BioMed Research International

BioMed Research International / 2016 / Article

Research Article | Open Access

Volume 2016 |Article ID 9823697 | 10 pages |

KvLEA, a New Isolated Late Embryogenesis Abundant Protein Gene from Kosteletzkya virginica Responding to Multiabiotic Stresses

Academic Editor: Byoung R. Jeong
Received14 Jan 2016
Accepted03 Mar 2016
Published30 Mar 2016


The LEA proteins are a kind of hydrophilic proteins, playing main functions in desiccation tolerance. However, their importance as a kind of stress proteins in abiotic stress is being clarified little by little. In this study we isolated, cloned, and identified the first KvLEA gene in Kosteletzkya virginica. Bioinformatic analysis showed that the protein encoded by this gene had common properties of LEA proteins and the multiple sequences alignment and phylogenetic analysis further showed that this protein had high homology with two Arabidopsis LEA proteins. Gene expression analysis revealed that this gene had a higher expression in root and it was induced obviously by salt stress. Moreover, the transcripts of KvLEA were also induced by other abiotic stresses including drought, high temperature, chilling, and ABA treatment. Among these abiotic stresses, ABA treatment brought about the biggest changes to this gene. Collectively, our research discovered a novel LEA gene and uncovered its involvement in multiabiotic stresses in K. virginica. This research not only enriched studies on LEA gene in plant but also would accelerate more studies on K. virginica in the future.

1. Introduction

Plants are continuously subjected to environmental stresses such as drought, high salinity, cold, chilling, and freezing along their life cycles. These abiotic stresses can negatively affect plants in growth and development, leading to enormous losses in agricultural production throughout the world [1, 2]. For survival, plants have developed a variety of anatomical and morphological features which may alleviate the damage of these adverse conditions. Both the activation of stress responsive genes and the synthesis of resistant proteins trigger a series of physiological and metabolism responses to environmental stresses [35]. The late embryogenesis abundant (LEA) protein is one of the many resistant proteins which were synthesized under adverse conditions [6, 7].

The researches on LEA proteins began with the discovery of the first LEA protein, which was discovered in cotton seeds more than three decades ago [8]. From then on, the studies on LEA proteins have never stopped. So far, we have known that these proteins are highly hydrophilic and intrinsically disordered, with low proportions of cysteine and tryptophan and high proportions of glycine, glutamate, lysine, and threonine [9, 10]. According to the amino acid sequences and conserved motifs, the LEA proteins are generally categorized into different groups in different plants [11]. For instance, there are as many as 51 LEA proteins in Arabidopsis and they are divided into nine groups, including LEA-1, LEA-2, LEA-3, LEA-4, LEA-5, SMP, PvLEA18, dehydrin, and AtM [7]. However, according to the PFAM database, LEA proteins were grouped into eight families: dehydrin, LEA_1, LEA_2, LEA_3, LEA_4, LEA_5, LEA_6, and SMP, without the AtM group [12]. The LEAPdb which was a public database of LEA gene sequences gave a more detailed classification, with 12 nonredundant groups [13].

As the researches on LEA move along, the importance of LEA proteins is reported by more and more studies. Their synthesis in large amount during the late stages of seed development enables the maturing seeds to acquire the desiccation tolerance. Importantly, by means of stabilizing proteins, nucleic acids, and cell membranes, LEA proteins are proved to be the common components associated with tolerance to various stresses [14, 15]. For example, the maize LEA3 gene was discovered to be induced by ABA and hyperosmolarity [16], and afterwards it was proved to be able to reduce cell shrinkage effects under dehydration [17]. Similarly, a novel LEA gene was identified in wheat which was induced by freezing tolerance [18]. The reduced expression of CeLEA1, a LEA-like protein from Caenorhabditis elegans, led to reduced survival under desiccation and osmotic and heat stresses [19]. On the other hand, ectopic expressions of LEA in various organisms also gave the evidence for their functions in stress protection [9, 20, 21]. The transgenic wheat and rice with heterogeneous expression of LEA gene from barley acquired enhanced drought and salt tolerance [22, 23]. Overexpressing NtLEA7-3 in Arabidopsis endowed the transgenic plants with enhanced resistance to cold, drought, and salt stresses [24]. In Arabidopsis, the SAG21 was discovered to enhance the tolerance against bacterial pathogen (Pst DC3000) and oxidative stress [25]. The LEA protein Rab28 which is localized in the nucleus in maize embryo can enhance transgenic maize tolerance to drought stress [26]. Therefore, the LEA proteins are involved not only in water deficit but also in abiotic stresses. It is one of the key factors for plants to respond to adverse environment.

K. virginica is a newly introduced species due to its amazing salt stress resistance and potential economic value [27]. It was reported that this plant was able to maintain normal growth and development under adverse conditions with 0.3% to 2.5% sodium salt [28]. Thus, it must possess highly efficient physiological, biochemical, and molecular mechanisms to do this. Therefore, we are interested in its special mechanisms under salt stress, in the hope of uncovering novel resistance mechanisms in it. However, the genetic information on it is very scarce. As far as we know, there are almost no reports about the molecular mechanism of salt resistance on K. virginica, except for one report covering the gene expression analysis on K. virginica seedlings by cDNA-amplified fragment length polymorphism (cDNA-AFLP) technology [29].

Based on the diverse biological functions of LEA proteins as stated before, we wondered whether LEA also had similar roles in K. virginica. Therefore, this study aimed to clone, isolate, identify, and explore the possible functions of a LEA gene in K. virginica. With the help of transcriptome analysis of K. virginica under salt stress in our recent research, we got the core sequence of the gene [30]. RACE technology was adopted to clone the whole sequence of this gene. The biological software such as ProParam, InterProScan 5, BLASTp, and CLUSTALWX was used to do the sequence prediction and analysis. Phylogenetic tree was constructed to analyze which subgroup it may belong to. Furthermore, qPCR assays were carried out to detect the gene expression patterns under abiotic stresses. This study about the first LEA gene in K. virginica further enriched the research information on LEA gene. Meanwhile, it also laid a good foundation for molecular studies in K. virginica.

2. Material and Methods

2.1. Plant Materials and Growth Conditions

The seeds of K. virginica used in this study were coming from the K. virginica growing in Yellow River Delta, Shandong Province, China. The collected seeds were disinfected with 70% alcohol solution for 30 s and 0.1% mercuric chloride solution for 10 min and then washed thoroughly with sterile water six times. The surface-sterilized seeds were laid on wet filter paper for germination and then the germinating seeds were planted in vermiculite in plastic pots watered with Hoagland’s solution [31]. The seedlings were cultivated under conditions of 16 h light/8 h dark and the temperature was kept at 25°C/20°C, respectively, in day and night in artificial climatic chambers (Huier, China). The humidity was kept at 60% and the seedlings were watered every 3 days with nutrition solution. Two-week-old and homogeneous seedlings were chosen for different samplings and six homogeneous seedlings at least were contained in each sample. However, the samples for tissue expression pattern detection came from the different corresponding tissues, respectively. All the samples were frozen with liquid nitrogen and stored at −80°C.

2.2. Cloning and Sequence Analysis of KvLEA

For gene cloning total RNA was extracted with RNAiso Plus (TaKaRa, total RNA extraction reagent) according to the operation steps. Agilent 2100 BioAnalyzer (Agilent Technologies, CA, USA) was used for the detection of the RNA quality and quantity. The full length of KvLEA was amplified by RACE according to the user manual (SMART RACE cDNA Amplification Kit). The gene-specific primers (GSPs) (forward: CCTCCTGCTCCTGGCTCTTA; reverse: GGTGGCTGAAGGGACGGAGTA) and the nested primers (NGSPs) (forward: CCTGGCTCTTACTACCAACGAC; reverse: AAGCAGACGGCATCCGAAAC) were designed based on the cDNA core sequence coming from our previous transcriptome sequencing data, which had been deposited in Transcriptome Shotgun Assembly (TSA) Sequence Database with the accession number GCJL00000000 [30]. The PCR products were cloned into pEASY®-T5 Zero Cloning Vector (Transgene, China) after purification from gels for sequencing. The physical and chemical parameters of KvLEA protein were analyzed with ProParam, InterProScan 5 (, and the Sequence Manipulation Suite ( The BLASTp was performed at NCBI (National Center for Biotechnology for Information, [32]. Multiple sequence alignment was carried out among the deduced KvLEA protein and all the eighteen LEA_4 proteins in Arabidopsis with CLUSTALWX program. The phylogenetic tree was produced based on the multiple sequence alignment using MEGA 6.0 software by Neighbor-Joining method [33].

2.3. Multiabiotic Stress Treatments

The two-week-old K. virginica seedlings grown in plastic pots (six seedlings at least in each pot) were selected for our research. For heat and chilling stress treatments, the homogeneous seedlings were transferred to different artificial climatic chambers (Huier, China) at 42°C and 4°C, respectively. For high salinity, drought, and ABA stress treatments, the plants were irrigated with nutrient solution with 300 mM NaCl, 15% PEG 6000, and 100 μM ABA, respectively. The handling times for all the treatments were 0, 2, 6, 12, and 24 hours. The control sample was kept at normal growth conditions and irrigated with nutrition solution. The control and treated samples were all removed from the matrix and washed carefully after treatments. Then, the seedlings were soaked up cautiously and quick-frozen in liquid nitrogen and stored at −80°C for use.

2.4. RNA Isolation and Gene Expression Analysis

The total RNA was extracted from samples with RNAiso Plus (TaKaRa, total RNA extraction reagent). The first-strand DNA was synthesized with TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, China). The qPCR was performed with the cDNA diluted at a certain ratio as template and the gene-specific qPCR primers were designed with the primer-design software Beacon Designer 7.0. The primers are 5′-TAGTAAGAGCCAGGAGCAGGAG and 3′-TTGAACTCGCCAGCCTTATCTC. The primers of the internal control gene KvEF1-α are 5′-TCAATGAGCCAAAGAGG and 3′-CAACACGACCAACAGGA.

The qPCR was conducted on the instrument ABI Prism® 7500 FAST (Applied Biosystems, Foster City, CA) and the reaction was performed using SYBR® Green Real-Time Selected Master Mix (Applied Biosystems by Life Technologies®) according to the user manual. The reaction volume was 20 μL, including 2 μL diluted cDNA template, 10 μL 2x SYBR Master Mix, and 200 nM of each primer. The reaction processes were as follows: (1) initial denaturation at 95°C for 2 min, 40 cycles of 15 s at 95°C for denaturation of template, and 1 min at 60°C for annealing and extension. The detection of the fluorescence signal was conducted at the temperature between 60°C and 90°C. The primer specificity was ensured beforehand by the typical melting curve and amplification plot as well as the sole product in RT-PCR. The cDNA template was diluted to guarantee that the Ct values of all the samples were located in the appropriate scope. Each sample was performed in triplicate and three biological replicates were performed to decrease the error.

2.5. Statistical Analysis

The relative expression level was calculated with method. Namely, the ΔCt values were the difference of the Ct values between target gene and the internal control gene (ΔCt = targetCt − EFCt). ΔΔCt values were the difference of the ΔCt values between sample ΔCt and control ΔCt (ΔΔCt = sampleΔCt − controlΔCt). The mean value and standard error (SD) of the three biological replicates were calculated through Microsoft Excel 2007. Plotting was performed with SigmaPlot 12.0.

3. Results

3.1. Isolation and Sequence Analysis of KvLEA Gene

The full length of KvLEA gene was determined by 5′ and 3′ rapid amplification of cDNA ends (RACE) technology. The total sequence of the gene is 1359 bp, along with a 184 bp 5′ untranslated region (UTR) and a 359 bp 3′ UTR. Hence, the open reading frame (ORF) of KvLEA is 816 bp and encodes a protein with 271 amino acids (Figure 1(a)). The sequence information of this gene had been presented to NCBI database and the GenBank accession number was KP688391. The KvLEA protein was predicted to be 29.79 kD molecular mass and the isoelectric point (pI) was 7.61. The grand average of hydropathicity (GRAVY) and the instability index of it were −1.292 and 28.49, respectively ( Meanwhile, the amino acid sequence of KvLEA protein is rich in alanine (17%), lysine (15%), and glutamic acid (11%), while lacking cysteine, histidine, tryptophan, and arginine. Thus, the percentage of the hydrophilic amino acid in it is reaching up to 70.85%, a hydrophilic protein. According to Kyte-Doolittle hydropathy plot [34], KvLEA protein also should be hydrophilic, except for a few hydrophobic residues at its N-terminus (Figure 1(b)).

With the deduced amino acid sequence, a BLASTp search was conducted at NCBI database ( The results indicated that KvLEA protein contained three LEA_4 (accession: pfam02987) superfamily conserved motif repeats and the locations of the three repeat motifs were 107–150 bp (-value: ), 152–194 bp (-value: ), and 191–234 bp (-value: ), respectively (Figure 1(c)), implying that this LEA protein might belong to LEA_4 group, which was the largest group among the nine groups in Arabidopsis. The motif analysis by InterProScan 5 ( also showed a similar result, with four repeats of LEA_4 (accession: pfam02987) superfamily conserved motifs (Supplemental S1 in Supplementary Material available online at We also analyzed the transmembrane domain of the protein at the same time. The prediction indicated that it had no transmembrane domain, staying with the same character of the other LEA_4 proteins (Supplemental S2). To further verify whether KvIEA belonged to the LEA_4 type LEA gene, a phylogenetic tree was constructed with the predicted sequence of KvLEA protein and all the eighteen LEA proteins belonging to LEA_4 group in Arabidopsis (Figure 1(d)). The result revealed that KvLEA should be a LEA_4 group member, sharing high genetic homology with two Arabidopsis genes At2g36640 and At3g53040 in the LEA_4 group.

3.2. KvLEA Expression Profiles under Normal and Salt Stress Treatment

As soon as we acquired the full gene sequence, we determined the tissue expression profiles of this gene at first. RNA was extracted from root, stem, and leaf, respectively, and the determination of the expressions was carried out by qPCR. The expression pattern (Figure 2(a)) showed that KvLEA tended to be expressed in root with priority. The expression level in root is more than 50 times that in leaf, implying that it might play an important role in root.

On account that KvLEA gene was obtained by screening our transcriptome sequencing data (accession number GCJL00000000) [30] of K. virginica, which displayed apparent transcripts accumulation under salt treatment, we studied this gene under salt stress in detail. We detected the conditions of the expression under different salt stress duration and different salt concentrations. In keeping with the transcriptome results, the gene indeed was induced by salt stress in different degrees under different salt conditions. With the increase of the salt stress intensities, the responses strengthened gradually (Figure 2(b)). 300 and 400 mM NaCl led to pronounced elevations in gene expression compared with 100 and 200 mM treatments. As shown in Figure 2(b), 400 mM NaCl triggered the most pronounced surge in expression at about 16-fold increase. With regard to the different duration of salt stresses, the accumulations of KvLEA gene kept at a high level all the time from 2 h to 24 h (Figure 2(c)). The transcripts accumulated a lot immediately after 2 h treatment and kept steadily high in the following time. Therefore, KvLEA should play an important role in salt tolerance and contribute to the high salt resistance of K. virginica.

3.3. Expression Patterns of KvLEA under Various Abiotic Stress Treatments

Previous researches have reported that some LEA proteins participated in various abiotic stresses such as high temperature [21], high salinity [35, 36], osmotic stress [36], and chilling stress [24]. Then, we wondered whether our KvLEA protein was also involved in these abiotic stresses, so we also examined the performances of KvLEA gene under these conditions. The results showed that KvLEA gene responded to drought, heat, chilling, and ABA treatments too. Under drought stress treatment, the KvLEA transcripts were induced and the accumulation increased progressively with time (Figure 3(a)), while the responses of KvLEA to drought stress were weak. The difference could be regarded as not significant or weak (generally, expression ratio ≥ 2 or ≤0.5 was deemed as the boundary of the significance). Compared to drought treatment, heat stress triggered more obvious accumulation to KvLEA transcripts and the accumulation appeared to be the highest at 2 h after treatment. However, contrary to drought stress, the transcripts under heat stress decreased with time (Figure 3(b)). The responses of KvLEA to chilling stress were interesting. It only displayed distinct response at 6 h after treatment, yet there were no differences at other time points (Figure 3(c)). In addition, 100 μM ABA caused the most obvious accumulations to this gene among all the abiotic stresses, especially at 6 h with 44-fold increase (Figure 3(d)).

4. Discussion

To adapt to the ever-changing ambient conditions, higher plants have developed complicated resistance mechanisms along with their evolutionary history. The existence of LEA proteins is a good example. Generally, these proteins share some common properties, including high hydrophilicity, repeat motifs, and low sequence complexity [37, 38]. In the present study, we isolated and cloned the first LEA gene in K. virginica. In the context of previous studies, this research also analyzed the sequence information of KvLEA gene at first. Similar to the common properties of most LEA proteins, KvLEA protein also has high hydrophilicity and contains repeat motifs. It is composed of high percentage of hydrophilic amino acids and the percentage of the hydrophilic amino acids is as much as 70.85%. Both the value of the grand average of hydropathicity (GRAVY) and the analysis of Kyte-Doolittle hydropathy plot verify its hydrophily at the same time (Figure 1(b)). On the other hand, the BLASTp search (Figure 1(c)) and the InterProScan 5 prediction (Supplemental S1) proved the existence of the repeat motifs in KvLEA protein.

On account of the function researches, LEA proteins are proposed to have a broad influence on abiotic stress responses in plants (Sun et al., 2013). For instance, dehydrin CaDHN1 made great contributions to multiple abiotic stresses in Capsicum annuum L. [39]. In potato, the expressions of five StLEA genes were induced by both salt and drought stresses [40]. Moreover, the CaLEA1 in pepper acted in ABA signaling regulation, drought, and salt stress responses [41]. In our KvLEA expression analysis, the results indicated a similar condition. Its expression is also strongly induced by salt stress under different NaCl concentrations and at different time points. With the increase of the salt concentrations, the responses enhanced gradually and 300 and 400 mM treatment led to obvious responses (Figure 2(b)). On the bases of our previous researches on K. virginica, 100 to 200 mM NaCl which was already drastic salt stress for common plant had little effect on it, and only when the concentration reached 300 mM or more did the influence begin to emerge [4244]. That is why we chose 300 mM for different time gradient treatments and this reflected the strong salt resistance of K. virginica at the same time. Under 300 mM condition, the response to NaCl was rapid and the expression level reached high value immediately after 2 h treatment (Figure 2(c)), though, from 2 h to 12 h, the accumulation of the transcripts declined a little, while from 12 h to 24 h the expression rose up again, indicating that there might be a feedback adjustment between the salt stress and the plant resistance. The mix performances were also discovered in previous research on other species under the same conditions. For instance, the ZmLEA3 in maize displayed two peaks during 48 h treatment. The accumulation reached a peak at 24 h and then reduced from 24 h to 36 h, while from 36 h to 48 h the accumulation rose up again, reaching a new peak [10]. In tobacco, the same presentation also appeared, while the difference was that the mix performances were downregulated [45]. Therefore, more in-depth studies are needed to uncover the complicated mechanisms underlying the KvLEA gene and the salt resistance in K virginica.

The responses of KvLEA gene to abiotic stresses showed us that it could be induced by a variety of abiotic stresses, while the response of KvLEA to drought stress was weak (Figure 3(a)). We speculated that there may be other LEA proteins in charge of responding to drought stress in K. virginica and there may also be many other LEA proteins having key functions in various abiotic stresses. In addition, according to the gene expression analysis, the gene also responded to heat (Figure 3(b)) and chilling (Figure 3(c)). Although many of the reported LEA genes were discovered to be expressed highly in seeds, there were several LEA genes responding to temperature fluctuation. For example, the Arabidopsis LEA genes At2g42530 and At2g42540 were cold responsive genes; thus, they were called COR15A (cold responsive 15A) and COR15B [46].

The most amusing performance appeared in ABA treatment (Figure 3(d)). ABA is a key phytohormone which can be involved in kinds of abiotic stresses. On the one hand, the abiotic stresses such as salt, drought, and cold stresses can lead to the production of ABA. On the other hand, the accumulated ABA can in return affect the expressions of many abiotic responsive genes and lead to stress responses [47, 48]. In this study, the exogenous applied ABA caused an obvious accumulation to this gene (Figure 3(d)). Furthermore, the expression of this gene reached more than 40-fold increase after 6 h treatment, illustrating that there may be complicated correlations between KvLEA gene and ABA in K. virginica. Lately, a proteomic analysis on maize seeds revealed that the deficiency of ABA in ABA-deficit mutant decreased the accumulation of several LEA proteins [49]. And the transgenic Arabidopsis overexpressing pepper CaLEA1 gene exhibited supersensitivity to ABA [41]. Therefore, more researches are needed to uncover the specific correlation between ABA and KvLEA in K. virginica in the future. Importantly, transgenic technology should be employed to study the functions of the gene in depth.

5. Conclusion

In conclusion, our present study isolated, cloned, and identified the first LEA gene from K. virginica. The deduced amino acid sequences of this gene showed that it was a typical LEA protein possessing many common properties of LEA proteins and had high homology with Arabidopsis LEA_4 genes At2g36640 and At3g53040. The tissue expression pattern analysis showed that this gene displayed a higher expression level in root. In spite of that, most LEA genes are induced by desiccation and large amount of LEA proteins is synthesized to improve desiccation tolerance, while the LEA genes also have many other known and unknown important functions. Our research revealed that KvLEA gene was induced not only by salt stress but also by a variety of other abiotic stresses especially for ABA treatment in K. virginica.

Competing Interests

The authors declare no conflict of interests.

Authors’ Contributions

Xiaoli Tang, Hongyan Wang, and Hongbo Shao designed the experiment. Xiaoli Tang performed the experiment and analyzed the data with Liye Chu. Xiaoli Tang and Hongbo Shao wrote the paper. All authors read and agreed on the final paper.


This work was supported by the National Natural Science Foundation of China (41171216), the National Basic Research Program of China (2013CB430403), Shuangchuang Talent Plan of Jiangsu Province, Jiangsu Autonomous Innovation of Agricultural Science & Technology [CX(15)1005], Jiangsu Key Laboratory for Bioresources of Saline Soils (JKLBS2014002), and Yantai Double-Hundred Talent Plan (XY-003-02).

Supplementary Materials

In order to verify the BLASTp results, both InterProScan 5 and TMHMM software were aplied to carry out the motif analysis and transmembrane domain pridiction. The two results which were listed in supplemental S1 and S2 also indicated this protein should be a member of LEA_4 group. Therefore, the 18 LEA_4 proteins in Arabidopsis were used for phylogenetic analysis. The gene IDs and names of the 18 proteins were listed in Supplemental S3 and the analysis result was displayed in Fig 1(d).

  1. Supplementary Material


  1. R. Munns and M. Tester, “Mechanisms of salinity tolerance,” Annual Review of Plant Biology, vol. 59, pp. 651–681, 2008. View at: Publisher Site | Google Scholar
  2. X. Tang, X. Mu, H. Shao, H. Wang, and M. Brestic, “Global plant-responding mechanisms to salt stress: physiological and molecular levels and implications in biotechnology,” Critical Reviews in Biotechnology, vol. 35, no. 4, pp. 425–437, 2015. View at: Publisher Site | Google Scholar
  3. L. Xiong, K. S. Schumaker, and J.-K. Zhu, “Cell signaling during cold, drought, and salt stress,” Plant Cell, vol. 14, no. 1, pp. S165–S183, 2002. View at: Publisher Site | Google Scholar
  4. K. Yamaguchi-Shinozaki and K. Shinozaki, “Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses,” Annual Review of Plant Biology, vol. 57, pp. 781–803, 2006. View at: Publisher Site | Google Scholar
  5. J. You, W. Zong, H. Hu, X. Li, J. Xiao, and L. Xiong, “A STRESS-RESPONSIVE NAC1-regulated protein phosphatase gene rice Protein Phosphatase18 modulates drought and oxidative stress tolerance through abscisic acid-independent reactive oxygen species scavenging in rice,” Plant Physiology, vol. 166, no. 4, pp. 2100–2114, 2014. View at: Publisher Site | Google Scholar
  6. N. Bies-Ethève, P. Gaubier-Comella, A. Debures et al., “Inventory, evolution and expression profiling diversity of the LEA (late embryogenesis abundant) protein gene family in Arabidopsis thaliana,” Plant Molecular Biology, vol. 67, no. 1-2, pp. 107–124, 2008. View at: Publisher Site | Google Scholar
  7. M. Hundertmark and D. K. Hincha, “LEA (late embryogenesis abundant) proteins and their encoding genes in Arabidopsis thaliana,” BMC Genomics, vol. 9, article 118, 2008. View at: Publisher Site | Google Scholar
  8. L. Dure III and G. A. Galau, “Developmental biochemistry of cottonseed embryogenesis and germination,” Plant Physiology, vol. 68, no. 1, pp. 187–194, 1981. View at: Publisher Site | Google Scholar
  9. A. Candat, G. Paszkiewicz, M. Neveu et al., “The ubiquitous distribution of late embryogenesis abundant proteins across cell compartments in Arabidopsis offers tailored protection against abiotic stress,” Plant Cell, vol. 26, no. 7, pp. 3148–3166, 2014. View at: Publisher Site | Google Scholar
  10. Y. Liu, L. Wang, X. Xing et al., “ZmLEA3, a multifunctional group 3 LEA protein from maize (Zea mays L.), is involved in biotic and abiotic stresses,” Plant and Cell Physiology, vol. 54, no. 6, pp. 944–959, 2013. View at: Publisher Site | Google Scholar
  11. M. Battaglia, Y. Olvera-Carrillo, A. Garciarrubio, F. Campos, and A. A. Covarrubias, “The enigmatic LEA proteins and other hydrophilins,” Plant Physiology, vol. 148, no. 1, pp. 6–24, 2008. View at: Publisher Site | Google Scholar
  12. R. D. Finn, A. Bateman, J. Clements et al., “Pfam: the protein families database,” Nucleic Acids Research, vol. 42, no. 1, pp. D222–D230, 2014. View at: Publisher Site | Google Scholar
  13. G. Hunault and E. Jaspard, “LEAPdb: a database for the late embryogenesis abundant proteins,” BMC Genomics, vol. 11, no. 1, article 221, 2010. View at: Publisher Site | Google Scholar
  14. M. Battaglia and A. A. Covarrubias, “Late Embryogenesis Abundant (LEA) proteins in legumes,” Frontiers in Plant Science, vol. 4, article 190, 2013. View at: Publisher Site | Google Scholar
  15. F. Jia, S. Qi, H. Li et al., “Overexpression of late embryogenesis abundant 14 enhances arabidopsis salt stress tolerance,” Biochemical and Biophysical Research Communications, vol. 454, no. 4, pp. 505–511, 2015. View at: Publisher Site | Google Scholar
  16. E. B. Thomann, J. Sollinger, C. White, and C. J. Rivin, “Accumulation of group 3 late embryogenesis abundant proteins in zea mays embryos: Roles of abscisic acid and the viviparous-1 gene product,” Plant Physiology, vol. 99, no. 2, pp. 607–614, 1992. View at: Publisher Site | Google Scholar
  17. I. Amara, A. Odena, E. Oliveira et al., “Insights into maize LEA proteins: from proteomics to functional approaches,” Plant and Cell Physiology, vol. 53, no. 2, pp. 312–329, 2012. View at: Publisher Site | Google Scholar
  18. K. Sasaki, N. K. Christov, S. Tsuda, and R. Imai, “Identification of a novel LEA protein involved in freezing tolerance in wheat,” Plant and Cell Physiology, vol. 55, no. 1, pp. 136–147, 2014. View at: Publisher Site | Google Scholar
  19. T. Z. Gal, I. Glazer, and H. Koltai, “An LEA group 3 family member is involved in survival of C. elegans during exposure to stress,” FEBS Letters, vol. 577, no. 1-2, pp. 21–26, 2004. View at: Publisher Site | Google Scholar
  20. M. Wang, P. Li, C. Li et al., “SiLEA14, a novel atypical LEA protein, confers abiotic stress resistance in foxtail millet,” BMC Plant Biology, vol. 14, no. 1, article 290, 2014. View at: Publisher Site | Google Scholar
  21. X. Zhang, S. Lu, C. Jiang et al., “RcLEA, a late embryogenesis abundant protein gene isolated from Rosa chinensis, confers tolerance to Escherichia coli and Arabidopsis thaliana and stabilizes enzyme activity under diverse stresses,” Plant Molecular Biology, vol. 85, no. 4, pp. 333–347, 2014. View at: Publisher Site | Google Scholar
  22. D. Xu, X. Duan, B. Wang, B. Hong, T.-H. D. Ho, and R. Wu, “Expression of a late embryogenesis abundant protein gene, HVA1, from barley confers tolerance to water deficit and salt stress in transgenic rice,” Plant Physiology, vol. 110, no. 1, pp. 249–257, 1996. View at: Google Scholar
  23. E. Sivamani, A. Bahieldin, J. M. Wraith et al., “Improved biomass productivity and water use efficiency under water deficit conditions in transgenic wheat constitutively expressing the barley HVA1 gene,” Plant Science, vol. 155, no. 1, pp. 1–9, 2000. View at: Publisher Site | Google Scholar
  24. Y.-P. Gai, X.-L. Ji, W. Lu, X.-J. Han, G.-D. Yang, and C.-C. Zheng, “A novel late embryogenesis abundant like protein associated with chilling stress in Nicotiana tabacum cv. bright yellow-2 cell suspension culture,” Molecular & Cellular Proteomics, vol. 10, no. 11, Article ID M111.010363, 2011. View at: Publisher Site | Google Scholar
  25. F. M. Salleh, K. Evans, B. Goodall et al., “A novel function for a redox-related LEA protein (SAG21/AtLEA5) in root development and biotic stress responses,” Plant, Cell and Environment, vol. 35, no. 2, pp. 418–429, 2012. View at: Publisher Site | Google Scholar
  26. I. Amara, M. Capellades, M. D. Ludevid, M. Pagès, and A. Goday, “Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene,” Journal of Plant Physiology, vol. 170, no. 9, pp. 864–873, 2013. View at: Publisher Site | Google Scholar
  27. H. Wang, X. Tang, C. Shao, H. Shao, and H. Wang, “Molecular cloning and bioinformatics analysis of a new plasma membrane Na+/H+ antiporter gene from the halophyte Kosteletzkya virginica,” The Scientific World Journal, vol. 2014, Article ID 141675, 7 pages, 2014. View at: Publisher Site | Google Scholar
  28. G. Zhou, Y. Xia, B. L. Ma, C. Feng, and P. Qin, “Culture of seashore mallow under different salinity levels using plastic nutrient-rich matrices and transplantation,” Agronomy Journal, vol. 102, no. 2, pp. 395–402, 2010. View at: Publisher Site | Google Scholar
  29. Y.-Q. Guo, Z.-Y. Tian, G.-Y. Qin et al., “Gene expression of halophyte Kosteletzkya virginica seedlings under salt stress at early stage,” Genetica, vol. 137, no. 2, pp. 189–199, 2009. View at: Publisher Site | Google Scholar
  30. X. Tang, H. Wang, C. Shao, and H. Shao, “Global gene expression of Kosteletzkya virginica seedlings responding to salt stress,” PLoS ONE, vol. 10, no. 4, Article ID e0124421, 2015. View at: Publisher Site | Google Scholar
  31. D. R. Hoagland and D. I. Arnon, The Water-Culture Method for Growing Plants without Soil, vol. 347 of California Agricultural Experiment Station Circular, California Agricultural Experiment Station Publications, 1950.
  32. A. Marchler-Bauer, S. Lu, J. B. Anderson et al., “CDD: a Conserved Domain Database for the functional annotation of proteins,” Nucleic Acids Research, vol. 39, no. 1, pp. D225–D229, 2011. View at: Publisher Site | Google Scholar
  33. K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, “MEGA6: molecular evolutionary genetics analysis version 6.0,” Molecular Biology and Evolution, vol. 30, no. 12, pp. 2725–2729, 2013. View at: Publisher Site | Google Scholar
  34. J. Kyte and R. F. Doolittle, “A simple method for displaying the hydropathic character of a protein,” Journal of Molecular Biology, vol. 157, no. 1, pp. 105–132, 1982. View at: Publisher Site | Google Scholar
  35. Y. Liu, Y. Zheng, Y. Zhang, W. Wang, and R. Li, “Soybean PM2 protein (LEA3) confers the tolerance of Escherichia coli and stabilization of enzyme activity under diverse stresses,” Current Microbiology, vol. 60, no. 5, pp. 373–378, 2010. View at: Publisher Site | Google Scholar
  36. S.-C. Park, Y.-H. Kim, J. C. Jeong et al., “Sweetpotato late embryogenesis abundant 14 (IbLEA14) gene influences lignification and increases osmotic- and salt stress-tolerance of transgenic calli,” Planta, vol. 233, no. 3, pp. 621–634, 2011. View at: Publisher Site | Google Scholar
  37. M.-D. Shih, F. A. Hoekstra, and Y.-I. C. Hsing, “Late embryogenesis abundant proteins,” in Advances in Botanical Research, J.-C. Kader and M. Delseny, Eds., vol. 48, pp. 211–255, Academic Press, 2008. View at: Google Scholar
  38. A. Tunnacliffe, D. Hincha, O. Leprince, and D. Macherel, “LEA proteins: versatility of form and function,” in Dormancy and Resistance in Harsh Environments, E. Lubzens, J. Cerda, and M. Clark, Eds., pp. 91–108, Springer, Berlin, Germany, 2010. View at: Google Scholar
  39. R.-G. Chen, H. Jing, W.-L. Guo et al., “Silencing of dehydrin CaDHN1 diminishes tolerance to multiple abiotic stresses in Capsicum annuum L.,” Plant Cell Reports, vol. 34, no. 12, pp. 2189–2200, 2015. View at: Publisher Site | Google Scholar
  40. S. Charfeddine, M. N. Saïdi, M. Charfeddine, and R. Gargouri-Bouzid, “Genome-wide identification and expression profiling of the late embryogenesis abundant genes in potato with emphasis on dehydrins,” Molecular Biology Reports, vol. 42, no. 7, pp. 1163–1174, 2015. View at: Publisher Site | Google Scholar
  41. C. W. Lim, S. Lim, W. Baek, and S. C. Lee, “The pepper late embryogenesis abundant protein CaLEA1 acts in regulating abscisic acid signaling, drought and salt stress response,” Physiologia Plantarum, vol. 154, no. 4, pp. 526–542, 2015. View at: Publisher Site | Google Scholar
  42. C.-J. Ruan, H. Li, Y.-Q. Guo et al., “Kosteletzkya virginica, an agroecoengineering halophytic species for alternative agricultural production in China's east coast: ecological adaptation and benefits, seed yield, oil content, fatty acid and biodiesel properties,” Ecological Engineering, vol. 32, no. 4, pp. 320–328, 2008. View at: Publisher Site | Google Scholar
  43. H. Wang, X. Tang, H. Wang, and H. Shao, “Physiological responses of Kosteletzkya virginica to coastal wetland soil,” The Scientific World Journal, vol. 2015, Article ID 354581, 9 pages, 2015. View at: Publisher Site | Google Scholar
  44. H. Wang, X. Tang, H. Wang, and H.-B. Shao, “Proline accumulation and metabolism-related genes expression profiles in Kosteletzkya virginica seedlings under salt stress,” Frontiers in Plant Science, vol. 6, article 792, 2015. View at: Publisher Site | Google Scholar
  45. Y. Liu, L. Wang, S. Jiang, J. Pan, G. Cai, and D. Li, “Group 5 LEA protein, ZmLEA5C, enhance tolerance to osmotic and low temperature stresses in transgenic tobacco and yeast,” Plant Physiology and Biochemistry, vol. 84, pp. 22–31, 2014. View at: Publisher Site | Google Scholar
  46. P. L. Steponkus, M. Uemura, R. A. Joseph, S. J. Gilmour, and M. F. Thomashow, “Mode of action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana,” Proceedings of the National Academy of Sciences of the United States of America, vol. 95, no. 24, pp. 14570–14575, 1998. View at: Publisher Site | Google Scholar
  47. K. Nakashima and K. Yamaguchi-Shinozaki, “ABA signaling in stress-response and seed development,” Plant Cell Reports, vol. 32, no. 7, pp. 959–970, 2013. View at: Publisher Site | Google Scholar
  48. A. S. Raghavendra, V. K. Gonugunta, A. Christmann, and E. Grill, “ABA perception and signalling,” Trends in Plant Science, vol. 15, no. 7, pp. 395–401, 2010. View at: Publisher Site | Google Scholar
  49. X. Wu, F. Gong, L. Yang, X. Hu, F. Tai, and W. Wang, “Proteomic analysis reveals differential accumulation of small heat shock proteins and late embryogenesis abundant proteins between ABA-deficient mutant vp5 seeds and wild-type Vp5 seeds in maize,” Frontiers in Plant Science, vol. 5, article 801, 2014. View at: Publisher Site | Google Scholar

Copyright © 2016 Xiaoli Tang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1050 Views | 426 Downloads | 7 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder
 Sign up for content alertsSign up