Table of Contents Author Guidelines Submit a Manuscript
RETRACTED

BioMed Research International has retracted this article. This article is one of a series of very similar articles on shRNA and cancer cell lines identified by Byrne and Labbé [2]; the intertextual distance between this article and another of the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé. The authors say resequencing showed that the nontargeting sequence plasmid they bought is actually an empty vector.(ii)There is duplication between panels in Figure (a) (between the top left and top right panels and between the bottom left and center left panels), which the authors say was due to carelessness.(iii)The control panels of Figures (a) and (a) in this article are the same as in Figures (a) and (a), respectively, in the authors’ article on Linc-ITGB1 [4], which was not cited. The authors said knockdown of KIAA0125 and Linc-ITGB1 expression by RNAi was performed simultaneously, so they shared the same controls.

BioMed Research International
Volume 2015 (2015), Article ID 108458, 9 pages
http://dx.doi.org/10.1155/2015/108458
Research Article

Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer

Department of General Surgery, Xinhua Hospital Affiliated to School of Medicine, Shanghai Jiao Tong University, 1665 Kongjiang Road, Shanghai 200092, China

Received 29 May 2014; Revised 15 August 2014; Accepted 20 August 2014

Academic Editor: Aurelio Ariza

Copyright © 2015 Wenjie Lv et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Linked References

  1. Z. Tan, M. Li, W. Wu et al., “NLK is a key regulator of proliferation and migration in gallbladder carcinoma cells,” Molecular and Cellular Biochemistry, vol. 369, no. 1-2, pp. 27–33, 2012. View at Publisher · View at Google Scholar · View at Scopus
  2. S. Gourgiotis, H. M. Kocher, L. Solaini, A. Yarollahi, E. Tsiambas, and N. S. Salemis, “Gallbladder cancer,” American Journal of Surgery, vol. 196, no. 2, pp. 252–264, 2008. View at Publisher · View at Google Scholar · View at Scopus
  3. Z. Tan, S. Zhang, M. Li et al., “Regulation of cell proliferation and migration in gallbladder cancer by zinc finger X-chromosomal protein,” Gene, vol. 528, no. 2, pp. 261–266, 2013. View at Publisher · View at Google Scholar · View at Scopus
  4. H. Zong, B. Yin, H. Zhou, D. Cai, B. Ma, and Y. Xiang, “Inhibition of mTOR pathway attenuates migration and invasion of gallbladder cancer via EMT inhibition,” Molecular Biology Reports, vol. 41, no. 7, pp. 4507–4512, 2014. View at Publisher · View at Google Scholar · View at Scopus
  5. I. H. Jeong, S. U. Choi, S. R. Lee et al., “Outcomes after combined laparoscopic gastrectomy and laparoscopic cholecystectomy in gastric cancer patients,” European Surgical Research, vol. 42, no. 4, pp. 203–208, 2009. View at Publisher · View at Google Scholar · View at Scopus
  6. G. Miller and W. R. Jarnagin, “Gallbladder carcinoma,” European Journal of Surgical Oncology, vol. 34, no. 3, pp. 306–312, 2008. View at Publisher · View at Google Scholar · View at Scopus
  7. A. X. Zhu, T. S. Hong, A. F. Hezel, and D. A. Kooby, “Current management of gallbladder carcinoma,” Oncologist, vol. 15, no. 2, pp. 168–181, 2010. View at Publisher · View at Google Scholar · View at Scopus
  8. X. Wang, S. Arai, X. Song et al., “Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription,” Nature, vol. 454, no. 7200, pp. 126–130, 2008. View at Publisher · View at Google Scholar · View at Scopus
  9. T. R. Mercer, M. E. Dinger, and J. S. Mattick, “Long non-coding RNAs: insights into functions,” Nature Reviews Genetics, vol. 10, no. 3, pp. 155–159, 2009. View at Publisher · View at Google Scholar · View at Scopus
  10. H. Ono, N. Motoi, H. Nagano et al., “Long noncoding RNA HOTAIR is relevant to cellular proliferation, invasiveness, and clinical relapse in small-cell lung cancer,” Cancer Medicine, vol. 3, no. 3, pp. 632–642, 2014. View at Publisher · View at Google Scholar
  11. C. P. Ponting, P. L. Oliver, and W. Reik, “Evolution and functions of long noncoding RNAs,” Cell, vol. 136, no. 4, pp. 629–641, 2009. View at Publisher · View at Google Scholar · View at Scopus
  12. K. Takahashi, I. Yan, H. Haga, and T. Patel, “Long non-coding RNA in liver diseases,” Hepatology, vol. 60, no. 2, pp. 744–753, 2014. View at Publisher · View at Google Scholar
  13. S. Chung, H. Nakagawa, M. Uemura et al., “Association of a novel long non-coding RNA in 8q24 with prostate cancer susceptibility,” Cancer Science, vol. 102, no. 1, pp. 245–252, 2011. View at Publisher · View at Google Scholar · View at Scopus
  14. H. Ling, R. Spizzo, Y. Atlasi et al., “CCAT2, a novel noncoding RNA mapping to 8q24, underlies metastatic progression and chromosomal instability in colon cancer,” Genome Research, vol. 23, no. 9, pp. 1446–1461, 2013. View at Publisher · View at Google Scholar · View at Scopus
  15. L. Lu, G. Zhu, C. Zhang et al., “Association of large noncoding RNA HOTAIR expression and its downstream intergenic CpG island methylation with survival in breast cancer,” Breast Cancer Research and Treatment, vol. 136, no. 3, pp. 875–883, 2012. View at Publisher · View at Google Scholar · View at Scopus
  16. C. P. Alves, A. S. Fonseca, B. R. Muys et al., “Brief report: the lincRNA hotair is required for epithelial-to-mesenchymal transition and stemness maintenance of cancer cell lines,” Stem Cells, vol. 31, no. 12, pp. 2827–2832, 2013. View at Publisher · View at Google Scholar · View at Scopus
  17. X.-B. Lv, G.-Y. Lian, H.-R. Wang, E. Song, H. Yao, and M.-H. Wang, “Long noncoding RNA HOTAIR is a prognostic marker for esophageal squamous cell carcinoma progression and survival,” PLoS ONE, vol. 8, no. 5, Article ID e63516, 2013. View at Publisher · View at Google Scholar · View at Scopus
  18. C. Xu, M. Yang, J. Tian, X. Wang, and Z. Li, “MALAT-1: a long non-coding RNA and its important 3' end functional motif in colorectal cancer metastasis,” International Journal of Oncology, vol. 39, no. 1, pp. 169–175, 2014. View at Publisher · View at Google Scholar
  19. P. Ji, S. Diederichs, W. Wang et al., “MALAT-1, a novel noncoding RNA, and thymosin β4 predict metastasis and survival in early-stage non-small cell lung cancer,” Oncogene, vol. 22, no. 39, pp. 8031–8041, 2003. View at Publisher · View at Google Scholar · View at Scopus
  20. L. Ying, Q. Chen, Y. Wang, Z. Zhou, Y. Huang, and F. Qiu, “Upregulated MALAT-1 contributes to bladder cancer cell migration by inducing epithelial-to-mesenchymal transition,” Molecular BioSystems, vol. 8, no. 9, pp. 2289–2294, 2012. View at Publisher · View at Google Scholar · View at Scopus
  21. Y.-B. Liu, X.-W. He, J.-W. Wang et al., “Establishment of liver metastasis model of human gallbladder cancer and isolation of the subpopulation with high metastatic potential,” National Medical Journal of China, vol. 86, no. 30, pp. 2117–2121, 2006. View at Google Scholar · View at Scopus
  22. K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. View at Publisher · View at Google Scholar · View at Scopus
  23. F. Schulze, K. Schardt, I. Wedemeyer et al., “Epithelial-mesenchymal transition of biliary epithelial cells in advanced liver fibrosis,” Verhandlungen der Deutschen Gesellschaft für Pathologie, vol. 91, pp. 250–256, 2007. View at Google Scholar · View at Scopus
  24. M. D. Paraskevopoulou, G. Georgakilas, N. Kostoulas et al., “DIANA-LncBase: experimentally verified and computationally predicted microRNA targets on long non-coding RNAs,” Nucleic Acids Research, vol. 41, no. 1, pp. D239–D245, 2013. View at Publisher · View at Google Scholar · View at Scopus
  25. H. Yang, Y. Zhong, H. Xie et al., “Induction of the liver cancer-down-regulated long noncoding RNA uc002mbe.2 mediates trichostatin-induced apoptosis of liver cancer cells,” Biochemical Pharmacology, vol. 85, no. 12, pp. 1761–1769, 2013. View at Publisher · View at Google Scholar · View at Scopus
  26. E. D. Hay and A. Zuk, “Transformations between epithelium and mesenchyme: normal, pathological, and experimentally induced,” American Journal of Kidney Diseases, vol. 26, no. 4, pp. 678–690, 1995. View at Publisher · View at Google Scholar · View at Scopus
  27. E. W. Thompson and D. F. Newgreen, “Carcinoma invasion and metastasis: a role for epithelial-mesenchymal transition?” Cancer Research, vol. 65, no. 14, pp. 5991–5995, 2005. View at Google Scholar · View at Scopus
  28. J. P. Thiery, “Epithelial-mesenchymal transitions in tumour progression,” Nature Reviews Cancer, vol. 2, no. 6, pp. 442–454, 2002. View at Google Scholar
  29. D. A. Zajchowski, M. F. Bartholdi, Y. Gong et al., “Identification of gene expression profiles that predict the aggressive behavior of breast cancer cells,” Cancer Research, vol. 61, no. 13, pp. 5168–5178, 2001. View at Google Scholar · View at Scopus
  30. J. A. Davies, “Mesenchyme to epithelium transition during development of the mammalian kidney tubule,” Acta Anatomica, vol. 156, no. 3, pp. 187–201, 1996. View at Publisher · View at Google Scholar · View at Scopus
  31. A. Bonnomet, A. Brysse, A. Tachsidis et al., “Epithelial-to-mesenchymal transitions and circulating tumor cells,” Journal of Mammary Gland Biology and Neoplasia, vol. 15, no. 2, pp. 261–273, 2010. View at Publisher · View at Google Scholar · View at Scopus
  32. A. Satelli and S. Li, “Vimentin in cancer and its potential as a molecular target for cancer therapy,” Cellular and Molecular Life Sciences, vol. 68, no. 18, pp. 3033–3046, 2011. View at Publisher · View at Google Scholar · View at Scopus
  33. R. Kalluri and R. A. Weinberg, “The basics of epithelial-mesenchymal transition,” The Journal of Clinical Investigation, vol. 119, no. 6, pp. 1420–1428, 2009. View at Publisher · View at Google Scholar · View at Scopus