast, the transforming growth factor beta (TGFβ) family has not been documented in broilers with pulmonary hypertension. TGFβ family are cytokines whose expression increases in various forms of acute and chronic lung disease in mammals [9]. TGFβ family members affect various biological processes including cell proliferation, differentiation, migration, adhesion, apoptosis, and extracellular matrix (ECM) production. The TGFβ ligands are encoded by three distinct genes (TGFβ1, TGFβ2, and TGFβ3). They all elicit their cellular effects by inducing heterotetrameric complexes of type I and type II serine/threonine kinase transmembrane receptors (TβRI and TβRII). TGFβ accessory receptors regulate access of TGFβ family members to signaling receptors: endoglin, betaglycan, and the inhibitory pseudoreceptor BMP and activin membrane-bound inhibitor homolog (BAMBI) are the best characterized. TGFβ accessory receptors have a short intracellular domain that lacks catalytic activity. TGFβ2 can bind to TβRII only in the presence of betaglycan [10]. TGFβ signaling is silenced by the pseudo receptor BAMBI that acts as a decoy. It is closely related to TβRI in the extracellular domain but has an intracellular domain that exhibits no enzymatic activity.

In normal production conditions, pulmonary hypertension in broilers accounts for 5–7% of mortality. Mortality may increase due to housing conditions, altitude, hypoxia, and cold temperature, among others. Broilers susceptible to pulmonary hypertension undergo pathophysiological progression leading to right-side chronic heart failure, pressure-induced cirrhosis of the liver, and transudation of fluid into the abdominal cavity [1113]. Increased pulmonary artery pressure includes remodeling with hypertrophy and hyperplasia of smooth muscle cells accompanied in up to 80% of the cases by the formation of occlusive plexiform lesions (plexogenic arteriopathy) [14]. Many fast growing broilers show dilated heart and clinical signs of heart failure, but not all of these broilers develop ascites. In some instances, broilers show moderate dilation of left and right ventricles but developed massive ascites, whereas many broilers with similar or even more severe heart pathology and signs of heart failure do not develop ascites [1517]. Whether the outcome is heart failure with or without ascites, remodeling of extracellular matrix proteins is at the core. Differences in maladaptive structural changes in the major arteries and pathological remodeling in veins are observed in ascitic birds [18].

We think that differences in progression of disease in broilers may start in lung vascular endothelium. Thus, we hypothesized expression differences of endothelin-1, TGF-β1, TGF-β2, and TGF-β3, of their receptors TβRI, TβRII, and of their pseudoreceptor BAMBI in lung tissue of broilers with ascites, with right cardiac failure but without ascites and in healthy broilers. To evaluate early development of ascites and signs of pulmonary hypertension, we decided to grow broilers under normal and cold temperature. Therefore, we determined mRNA expression of these genes in lung samples from 4-week-old broilers raised either under normal or cold temperature conditions.

2. Material and Methods

Fifty-one 1-day-old male broiler chicks of a commercial strain (Arbor Acres, Tyson Foods, Torreon, COAH, Mexico) were transported to our growth facilities (Saltillo, COAH, Mexico), divided in two groups, and housed in two rooms.

The two groups were maintained with continuous lighting feed and tap water. All chickens were supplied adlibitum with a commercial mash broiler starter diet until 21 d of age and were fed a mash broiler grower diet thereafter. The birds were monitored daily for the presence of disease, weighed every week, and postmortem examination was performed in all mortalities. The first three-week birds in both groups were raised according to recommended temperatures. From day 22 to day 28, temperature was gradually reduced from 22°C to 14°C in a group (cold group). In the meantime, birds in the other group (control group) remained within recommended temperatures (21-22°C).

On days 28–30, all birds were killed by cervical dislocation, necropsied, and classed for ascites status as follows: healthy (normal, no sign of heart or liver involvement, no fluid in abdominal cavity) and cardiac failure (from mild to severe heart enlargement with flaccidity and possible hydropericardium), and ascitic (overt right ventricular hypertrophy, copious abdominal fluid with, or without fibrin clots). This classification was performed by 3 observers during necropsies and verified by anteroposterior photograph of the heart without pericardium. Samples from the apical regions of left lungs were obtained in cryotubes (1.5 mL) and snap frozen in liquid nitrogen within 15 minutes from death.

2.1. Total RNA Isolation and cDNA Synthesis

100 mg of lung tissue was disrupted with a tissue homogenizer (Polytron Kinematica) in 1 mL of TriPure reagent (ROCHE, Sciences, Maryland, USA). To avoid DNA carryover, DNase treatment was performed in all samples with DNase I recombinant (ROCHE, Sciences, Maryland, USA) and a second RNA purification step with 750 µL of TriPure. The RNA integrity evaluation, was done visualizing ribosomal RNA 18S and 28S integrity on agarose 1.5% gels stained with ethidium bromide, whereas concentration and purity were assessed by spectrophotometry on a NanoDrop 1000 (Thermo Fisher Scientific Lafayette, CO, USA).

cDNA synthesis was performed, using 1 µg of total RNA using random hexamers and the transcriptor first strand cDNA synthesis kit (ROCHE, Sciences, Maryland, USA) according to the manufacturer instructions. Finally, to evaluate DNase treatment, RT-minus reactions were performed.

2.2. RT-qPCR Analysis

We performed qPCR reaction using primers for each target and reference gene designed with the ProbeFinder software version 2.4 in combination with LNA probes from the Universal Probe Library Roche (Table 1). One µL of cDNA, was amplified with 400 nM of each primer (Invitrogen Carlsbad California, USA), 100 nM of UPL probe (ROCHE, Rotkreuz, Switzerland), the LighCycler TaqMan Master (ROCHE, Sciences, Maryland, USA), followed by 45 cycles of 95° 10 sec., 60° 30 sec. and 72° 1 sec., in a Roche LightCycler 2.0 (ROCHE, Rotkreuz, Switzerland). The mRNA relative quantification of target genes was conducted using ACTB and GAPDH as reference genes and the method. For qPCR assays quality control, determination of linearity and reproducibility was evaluated (VC < 10%) and negative amplification for RT-minus controls.

GENEGenBank PRIMERS 5′-3′Tm °CAmplicon bpProbe

EDN1 XM_418943.3gccagccagagagacaagaa606229
TGF-β1(TGF-β4) JQ423909gtccgggctctgtacaaca598717
TGF-β2 NM_001031045ccaggttctgaaatccaaaga59629
TGF-β3 NM_205454gggccctggataccaactac606225
TβR I NM_204246ggaaattgctcgtcgatgtt606531
TβR II NM_205428gagttcaagcaccacgacaa59617
BAMBI NM_001195401acagaggactgcacgatgttt596112
ACTB NM_205518gctctgactgaccgcgtta606076
GAPDH NM_204305gtcctctctggcaaagtcca606549

TGF-β1 was formerly known as TGF-β4 in chicken. In spite of claims to rename TGF-β4 as TGF-β1 [19, 20], it is until January 2012 that TGF-β1 may be located in GenBank as Gene ID: 100873157 (Gallus gallus).

Primers sequences used for RT-qPCR analysis of chicken mRNAs are shown in Table 1. Data are presented as means and standard errors. Statistical analysis of data was performed by the Kruskal-Wallis test, followed by Dunn’s post-hoc comparisons and Spearman’s correlations. was considered significant. The protocol was reviewed by the Institutional Animal Care Committee prior to being approved by the University Council on Biological and Health Sciences (Universidad Autonoma Metropolitana Xochimilco, Mexico) and complied with international guidelines for research involving animal subjects.

3. Results

Endothelin 1 mRNA expression levels in lungs from ascitic chickens were 2.5 to 2.9-fold higher than levels from healthy birds ( ) both in control and cold-treated groups of broilers, whereas levels in animals with cardiac failure were intermediate (Figure 1). Conversely, for TGFβ2 and TGFβ3 gene expression in lungs, healthy animals showed 2.1 to 2.6-fold higher expression levels than ascitic animals in both groups ( ), and any trend is observed for TGFβ1 ( ; Figure 2). No differences were observed in TβRI and TβRII mRNA gene expressions among healthy, ascitic and chickens with cardiac failure ( ; Figure 3). Neither BAMBI mRNA gene expression showed differences to mention with the exception of the lowest values observed in birds with ascites as compared with healthy control group ( ; Figure 3). Results were also analyzed using GAPDH as another reference gene, and ACTB and GAPDH results showed good correlation ( ; ) and showed the same trend.

To test associations between mRNA levels, we used Spearman’s correlation test. Negative correlations for endothelin 1 with TGFβ2 and TGFβ3 gene expression in lungs were observed (−0.56 and −0.57; ), whereas low positive correlation was found among endothelin 1 and TβRI (0.28; ). A high correlation between TGFβ2 and TGFβ3 mRNA expression levels was observed (0.76; ), and both variables correlated with BAMBI gene expression (0.44 and 0.45; ). Finally, moderate correlations among TβRI and TβRII (0.45; ) and among TβRII and BAMBI mRNA gene expression (0.38; ) were observed. Surprisingly, not any significant correlation of TGFβ1 mRNA gene expression with the other variables was observed ( ).

4. Discussion

We found higher endothelin 1 mRNA levels in ascitic broilers, both in control and cold treated groups, than corresponding levels for healthy broilers and broilers with cardiac failure but without ascites ( ). On the contrary, we found lower mRNA levels of TGF-β2 and TGF-β3 in ascitic broilers, in control, and in cold treated groups than corresponding levels in healthy broilers and with cardiac failure but without ascites ( ). In addition, we do not found any differences for TGFβ1, TβRI, and TβRII mRNA gene expression among healthy, ascetic, and chickens with cardiac failure.

As in this study, increased endothelin 1 mRNA levels have been previously reported in the lungs of broilers with natural or induced pulmonary hypertension compared to nonpulmonary hypertensive broilers [58]. Also, upregulated gene expression of endothelin 1 has been observed in the heart of broilers as compared with layer chickens [21] and in the heart of broiler chickens with T(3)-induced pulmonary hypertension with respect to their internal controls [22]. Endothelin 1 is produced in small amounts mainly by endothelial cells; however, in pathophysiological conditions, its production is stimulated in a large number of different cell types, including endothelial cells, vascular smooth muscle cells, fibroblasts, and inflammatory cells such as macrophages and leukocytes processes [23]. The increases of endothelin 1 mRNA levels in lung and heart are a hallmark of pulmonary hypertension syndrome in broilers.

Downregulation of mRNA levels of TGF-β2 and TGF-β3 in lungs from broilers with ascites is a novel finding both in control and cold groups. These results may be paralleled to previous findings obtained by immunohistochemistry methods. TGFβ1 mRNA expression in alveolar macrophages from lung tissue from patients with idiopathic pulmonary fibrosis is abundant in sites of active fibrosis but not in the lung parenchyma of a patient with primary pulmonary hypertension [24]. Transforming growth factor-β1 decreases in remodeling hypertensive bovine pulmonary arteries, in a new-born calf’s model simulating high altitude [25]. In lung tissue from patients with primary pulmonary hypertension, TGF-β1 immunostaining was either faint or absent in both normal and hypertensive vessels, whereas an intense, cell-associated TGF-β3 and a slightly less intense TGF-β2 immunoreactivity were observed in the media and neointimal of the hypertensive muscular arteries as compared with normal arteries of comparable size [26]. These observations suggest a distinctive role for TGF-β1, TGF-β2, and TGF-β3 in hypertensive pulmonary vascular remodeling.

Overall correlations among mRNA gene expression levels showed positively related TGF-β2 and TGF-β3, both negatively correlated with endothelin 1, whereas no relationship with TGF-β1 is observed. Other than its role as a vasoconstrictor, endothelin 1 also contributes to inflammation, as well as fibrosis during various pathophysiological processes [23]. Systemic sclerosis (SSc) has higher circulating levels of endothelin 1 and is characterized by a first inflammatory stage followed by a chronic fibrotic stage notably in the lung [27]. An avian model of SSc confirmed that as in the human disease, TGF-β1 has a profibrotic activity on chicken fibroblasts, but that of TGF-β3 and particularly TGF-β2 is antifibrotic and may be a candidate for SSc therapy [28, 29]. Even TGF-β1 in promoting fibrosis seems to have beneficial effects in SSc by inhibiting inflammation [30]. In other settings, high-density lipoproteins and TGF-β2 expression in endothelial cells are related to atherosclerotic plaque stability [31], and, compared to TGF-β1, TGF-β3 is associated to reduced scarring and superior healing in oral mucosal and cutaneous wounds [32, 33].

Concerning the inhibitory pseudoreceptor BAMBI (BMP and activin membrane-bound inhibitor homolog), we found the lowest mRNA levels in lung tissue from ascitic birds in the control groups whereas no other differences were observed. In an in vitro experiment with lung tissues obtained from COPD patients, no significant changes of TGF-β receptors 1 and 2 and Smad-3 expression are observed, but conversely to our results, a strong expression of BAMBI with upregulation after in vitro infection with Haemophilus influenzae was demonstrated [34]. Due to the small number of birds in the ascitic group ( ), BAMBI expression in controls was unexpected; thus, we analyzed lung samples from broilers (Ross) under commercial production conditions and corroborate the lower expression in the ascitic birds (data not included). It has been observed that some anti-inflammatory signals are induced during cold acclimation such as adiponectin [35] which in turn may compensate through the upregulation of BAMBI [36], thus counteracting a lowering effect of ascites on BAMBI expression from chicken in the cold group.

We speculate that an increased expression of endothelin 1 and a reduced TGFβ signaling are related to a shortage in lung development and function. In pulmonary arterial hypertension associated to intrauterine growth restriction (IUGR), lung development and function are affected and an attenuated TGFβ signaling is observed that may contribute to the pathological processes of IUGR-associated lung disease [37]. Also, loss of transforming growth factor beta signaling might contribute to the abnormal growth of endothelial cells in plexiform lesions in idiopathic pulmonary arterial hypertension in human [38]. Plexiform lesions are also observed in pulmonary arterial hypertension in broilers.

In conclusion, our data show an increase in endothelin-1 transcript levels as disease progresses from healthy to dilated cardiomyopathy with ascites, while a corresponding decrease in TGF-β2 and TGF-β3 is observed and seems independent of temperature conditions.


We are indebted to Tyson Foods Mexico (Torreón, Coahuila, Mexico) for generous donation of chickens, to Dr. Jorge Galo Medina, Rector of the Universidad Autónoma Agraria Antonio Narro (Saltillo, Coahuila, Mexico) for chicken growing and experimental facilities, and to Nelson López for animal health care. Laboratory work was supported by Instituto Nacional de Cardiología Ignacio Chávez.


  1. J.-L. Vachiéry and A. Davenport, “The endothelin system in pulmonary and renal vasculopathy: les liaisons dangereuses,” European Respiratory Review, vol. 18, no. 114, pp. 260–271, 2009. View at: Publisher Site | Google Scholar
  2. C. Castañares, M. Redondo-Horcajo, N. Magan-Marchal, S. Lamas, and F. Rodriguez-Pascual, “Transforming growth factor-β receptor requirements for the induction of the endothelin-1 gene,” Experimental Biology and Medicine, vol. 231, no. 6, pp. 700–703, 2006. View at: Google Scholar
  3. C. Castañares, M. Redondo-Horcajo, N. Magán-Marchal, P. Ten Dijke, S. Lamas, and F. Rodríguez-Pascual, “Signaling by ALK5 mediates TGF-β-induces ET-1 expression in endothelial cells: a role for migration and proliferation,” Journal of Cell Science, vol. 120, no. 7, pp. 1256–1266, 2007. View at: Publisher Site | Google Scholar
  4. H. Deng, M. B. Hershenson, J. Lei, A. C. Anyanwu, D. J. Pinsky, and J. Kelley Bentley, “Pulmonary artery smooth muscle hypertrophy: roles of glycogen synthase kinase-3β and p70 ribosomal S6 kinase,” American Journal of Physiology, vol. 298, no. 6, pp. L793–L803, 2010. View at: Publisher Site | Google Scholar
  5. A. P. Gomez, M. J. Moreno, R. M. Baldrich, and A. Hernández, “Endothelin-1 molecular ribonucleic acid expression in pulmonary hypertensive and nonhypertensive chickens,” Poultry Science, vol. 87, no. 7, pp. 1395–1401, 2008. View at: Publisher Site | Google Scholar
  6. A. P. Gomez, M. J. Moreno, A. Iglesias, P. X. Coral, and A. Hernández, “Endothelin 1, its endothelin type a receptor, connective tissue growth factor, platelet-derived growth factor, and adrenomedullin expression in lungs of pulmonary hypertensive and nonhypertensive chickens,” Poultry Science, vol. 86, no. 5, pp. 909–916, 2007. View at: Google Scholar
  7. K. R. Hamal, R. F. Wideman, N. B. Anthony, and G. F. Erf, “Differential expression of vasoactive mediators in microparticle-challenged lungs of chickens that differ in susceptibility to pulmonary arterial hypertension,” American Journal of Physiology, vol. 298, no. 1, pp. R235–R242, 2010. View at: Publisher Site | Google Scholar
  8. Y. Yang, M. Gao, Z. Wu, and Y. Guo, “Genistein attenuates low temperature induced pulmonary hypertension in broiler chicks by modulating endothelial function,” European Journal of Pharmacology, vol. 649, no. 1–3, pp. 242–248, 2010. View at: Publisher Site | Google Scholar
  9. U. Bartram and C. P. Speer, “The role of transforming growth factor β in lung development and disease,” Chest, vol. 125, no. 2, pp. 754–765, 2004. View at: Publisher Site | Google Scholar
  10. E. Pardali and P. ten Dijke, “TGFβ signaling and cardiovascular diseases,” International Journal of Biological Sciences, vol. 8, no. 2, pp. 195–213, 2012. View at: Google Scholar
  11. R. J. Julian, “Ascites in poultry,” Avian Pathology, vol. 22, pp. 419–454, 1993. View at: Google Scholar
  12. R. J. Julian, “Production and growth related disorders and other metabolic diseases of poultry—a review,” Veterinary Journal, vol. 169, no. 3, pp. 350–369, 2005. View at: Publisher Site | Google Scholar
  13. A. R. Gupta, “Ascites syndrome in poultry: a review,” World's Poultry Science Journal, vol. 67, no. 3, pp. 457–468, 2011. View at: Publisher Site | Google Scholar
  14. R. F. Wideman Jr. and K. R. Hamal, “Idiopathic pulmonary arterial hypertension: an avian model for plexogenic arteriopathy and serotonergic vasoconstriction,” Journal of Pharmacological and Toxicological Methods, vol. 63, no. 3, pp. 283–295, 2011. View at: Publisher Site | Google Scholar
  15. A. A. Olkowski, C. Wojnarowicz, B. M. Rathgeber, J. A. Abbott, and H. L. Classen, “Lesions of the pericardium and their significance in the aetiology of heart failure in broiler chickens,” Research in Veterinary Science, vol. 74, no. 3, pp. 203–211, 2003. View at: Publisher Site | Google Scholar
  16. A. A. Olkowski and H. L. Classen, “Progressive bradycardia, a possible factor in the pathogenesis of ascites in fast growing broiler chickens raised at low altitude,” British Poultry Science, vol. 39, no. 1, pp. 139–146, 1998. View at: Google Scholar
  17. A. A. Olkowski, H. L. Classen, and L. Kumor, “Left atrio-ventricular valve degeneration, left ventricular dilation and right ventricular failure: a possible association with pulmonary hypertension and aetiology of ascites in broiler chickens,” Avian Pathology, vol. 27, no. 1, pp. 51–59, 1998. View at: Google Scholar
  18. S. Nain, C. Wojnarowicz, B. Laarveld, and A. A. Olkowski, “Vascular remodeling and its role in the pathogenesis of ascites in fast growing commercial broilers,” Research in Veterinary Science, vol. 86, no. 3, pp. 479–484, 2009. View at: Publisher Site | Google Scholar
  19. C. I. Lorda-Diez, J. A. Montero, J. A. Garcia-Porrero, and J. M. Hurle, “Tgfβ2 and 3 are coexpressed with their extracellular regulator Ltbp1 in the early limb bud and modulate mesodermal outgrowth and BMP signaling in chicken embryos,” BMC Developmental Biology, vol. 10, article 69, 2010. View at: Publisher Site | Google Scholar
  20. J. Halper, D. W. Burt, and M. N. Romanov, “On reassessment of the chicken TGFB4 gene as TGFB1,” Growth Factors, vol. 22, no. 2, pp. 121–122, 2004. View at: Publisher Site | Google Scholar
  21. H. Hassanpour, M. Teshfam, H. Momtaz, G. N. Brujeni, and L. Shahgholian, “Up-regulation of Endothelin-1 and Endothelin type A receptor genes expression in the heart of broiler chickens versus layer chickens,” Research in Veterinary Science, vol. 89, no. 3, pp. 352–357, 2010. View at: Publisher Site | Google Scholar
  22. H. Hassanpour, H. Momtaz, L. Shahgholian, R. Bagheri, S. Sarfaraz, and B. Heydaripoor, “Gene expression of endothelin-1 and its receptors in the heart of broiler chickens with T3-induced pulmonary hypertension,” Research in Veterinary Science, vol. 91, no. 3, pp. 370–375, 2011. View at: Publisher Site | Google Scholar
  23. A. Nguyen, N. Thorin-Trescases, and E. Thorin, “Working under pressure: coronary arteries and the endothelin system,” American Journal of Physiology, vol. 298, no. 5, pp. R1188–R1194, 2010. View at: Publisher Site | Google Scholar
  24. T. J. Broekelmann, A. H. Limper, T. V. Colby, and J. A. McDonald, “Transforming growth factor β1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis,” Proceedings of the National Academy of Sciences of the United States of America, vol. 88, no. 15, pp. 6642–6646, 1991. View at: Publisher Site | Google Scholar
  25. M. D. Botney, W. C. Parks, E. C. Crouch, K. Stenmark, and R. P. Mecham, “Transforming growth factor-β1 is decreased in remodeling hypertensive bovine pulmonary arteries,” Journal of Clinical Investigation, vol. 89, no. 5, pp. 1629–1635, 1992. View at: Google Scholar
  26. M. D. Botney, L. Bahadori, and L. I. Gold, “Vascular remodeling in primary pulmonary hypertension: potential role for transforming growth factor-β,” American Journal of Pathology, vol. 144, no. 2, pp. 286–295, 1994. View at: Google Scholar
  27. A. Sulli, S. Soldano, C. Pizzorni et al., “Raynaud's phenomenon and plasma endothelin: correlations with capillaroscopic patterns in systemic sclerosis,” Journal of Rheumatology, vol. 36, no. 6, pp. 1235–1239, 2009. View at: Publisher Site | Google Scholar
  28. M. Prelog, P. Scheidegger, S. Peter, M. E. Gershwin, G. Wick, and R. Sgonc, “Diminished transforming growth factor β2 production leads to increased expression of a profibrotic procollagen α2 type I messenger RNA variant in embryonic fibroblasts of UCD-200 chickens, a model for systemic sclerosis,” Arthritis and Rheumatism, vol. 52, no. 6, pp. 1804–1811, 2005. View at: Publisher Site | Google Scholar
  29. R. Sgonc and G. Wick, “Pro- and anti-fibrotic effects of TGF-beta in scleroderma,” Rheumatology, vol. 47, pp. v5–v7, 2008. View at: Google Scholar
  30. C. P. Denton, P. A. Merkel, D. E. Furst et al., “Recombinant human anti-transforming growth factor β1 antibody therapy in systemic sclerosis: a multicenter, randomized, placebo-controlled phase I/II trial of CAT-192,” Arthritis and Rheumatism, vol. 56, no. 1, pp. 323–333, 2007. View at: Publisher Site | Google Scholar
  31. G. D. Norata, E. Callegari, M. Marchesi, G. Chiesa, P. Eriksson, and A. L. Catapano, “High-density lipoproteins induce transforming growth factor-β2 expression in endothelial cells,” Circulation, vol. 111, no. 21, pp. 2805–2811, 2005. View at: Publisher Site | Google Scholar
  32. M. E. Schrementi, A. M. Ferreira, C. Zender, and L. A. DiPietro, “Site-specific production of TGF-β in oral mucosal and cutaneous wounds,” Wound Repair and Regeneration, vol. 16, no. 1, pp. 80–86, 2008. View at: Publisher Site | Google Scholar
  33. A. Eslami, C. L. Gallant-Behm, D. A. Hart et al., “Expression of integrin αvβ6 and TGF-β in Scarless vs Scar-forming wound healing,” Journal of Histochemistry and Cytochemistry, vol. 57, no. 6, pp. 543–557, 2009. View at: Publisher Site | Google Scholar
  34. D. Drömann, J. Rupp, K. Rohmann et al., “The TGF-beta-Pseudoreceptor BAMBI is strongly expressed in COPD lungs and regulated by nontypeable Haemophilus influenzae,” Respiratory Research, vol. 11, article 67, 2010. View at: Publisher Site | Google Scholar
  35. A. Jankovic, A. Korac, B. Buzadzic et al., “Endocrine and metabolic signaling in retroperitoneal white adipose tissue remodeling during cold acclimation,” Journal of Obesity, vol. 2013, Article ID 937572, 8 pages, 2013. View at: Publisher Site | Google Scholar
  36. J. Wanninger, M. Neumeier, S. Bauer et al., “Adiponectin induces the transforming growth factor decoy receptor BAMBI in human hepatocytes,” FEBS Letters, vol. 585, no. 9, pp. 1338–1344, 2011. View at: Publisher Site | Google Scholar
  37. M. A. Alejandre Alcázar, R. E. Morty, L. Lendzian et al., “Inhibition of tgf-β signaling and decreased apoptosis in iugr-associated lung disease in rats,” PLoS ONE, vol. 6, no. 10, Article ID e26371, 2011. View at: Publisher Site | Google Scholar
  38. A. Richter, M. E. Yeager, A. Zaiman, C. D. Cool, N. F. Voelkel, and R. M. Tuder, “Impaired transforming growth factor-β signaling in idiopathic pulmonary arterial hypertension,” American Journal of Respiratory and Critical Care Medicine, vol. 170, no. 12, pp. 1340–1348, 2004. View at: Publisher Site | Google Scholar

Copyright © 2013 Norma Dominguez-Avila et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.