Research Article
Molecular Characterization of LRB7 Gene and a Water Channel Protein TIP2 in Chorispora bungeana
Table 1
DNA/RNA primer sequences used in this study.
| Primers | From 5′ to 3′ | Denote |
| P1 | TTGCTGGDGTTGGGTCHGC | For the first fragment of LRB7 cDNA | P2 | TCCGCGGCYGTKGCRTAAACI | For the first fragment of LRB7 cDNA | P3 | CGCTTTGGTCTACACCGTCTA | For the second fragment of LRB7 cDNA | P4 | TCGGAAGAACMCAYGAASACAT | For the second fragment of LRB7 cDNA | P5 | GCGGAATTCATGGCAGGAGTAGCCTTCGGT | For the genomic region of LRB7 | P6 | GCGAAGCTTGAAATCAGAAGAA GCAAGAGG | For the genomic region of LRB7 | P7 | GGAGCTGAGAGATTCCGTTGC | For the actins gene | P8 | GAAG CATTTCCTGTGGACAATCGA | For the actins gene | P9 | ATCTTCTTCATTAAACAAAAAC | Semiquantitative RT-PCR analysis of LRB7 | P10 | GTAAACGGTGTAGACCAAA | Semiquantitative RT-PCR analysis of LRB7 | 5′ GSP1 | GAGATGTTGGCTCCGATTGCGAC | For the 5′ RACE of LRB7 | 5′ GSP2 | CTAGTCCGGGCGTGTCAAGAGCA | For the 5′ RACE of LRB7 | 3′ GSP3 | TCACTGGGTCTACTGGGTGGGTC | For the 3′ RACE of LRB7 | 3′ GSP4 | TGCCGGAGCTGTTTATGGCAATG | For the 3′ RACE of LRB7 |
|
|