BioMed Research International

BioMed Research International / 2017 / Article

Retraction | Open Access

Volume 2017 |Article ID 7640820 | https://doi.org/10.1155/2017/7640820

BioMed Research International, "Retracted: High Expression of PTGR1 Promotes NSCLC Cell Growth via Positive Regulation of Cyclin-Dependent Protein Kinase Complex", BioMed Research International, vol. 2017, Article ID 7640820, 1 page, 2017. https://doi.org/10.1155/2017/7640820

Retracted: High Expression of PTGR1 Promotes NSCLC Cell Growth via Positive Regulation of Cyclin-Dependent Protein Kinase Complex

Received08 Aug 2017
Accepted08 Aug 2017
Published28 Aug 2017

BioMed Research International has retracted the article titled “High Expression of PTGR1 Promotes NSCLC Cell Growth via Positive Regulation of Cyclin-Dependent Protein Kinase Complex” [1]. A series of very similar articles on shRNA and cancer cell lines was identified by Byrne and Labbé [2], and the intertextual distance between this article and an article in the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé.(ii)The article is very similar in methods and structure to two other studies that also use this incorrect sequence [4, 5].The authors did not respond to requests for comment.

References

  1. X. Huang, W. Zhou, Y. Zhang, and Y. Liu, “High expression of ptgr1 promotes NSCLC cell growth via positive regulation of cyclin-dependent protein kinase complex,” BioMed Research International, vol. 2016, Article ID 5230642, 2016. View at: Publisher Site | Google Scholar
  2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017. View at: Publisher Site | Google Scholar
  3. Y. Wang, T. Jin, X. Dai, and J. Xu, “Lentivirus-mediated knockdown of CEP55 suppresses cell proliferation of breast cancer cells,” BioScience Trends, vol. 10, no. 1, pp. 67–73, 2016. View at: Publisher Site | Google Scholar
  4. X. Zhao, M. Chen, and J. Tan, “Knockdown of ZFR suppresses cell proliferation and invasion of human pancreatic cancer,” Biological Research, vol. 49, no. 1, 2016. View at: Publisher Site | Google Scholar
  5. C. Zhang, J. Fu, F. Xue et al., “Knockdown of ribosomal protein S15A induces human glioblastoma cell apoptosis,” World Journal of Surgical Oncology, vol. 14, no. 1, article no. 129, 2016. View at: Publisher Site | Google Scholar

Copyright © 2017 BioMed Research International. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views1556
Downloads487
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.