BioMed Research International

BioMed Research International / 2015 / Article
Special Issue

Aberrant Gene Regulation in Obstetric, Gynecologic, and Reproductive Diseases

View this Special Issue

Research Article | Open Access

Volume 2015 |Article ID 925691 | 8 pages | https://doi.org/10.1155/2015/925691

Paracrine Regulation of Steroidogenesis in Theca Cells by Granulosa Cells Derived from Mouse Preantral Follicles

Academic Editor: Leon Spicer
Received15 Feb 2015
Revised14 Jun 2015
Accepted28 Jun 2015
Published19 Aug 2015

Abstract

Interaction partners of follicular cells play a significant role in steroidogenesis, follicular formation, and development. Androgen secreted by theca cells (TCs) can initiate follicle development and ovulation and provide precursor materials for estrogen synthesis. Therefore, studies on ovarian microenvironment will not only lead to better understanding of the steroidogenesis but also have clinical significance for ovarian endocrine abnormalities such as hyperandrogenism in polycystic ovary syndrome (PCOS). This study applied the Transwell coculture model to investigate if the interaction between granulosa and theca cells may affect androgen production in theca cells. Concentrations of testosterone and androstenedione in the spent medium were measured by radioimmunoassay and enzyme linked immunosorbent assay, respectively. The results show that the coculture with granulosa cells (GCs) increases steroidogenesis in TCs. In addition, testosterone and androstenedione productions in response to LH stimulation were also increased in the coculture model. Significantly increased mRNA expressions of steroidogenic enzymes (Star, Cyp11a1, Cyp17a1, and Hsd3b2) were observed in the cocultured TCs. Thus, GCs were capable of promoting steroidogenesis and LH responsiveness in TCs. This study provided a basis for further exploration of ovarian endocrine mechanism and pathologies.

1. Introduction

Oocyte, granulosa cells (GCs), and theca cells (TCs) are the main components of follicles, and the functions and interactions among them play crucial role(s) in steroidogenesis, follicular development, and atresia [1]. Oocyte-granulosa cell communications, largely carried out by gap junctions, are essential for the female gametogenesis and formation and maturation of follicles as well as embryonic development after fertilization. Some paracrine factors such as growth differentiation factor 9 (GDF-9) and bone morphogenetic protein 15 (BMP-15) are specifically secreted by oocyte. These factors regulate follicle formation and GCs/TCs proliferation and differentiation [2, 3]. On the other hand, insulin-like growth factor-I (IGF-I), activin, and inhibin secreted by GCs are autocrine/paracrine regulators contributing to the modulation of ovarian function [4]. TCs do not only support the structure and functionality of the developing follicle but also provide androgen for estrogen biosynthesis in GCs, which stimulates the early follicle growth [5, 6].

Androgen is mainly secreted from ovary and adrenal gland. In ovaries, the steroidogenesis is accomplished by both the granulosa cells and theca cells. The synthesis of various steroids is determined by cell-specific expression of a series of steroidogenic enzymes. The transportation of cholesterol into the mitochondria is facilitated by STAR which regulates the production of androgens. It is established that the androgen-secreting theca cells express P450Scc (CYP11A1), P450C17 (CYP17), and HSD3B2, all of which are key enzymes essential for androgen biosynthesis. In hyperandrogenemia patients, the circulatory testosterone and androstenedione are primarily produced by follicular TCs of ovary [7, 8]. Although some investigator observed that oocyte-derived factors such as GDF-9 directly upregulated Cyp17 mRNA and protein expression in rats [9, 10] and paracrine regulations of GCs may also enhance steroid production in whole follicles, many aspects of the signaling network among different groups of follicular cells, especially their effects on steroid synthesis, remain to be investigated.

In vitro studies have shown that, as a key feature of TCs, the increment of androgen production was driven by LH in a dose-dependent manner [5, 11, 12]. Although these findings suggested that increased LH secretion may be pivotal for the upregulation of androgen production, some other studies in women with polycystic ovary syndrome (PCOS) found that its main effect was to promote the conversion of progesterone to androgen [13]. There appears a complex network of signals between GCs and TCs on the regulation of androgen production under different pathophysiological conditions. Unfortunately, studies on GCs regulation of the steroidogenesis in TCs in early follicle development are scattered and the regulatory mechanism remains poorly understood [14]. Specifically, literature search failed to find any systematic investigation focusing on the paracrine regulation of TCs’ steroidogenesis by GCs using cells derived from mouse preantral follicles.

The objective of this study is to explore the functional interactions between GCs and TCs and their involvement in steroid metabolism. We applied the Transwell coculture model to determine the effects of GCs on the steroidogenic function of TCs in the mouse preantral follicles by measuring the change of androgen concentration in response to LH stimulation. Results of the study will provide basic information on the significance of cell interactions for steroidogenesis in ovary.

2. Materials and Methods

2.1. Animals

Immature Female ICR mice for research (21 days old) were obtained from Lab Animal Center of Weifang Medical University. Mice were housed under controlled conditions with a daily lighting (12 h light and 12 h darkness). Food and water were provided ad libitum. All animal management procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee.

2.2. Cell Isolation and Culture

TCs were isolated from mice aged 21 days and cultured following published protocols with minor modifications [15, 16]. Briefly, isolated ovaries were immediately transferred to the prewarmed Medium 199 (GIBCO, Grand Island, NY) containing 0.1% BSA, 100 IU/mL penicillin, and 100 μg/mL streptomycin. Ovaries were cleaned of any surrounding tissue and repeatedly punctured with 29 G needles to release GCs. The remaining ovarian tissues were incubated in Medium 199 supplemented with 4 mg/mL collagenase I (Worthington Biochemical Corp, Lakewood, New Jersey), 10 μg/mL DNase I (Worthington Biochemical Corp, Lakewood, New Jersey), and 0.1% BSA for 60 min at 37°C following three times of washing with Medium 199. Then the TCs were placed in Medium 199 containing 0.1% BSA, 1% FBS, 1% insulin-transferrin-selenium (ITS) (GIBCO, Grand Island, NY, USA), 100 IU/mL of penicillin, and 100 μg/mL streptomycin. After overnight incubation, the wells were washed with Medium 199 to remove unattached cells.

For GCs collection, the released cells from the above steps were placed in prewarmed medium of DMEM/F12. Following three times of washing, the GCs were transferred to the conditioned DMEM/F12 medium containing 0.1% BSA, 10% FBS, 100 IU/mL penicillin, and 100 μg/mL streptomycin. After overnight incubation, the wells were washed with DMEM/F12 medium to remove unattached cells. Cellular morphology was observed under the microscope.

2.3. Immunofluorescence Detection of CYP17A1 and FSHR

TCs were seeded on coverslip following washing with Medium 199 to remove unattached cells after overnight incubation. For the identification of TCs and GCs, a CYP17A1 antibody, a marker enzyme specifically expressed in TC, was used to verify the purity and identify the cells. Icy acetone was added and a coverslip was placed at −20°C for 10 minutes. After washing and permeabilization with PBS containing 0.5% Triton X-100, the cells were blocked with goat serum (Zhongshan Jinqiao Biotechnology Co. Ltd., Beijing, China) for 1 h in a humidified chamber at 37°C. Subsequently, slides were incubated with CYP17A1 antibody (1 : 200, Santa Cruz, CA) or FSHR antibody (1 : 200, Bioworld Technology, Inc., Minnesota) overnight at 4°C. Slides were incubated with secondary fluorescent FITC (1 : 100, Boster Biotechnology Co. Ltd., Wuhan, China) for 1 h in a humidified chamber at 37°C. After washing and nuclear staining with Hoechst for 10 seconds, the staining was stopped. The slides were seal-capped with Debico and observed under a fluorescence microscope.

2.4. Transwell Coculture of GCs and TCs

GCs were seeded in Transwell (3 μm pore size, 24 mm diameter; Corning, NY) inner membrane at a density of 3 × 105 and cultured with 1 mL DMEM/F12 supplemented with 0.1% BSA and antibiotics. After transfer into 6-well plate, TCs were seeded at a density of 1 × 105 with Medium 199 supplemented with 0.1% BSA, 1% ITS, and antibiotics. For androgen assay and quantitative real-time PCR analyses, cells were cultured in serum-free medium for 72 h.

To assess the effect of GCs on LH responsiveness after being cocultured for 24 h, LH was added at increasing concentrations (0, 0.01, 0.1, or 1 IU/mL) and culture continued for 48 h. Then the medium was collected for subsequent measurement.

2.5. Androgen Assays

The spent medium was collected at 24 h, 48 h, and 72 h. After centrifugation at 2500 ×g at 4°C for 15 minutes, the supernatant was stored at −80°C for androgen measurement. The concentrations of testosterone and androstenedione were determined using radioimmunoassay (RIA) kit (Beifang Biotechnique Institute, Beijing, China) and enzyme linked immunosorbent assay (ELISA) kit (J&L Biological, Shanghai, China), respectively, according to manufacturer’s protocols.

2.6. Quantitative Real-Time PCR

TCs were harvested and RNA was extracted using Trizol reagents (Invitrogen, Carlsbad, CA). RNA was measured with spectrometry for OD260/280 and cDNAs were prepared with PrimeScript Reverse Transcription Kit (Takara, Dalian, China) according to manufacturer’s recommendations. Real-time PCR was performed with StepOne Plus Real-Time PCR System (Applied Biosystems, USA) using SYBR Premix Ex Taq II (Takara, Dalian, China). Primers were designed for each gene using the Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA). The designation and sequences of specific PCR primers of Star, Cyp11a1, Cyp17a1, Hsd3b2, and LHR expression were listed in Table 1. Primers were synthesized by Invitrogen (Invitrogen Trading Co. Ltd., Shanghai, China).


Accession numberGeneSequence 5′-3′Size (bp)

NM_011485.4StarF: CCACCTGCATGGTGCTTCA 142
R: TTGGCGAACTCTATCTGGGTCTG

NM_019779.3Cyp11a1F: GGCACTTTGGAGTCAGTTTACAT 186
R: GTTTAGGACGATTCGGTCTTTCTT

NM_007809.3Cyp17a1F: TCTGGGCACTGCATCACG 124
R: GCTCCGAAGGGCAAATAACT

NM_153193.3Hsd3b2F: GCCCCTACTGTACTGGCTTG212
R: TCCCGATCCACTCTGAGGTT

NM_001289726.1GAPDHF: AGGTTGTCTCCTGCGACTTCA 187
R: GGGTGGTCCAGGGTTTCTTACT

NM_013582.2LHRF: GAGACGCTTTATTCTGCCATCT119
R: CAGGGATTGAAAGCATCTGG

Each sample was assayed in duplicate using 1 μL cDNA, 10 pmol primer, and 1 μL SYBR Green Master Mix (Applied Biosystems, USA) in a total volume of 20 μL. GAPDH mRNA was measured and the results served as internal control. PCR conditions were initial denaturation at 95°C for 1 min followed by 40 cycles of amplification: denaturation at 95°C for 15 sec, annealing at 60°C for 1 min, and extension at 72°C for 3 min. Melting curve analysis was performed to confirm the specificity of amplification. The difference of CT between steroidogenic enzymes and GAPDH was defined as ΔCT. The difference of ΔCT between experimental and control groups was defined as ΔΔCT. The relative quantity was determined by [17].

2.7. Statistical Analysis

All data were expressed as mean ± SEM from at least three independent experiments. For comparison of quantitative data of two groups, Student’s -test was used, and for multiple comparisons, one-way ANOVA (SPSS 16.0) was used. was considered as reaching a statistically significant level.

3. Results

3.1. Verification on the Purity of Theca Cells

After overnight incubation, the wells coated with TCs were washed with medium to remove unattached cells. The cellular morphology and confluence of TCs were observed under the microscope. Typically, the attached cells looked thin and dendritic, indicating their TC origin. By a series of titration experiments, the density of TCs was adjusted to approximately 70% confluence. The purity of TCs was further verified with immunofluorescence staining using a TC-specific marker Cytochrome P450, family 17, subfamily A, polypeptide 1 (CYP17A1, also known as 17a-hydroxylase/17, 20-lyase), and the GC-specific marker Follicle Stimulating Hormone Receptor (FSHR) for reverse identification. The results in Figure 1 demonstrated that more than 90% of the cells were stained positive for CYP17A1, confirming these cells’ TC origin. As FSHR is a GC-specific marker not TCs, we used it to confirm that the extracted cells were TCs and contain almost no GCs by reverse identification. Results from control experiments using FSHR antibody did not show significant fluorescence signal, indicating that these TCs cultures were largely free of GC contamination.

3.2. Effect of Granulosa Cells on the Steroidogenesis in Theca Cells

Concentrations of testosterone and androstenedione in the spent medium were measured at 24 h, 48 h, and 72 h using RIA and ELISA, respectively. When cocultured with GCs, TCs produced an increased amount of testosterone and androstenedione than TCs cultured alone (, Figure 2(a) for testosterone and Figure 2(c) for androstenedione). Interestingly, when TCs were cultured alone, the production of testosterone and androstenedione showed a declining trend along time, which may reflect the adaptation change to in vitro conditions lacking the supports from other cell types. In the spent medium of GCs cultured alone, the levels of testosterone (Figure 2(b)) and androstenedione (Figure 2(d)) were both diminished in comparison with TCs. And no alterations were observed following different time of in vitro culture (). Taken together, these results indicated that GCs could promote TCs production of testosterone and androstenedione.

3.3. Expression of Steroidogenic Enzymes in the Cocultured Model

To investigate the regulatory pathway leading to the increased androgen production, quantitative real-time PCR was performed to determine the expression of genes involved in androgen synthesis Star, Cyp11a1, Cyp17a1, and Hsd3b2 at 24 h, 48 h, and 72 h. As shown in Figure 3, the results revealed that the expressions of all these genes were increased in the cocultured model compared with TCs cultured alone (). Thus, increasing expression of the genes involved with androgen synthesis appeared to account for the increased androgen production. These results indicated that paracrine factors secreted from GCs can pass the Transwell insert membrane and regulate the transcription of steroidogenic enzymes.

3.4. Effects of Granulosa Cells on the Expression of LHR mRNA in Theca Cells

While the LHR mRNA expression of TCs in the cocultured model manifested no difference compared with TCs cultured alone at 24 h (, Figure 4(a)), at 48 h the LHR mRNA expression of TCs increased significantly (, Figure 4(a)), indicating that paracrine factors secreted from GC cells could stimulate the LHR mRNA expression in TCs. The subsequent disappearance of difference between TCs cultured alone and cocultured model may reflect the suboptimal conditions related to in vitro environment. The cocultured GCs could enhance the capacity of LH responsiveness through increasing LHR mRNA expression in TCs.

It was reported that, in TCs, LH upon binding to LH receptor could regulate the expressions of a series of synthesis enzymes through activation of cAMP/PKA signaling pathway, facilitating the synthesis and secretion of steroids [18, 19]. To determine the effect of GCs on androgen production by TCs in response to LH, the levels of testosterone and androstenedione in the spent medium were measured following stimulation with LH. The results revealed that testosterone and androstenedione production significantly increased in response to different concentrations of LH in the cocultured model (, Figures 4(b) and 4(c)). However, there was no difference in the amount of testosterone (, Figure 4(b)) or androstenedione (, Figure 4(c)) even in the presence of LH when TCs were cultured alone.

4. Discussion

On the basis of two-cell/two-gonadotropin theory of ovarian steroid synthesis, androgen production is initiated by steroidogenic enzymes (STAR, P450Scc, P450C17, and HSD3B2) in TCs and then subsequently aromatized in GCs [20]. Based on the findings that TCs androgenic pathways can be regulated by GCs via a paracrine pathway [21], we attempted to confirm that this phenomenon exists in mouse preantral follicles using the cocultured model. In this Transwell coculture model, hormones and paracrine factors secreted from follicular cells such as steroids, growth factors, and cytokines can pass the Transwell insert membrane. The cocultured model can mimic to a certain extent the local ovarian steroidogenesis by supporting similar structural integrity of follicles. Through measuring the steroidogenesis in this model, we can observe the effects of extensive cross talk and intercellular signaling between GCs and TCs, validating the efficacy of the model for studying the cell-cell interactions. In future, the coculture can be applied to investigate the significance of interactions between GCs and TCs under various pathological conditions such as hyperandrogenemia in PCOS [22] where the expression of steroidogenic enzymes was much increased [23].

Parrott and Skinner reported that GCs could promote ovarian interstitial cells recruitment to form theca cell layers around follicles and that inhibin secreted from GCs could induce maturation of the dominant follicle and the production of androstenedione [24]. These findings indicated that GCs probably provide some essential regulating factors for TCs on steroidogenesis, such as steroids, growth factors, cytokines, and extracellular matrix and maintain the ability of TCs for androgen synthesis by paracrine regulation. In this study, we evaluated the functions of ovarian cells by measuring the change in androgen concentrations. When cocultured with GCs, TCs produced an increased amount of testosterone and androstenedione than TCs cultured alone. This increase was driven by enhancing the expressions of steroidal synthetase (STAR, P450Scc, P450C17, and HSD3B2) in TCs. As more P450Scc was expressed, cholesterol is converted to pregnenolone and progesterone. When precursor of steroid runs out, both testosterone and androstenedione productions showed a declining trend over time. This illustrates that not only oocyte-derived factors but also GCs-derived factors participate in steroid production in ovaries. How and by what pathway these autocrine/paracrine regulators derived from these follicular cell types exert effects on steroidogenesis still needs further investigation.

To determine the effect of GCs on androgen productions of TCs in response to LH, acquisition of LH responsiveness in preantral follicular TCs from the mouse ovary was evaluated. In this study, we found that the cocultured GCs could enhance the capacity of LH responsiveness on increasing LHR mRNA expression in TCs. The presence of GCs led to a significant increase on LHR mRNA expression of TCs at 48 h but manifested no difference compared with TCs cultured alone at 24 h and 72 h most likely due to the suboptimal in vitro culture conditions, for example, the lack of support by LH and other hormones.

It is generally accepted that LH responsiveness and responses to LH on androgen production are two well-established functions of TCs in ovary [2527]. By cAMP/PKA signal pathway, LH could regulate the expression of a range of androgen synthetases and facilitates the transcription of Star, Cyp11a1, Cyp17a1, and Hsd3b2 [28]. Previous studies have shown that the capacity of TCs on androgen synthesis and secretion in response to LH appears to be dose-dependent [5, 11, 12]. These findings are consistent with the clinical observation in women with PCOS that elevated serum LH levels positively correlate with serum testosterone concentrations [29, 30]. Rosenfield and Bordini [31] found that moderate levels of testosterone appear to stimulate LH production at both the hypothalamic and pituitary levels, while high levels of testosterone suppress the effect of LH. Another study indicated that the level of testosterone was low, while androstenedione was high in PCOS patients [32]. In our study, when treated cocultured model with different concentrations of LH (0-1 IU/mL), concentrations of testosterone and androstenedione increased in low concentrations of LH but no further increase was observed at high concentrations. These results were in accordance with previous studies, which suggested that excessive testosterone may suppress the response to LH [5, 31, 32]. Taken together, these findings indicated that GCs could strengthen the capacity of LH by facilitating the transcription of Star, Cyp11a1, Cyp17a1, and Hsd3b2, therefore inducing androgen synthesis in TCs.

As an important component of a follicle, TCs exert certain effects on steroidogenesis, follicular development, and atresia. In the present study, the in vitro cocultured model including GCs and TCs from mouse preantral follicles recapitulates some native ovary function. However, it is unable to completely represent in vivo microenvironment of whole follicles. Furthermore, it is not yet known what effects TCs-derived factors may exert on GCs and oocytes. Therefore, the function and mechanism of TCs exerted in the ovary as well as the interaction between TCs with GCs and oocytes deserve further exploration in vivo.

In conclusion, the present results demonstrated the key role of granulosa cells for the steroid production in theca cells. The Transwell coculture model has provided a technical basis for studying some features of interactions between follicular cell groups under different pathophysiological conditions such as that of hyperandrogenemia.

Disclosure

Xiaoqiang Liu and Pengyun Qiao are co-first authors.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Acknowledgments

The authors are sincerely indebted to Chao Zhai and Maoxiang Zhang for their help with mouse breeding. They would like to express their gratitude to Professor Jiang, Director of Epigenetic Laboratory at Mercer University School of Medicine, for his critiques and revision of the paper. This study was supported by Science and Technology Innovation Projects of Weifang Medical University (K1302010).

References

  1. M. Orisaka, K. Tajima, B. K. Tsang, and F. Kotsuji, “Oocyte-granulosa-theca cell interactions during preantral follicular development,” Journal of Ovarian Research, vol. 2, no. 1, article 9, 2009. View at: Publisher Site | Google Scholar
  2. J. Peng, Q. Li, K. Wigglesworth et al., “Growth differentiation factor 9:bone morphogenetic protein 15 heterodimers are potent regulators of ovarian functions,” Proceedings of the National Academy of Sciences of the United States of America, vol. 110, no. 8, pp. E776–E785, 2013. View at: Publisher Site | Google Scholar
  3. A. R. Baerwald, G. P. Adams, and R. A. Pierson, “Ovarian antral folliculogenesis during the human menstrual cycle: a review,” Human Reproduction Update, vol. 18, no. 1, Article ID dmr039, pp. 73–91, 2012. View at: Publisher Site | Google Scholar
  4. A. V. Sirotkin, “Cytokines: signalling molecules controlling ovarian functions,” International Journal of Biochemistry and Cell Biology, vol. 43, no. 6, pp. 857–861, 2011. View at: Publisher Site | Google Scholar
  5. K. Tajima, M. Orisaka, T. Mori, and F. Kotsuji, “Ovarian theca cells in follicular function,” Reproductive BioMedicine Online, vol. 15, no. 5, pp. 591–609, 2007. View at: Publisher Site | Google Scholar
  6. H. Wang, K. Andoh, H. Hagiwara et al., “Effect of adrenal and ovarian androgens on type 4 follicles unresponsive to FSH in immature mice,” Endocrinology, vol. 142, no. 11, pp. 4930–4936, 2001. View at: Publisher Site | Google Scholar
  7. E. Diamanti-Kandarakis and C. Piperi, “Genetics of polycystic ovary syndrome: searching for the way out of the labyrinth,” Human Reproduction Update, vol. 11, no. 6, pp. 631–643, 2005. View at: Publisher Site | Google Scholar
  8. K. J. Ryan, Z. Petro, and J. Kaiser, “Steroid formation by isolated and recombined ovarian granulosa and tehcal cells,” Journal of Clinical Endocrinology & Metabolism, vol. 28, no. 3, pp. 355–358, 1968. View at: Publisher Site | Google Scholar
  9. C. D. Smyth, F. Miro, P. F. Whitelaw, C. M. Howles, and S. G. Hillier, “Ovarian thecal/interstitial androgen synthesis is enhanced by a follicle-stimulating hormone-stimulated paracrine mechanism,” Endocrinology, vol. 133, no. 4, pp. 1532–1538, 1993. View at: Publisher Site | Google Scholar
  10. E. V. Solovyeva, M. Hayashi, K. Margi et al., “Growth differentiation factor-9 stimulates rat theca-interstitial cell androgen biosynthesis,” Biology of Reproduction, vol. 63, no. 4, pp. 1214–1218, 2000. View at: Publisher Site | Google Scholar
  11. C. D. Smyth, F. Miro, C. M. Howles, and S. G. Hillier, “Effect of luteinizing hormone on follicle stimulating hormone-activated paracrine signalling in rat ovary,” Human Reproduction, vol. 10, no. 1, pp. 33–39, 1995. View at: Publisher Site | Google Scholar
  12. K. E. Ryan, C. Glister, P. Lonergan, F. Martin, P. G. Knight, and A. C. Evans, “Functional significance of the signal transduction pathways Akt and Erk in ovarian follicles: in vitro and in vivo studies in cattle and sheep,” Journal of Ovarian Research, vol. 1, article 2, 13 pages, 2008. View at: Publisher Site | Google Scholar
  13. C. Gilling-Smith, D. S. Willis, R. W. Beard, and S. Franks, “Hypersecretion of androstenedione by isolated thecal cells from polycystic ovaries,” Journal of Clinical Endocrinology & Metabolism, vol. 79, no. 4, pp. 1158–1165, 1994. View at: Publisher Site | Google Scholar
  14. J. M. Young and A. S. McNeilly, “Theca: the forgotten cell of the ovarian follicle,” Reproduction, vol. 140, no. 4, pp. 489–504, 2010. View at: Publisher Site | Google Scholar
  15. G. Chaturvedi, K. Arai, D. Limback, K. F. Roby, and P. F. Terranova, “Src tyrosine kinase regulates CYP17 expression and androstenedione secretion in theca-enriched mouse ovarian cells,” Endocrine, vol. 25, no. 2, pp. 147–154, 2004. View at: Publisher Site | Google Scholar
  16. G. Chaturvedi, K. Arai, P. F. Terranova, and K. F. Roby, “The Src tyrosine kinase pathway regulates thecal CYP17 expression and androstenedione secretion,” Molecular and Cellular Biochemistry, vol. 318, no. 1-2, pp. 191–200, 2008. View at: Publisher Site | Google Scholar
  17. K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. View at: Publisher Site | Google Scholar
  18. D. M. Stocco, X. Wang, Y. Jo, and P. R. Manna, “Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: more complicated than we thought,” Molecular Endocrinology, vol. 19, no. 11, pp. 2647–2659, 2005. View at: Publisher Site | Google Scholar
  19. P. R. Manna, S. P. Chandrala, Y. Jo, and D. M. Stocco, “cAMP-independent signaling regulates steroidogenesis in mouse Leydig cells in the absence of StAR phosphorylation,” Journal of Molecular Endocrinology, vol. 37, no. 1, pp. 81–95, 2006. View at: Publisher Site | Google Scholar
  20. R. E. Gore-Langton and D. T. Armstrong, “Follicular steroidogenesis and its control,” in The Physiology of Reproduction, E. Knobil and J. D. Neill, Eds., pp. 571–627, Raven Press, New York, NY, USA, 2nd edition, 1994. View at: Google Scholar
  21. J. E. Fortune and D. T. Armstrong, “Androgen production by theca and granulosa isolated from proestrous rat follicles,” Endocrinology, vol. 100, no. 5, pp. 1341–1347, 1977. View at: Publisher Site | Google Scholar
  22. A. D. Murdoch, L. M. Grady, M. P. Ablett, T. Katopodi, R. S. Meadows, and T. E. Hardingham, “Chondrogenic differentiation of human bone marrow stem cells in transwell cultures: generation of scaffold-free cartilage,” Stem Cells, vol. 25, no. 11, pp. 2786–2796, 2007. View at: Publisher Site | Google Scholar
  23. M. Li, K. Xue, J. Ling, F.-Y. Diao, Y.-G. Cui, and J.-Y. Liu, “The orphan nuclear receptor NR4A1 regulates transcription of key steroidogenic enzymes in ovarian theca cells,” Molecular and Cellular Endocrinology, vol. 319, no. 1-2, pp. 39–46, 2010. View at: Publisher Site | Google Scholar
  24. J. A. Parrott and M. K. Skinner, “Kit ligand actions on ovarian stromal cells: effects on theca cell recruitment and steroid production,” Molecular Reproduction and Development, vol. 55, no. 1, pp. 55–64, 2000. View at: Google Scholar
  25. J. K. Wickenheisser, V. L. Nelson-DeGrave, and J. M. McAllister, “Human ovarian theca cells in culture,” Ttrends in Endocrinology and Metabolism, vol. 17, no. 2, pp. 65–71, 2006. View at: Publisher Site | Google Scholar
  26. C. Murayama, H. Miyazaki, A. Miyamoto, and T. Shimizu, “Luteinizing hormone (LH) regulates production of androstenedione and progesterone via control of histone acetylation of StAR and CYP17 promoters in ovarian theca cells,” Molecular and Cellular Endocrinology, vol. 350, no. 1, pp. 1–9, 2012. View at: Publisher Site | Google Scholar
  27. C. Alviggi, R. Clarizia, A. Mollo, A. Ranieri, and G. De Placido, “Who needs LH in ovarian stimulation?” Reproductive BioMedicine Online, vol. 12, no. 5, pp. 599–607, 2006. View at: Publisher Site | Google Scholar
  28. H. A. Lavoie and S. R. King, “Transcriptional regulation of steroidogenic genes: STARD1, CYP11A1 and HSD3B,” Experimental Biology and Medicine, vol. 234, no. 8, pp. 880–907, 2009. View at: Publisher Site | Google Scholar
  29. P. Froment and P. Touraine, “Thiazolidinediones and fertility in polycystic ovary syndrome (PCOS),” PPAR Research, vol. 2006, Article ID 73986, 8 pages, 2006. View at: Publisher Site | Google Scholar
  30. R. A. Lobo, O. A. Kletzky, J. D. Campeau, and G. S. DiZerega, “Elevated bioactive luteinizing hormone in women with the polycystic ovary syndrome,” Fertility and Sterility, vol. 39, no. 5, pp. 674–678, 1983. View at: Google Scholar
  31. R. L. Rosenfield and B. Bordini, “Evidence that obesity and androgens have independent and opposing effects on gonadotropin production from puberty to maturity,” Brain Research, vol. 1364, pp. 186–197, 2010. View at: Publisher Site | Google Scholar
  32. C. K. Welt, J. A. Gudmundsson, G. Arason et al., “Characterizing discrete subsets of polycystic ovary syndrome as defined by the Rotterdam criteria: the impact of weight on phenotype and metabolic features,” Journal of Clinical Endocrinology and Metabolism, vol. 91, no. 12, pp. 4842–4848, 2006. View at: Publisher Site | Google Scholar

Copyright © 2015 Xiaoqiang Liu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

2118 Views | 612 Downloads | 7 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.