Table of Contents Author Guidelines Submit a Manuscript
Research Article
BioMed Research International
Volume 2017, Article ID 3471417, 1 page
https://doi.org/10.1155/2017/3471417
Retraction

Retracted: Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer

BioMed Research International

Received 8 August 2017; Accepted 8 August 2017; Published 27 August 2017

Copyright © 2017 BioMed Research International. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


BioMed Research International has retracted the article titled “Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer” [1]. This article is one of a series of very similar articles on shRNA and cancer cell lines identified by Byrne and Labbé [2]; the intertextual distance between this article and another of the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé. The authors say resequencing showed that the nontargeting sequence plasmid they bought is actually an empty vector.(ii)There is duplication between panels in Figure (a) (between the top left and top right panels and between the bottom left and center left panels), which the authors say was due to carelessness.(iii)The control panels of Figures (a) and (a) in this article are the same as in Figures (a) and (a), respectively, in the authors’ article on Linc-ITGB1 [4], which was not cited. The authors said knockdown of KIAA0125 and Linc-ITGB1 expression by RNAi was performed simultaneously, so they shared the same controls.

References

  1. W. Lv, L. Wang, J. Lu, J. Mu, Y. Liu, and P. Dong, “Long noncoding RNA KIAA0125 potentiates cell migration and invasion in gallbladder cancer,” BioMed Research International, vol. 2015, Article ID 108458, 9 pages, 2015. View at Publisher · View at Google Scholar · View at Scopus
  2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017. View at Publisher · View at Google Scholar · View at Scopus
  3. Z. Wang, J. Sun, Y. Zhao, W. Guo, K. Lv, and Q. Zhang, “Lentivirus-mediated knockdown of tumor protein D52-like 2 inhibits glioma cell proliferation,” Cell Mol Biol (Noisy-le-grand), vol. 60, no. 1, pp. 39–44, 2014. View at Google Scholar
  4. L. Wang, Y. Zhang, W. Lv et al., “Long non-coding RNA Linc-ITGB1 knockdown inhibits cell migration and invasion in GBC-SD/M and GBC-SD gallbladder cancer cell lines,” Chemical Biology and Drug Design, vol. 86, no. 5, pp. 1064–1071, 2015. View at Publisher · View at Google Scholar · View at Scopus