BioMed Research International

BioMed Research International / 2018 / Article

Research Article | Open Access

Volume 2018 |Article ID 4601737 | 7 pages | https://doi.org/10.1155/2018/4601737

Occurrence and Multilocus Genotyping of Giardia duodenalis in Yunnan Black Goats in China

Academic Editor: Roberto Amerigo Papini
Received06 Aug 2018
Revised15 Sep 2018
Accepted26 Sep 2018
Published10 Oct 2018

Abstract

Giardia duodenalis is an important zoonotic parasite which can parasitize in the intestines of humans and various animals. However, the information about the prevalence and genetic diversity of G. duodenalis in goats in China is limited. It is yet to be known whether Yunnan black goats, a unique goat breed in subtropical Yunnan province, southwestern China, are infected with G. duodenalis. Thus, a total of 907 fecal samples were collected from Yunnan black goats in five regions in Yunnan province, to estimate the prevalence and genotypes of G. duodenalis using a PCR-based approach. The G. duodenalis prevalence is 4.2% (38/907) in Yunnan black goats by nested amplification of the β-giardin (bg) gene, and the genotypes are identified as assemblage E, with 5 novel subtypes (E11-E15). Multilocus sequence typing revealed that 11, 18, and 38 samples were amplifiable on tpi (triose phosphate isomerase), gdh (glutamate dehydrogenase), and bg locus, respectively, and identified three novel multilocus genotypes (MLGs): MLGE9-MLGE11. To our knowledge, this is the first report of G. duodenalis prevalence and genotypes in Yunnan black goats in China, which extended the host range of G. duodenalis and provided basic data for controlling G. duodenalis infection in Yunnan black goats.

1. Introduction

Giardia duodenalis (syn. Giardia lamblia and Giardia intestinalis) is a common enteric protozoan parasite which can infect humans and a wide range of animal species. G. duodenalis infection can cause a series of diseases which have important effects on human and animal health, such as abdominal cramps, diarrhea, weight loss, and malabsorption [13]. G. duodenalis infection can be caused by ingesting cysts in contaminated water or food, or through fecal-oral access due to wastewater [46]. According to the existing literature, the prevalence of G. duodenalis is approximately 10% in the world population [7], and the G. duodenalis prevalence ranged from 0 to 15.6% in humans [8, 9] and 1.3%-55.6% in sheep and goats in China [1]. G. duodenalis has a high prevalence in some low-income areas and developing countries [1013].

So far, G. duodenalis isolates from humans and various animals have been classified into eight different assemblages (A-H) on the basis of molecular characterization [14, 15]. Among them, assemblages A and B are the important zoonotic parasites that have a wild range of hosts, including human and other mammals, such as bovine, sheep, goats, and other domestic animals [1, 3]. Assemblage E occurs in artiodactyls, and assemblages C, D, F, G, and H have obvious animal specificity, but assemblages C-F have also been reported in humans in Ethiopia [16], Thailand [17], and Egypt [18].

Yunnan province is the fifth largest producer of goats in China [19], and about 10 million goats are raised each year. Many previous studies have reported G. duodenalis infection in goats in other countries with prevalence ranging from 2.9 to 35.8% [20, 21], but only limited investigations have been conducted in goats in China, with the prevalence ranging from 2.9 to 7.1% [2225].

Yunnan black goat is a unique breed of goat distributed in subtropical Yunnan province, southwestern China. It is yet to be known whether Yunnan black goats are infected with G. duodenalis. Thus, the objectives of the present study were to estimate the G. duodenalis prevalence in Yunnan black goats based on characterization of the β-giardin (bg) gene sequences and identify its genotypes using multilocus genotyping (MLG) targeting gdh gene, tpi gene, and bg gene sequences [15, 26].

2. Materials and Methods

2.1. Animals and Samples Collection

A total of 907 fecal samples were randomly collected from Yunnan black goats in Chuxiong, Lijiang, and Xishuangbanna prefectures, Yunnan province, southwestern China (Figure 1). All of the fecal samples were stored in separate sterile plastic collection tubes containing 2.5% potassium dichromate, kept cold with ice packs, transported to the laboratory as soon as possible, and kept in 4°C freezer until analysis. The sample information including geographical gender, age, locality, and date of sampling was recorded.

2.2. Genomic DNA Extraction

Fecal specimens were washed repeatedly with ultrapure water until all the potassium dichromate was removed, and then genomic DNA was extracted from 200 mg of each fecal sample in a 2 ml centrifuge tube using the commercial E.Z.N.A® Stool DNA kit (Omega Bio-Tek Inc., GA, USA) by following the manufacturer’s instruction. The obtained DNA samples were stored at −20°C for further study.

2.3. PCR Amplification and Sequencing

Each fecal specimen was examined for the presence and genotype of G. duodenalis by PCR-based sequencing of the 511 bp fragment of the bg-gene [27]. In addition, For MLG analysis, all bg-positive specimens were subjected to further PCR using primers for the tpi gene loci and gdh gene loci [2830]. The sequences of primers are presented in Table 1.


GenePrimerSequences (5′-3′)Annealing temperature (°C)Reference

bgGF1AAGCCCGACGACCTCACCCGCAGTGC55[1]
GR1GAGGCCGCCCTGGATCTTCGAGACGAC
GF2GAACGAACGAGATCGAGGTCCG55
GR2CTCGACGAGCTTCGTGTT
gdhGdh1TTCCGTRTYCAGTACAACTC50[1]
Gdh2ACCTCGTTCTGRGTGGCGCA
Gdh3ATGACYGAGCTYCAGAGGCACGT65
Gdh4GTGGCGCARGGCATGATGCA
tpiAL3543AAATIATGCCTGCTCGTCG50[1, 3]
AL3546CAA ACCTTITCCGCAAACC
ALEfCCCCTTCTGCCGTACATTTAT58
ALErGGCTCGTAAGCAATAACGACTT

The secondary reaction mixture contained 2 μl of template from the first PCR product, 2 μL deoxyribonucleotide triphosphate (dNTP) mixture, 2.5 μL of 10×PCR buffer, 3 mM of MgCl2, and 0.2 μM of each primer in a total volume of 25 μL. PCR amplifications were performed as follows: 1 cycle for 5 min at 94°C, followed by 35 cycles of 45 s at 94°C for denaturation, 45 s at 67°C for annealing, and 45 s at 72°C for an extension. All of amplification products were subsequently visualized on 1.5% agarose gels with ethidium bromide. For each PCR amplification, a positive sample (sequenced DNA) and negative (PCR water) control sample were included.

All nested-PCR products were sent to Xi’an Qingk Biotechnology Company for two-directional sequencing on an ABI PRISM 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA) using relevant internal nested primers for PCR amplification. The sequences obtained were compared with relevant sequences available in GenBank database (http://www.ncbi.nlm.nih.gov/GenBank) using Basic Local Alignment Search Tool (BLAST).

2.4. Phylogenetic Analysis

The tpi gene sequences were used for phylogenetic reconstruction using the Neighbor-Joining [NJ] analysis and the genetic distances were calculated by the Kimura 2-parameter model in MEGA6 [31, 32]. Bootstrap analysis (1000 replicates) was used to evaluate the reliability of the phylogenetic tree [33].

2.5. Statistical Analysis

The relationships between G. duodenalis prevalence and risk factors were analyzed using the x2 test in SPSS 20.0 (SPSS Inc., Chicago, IL, USA), and statistically significant differences were considered when P <0.05.

3. Results and Discussion

3.1. The Prevalence of G. duodenalis in Yunnan Black Goats

A total of 907 fecal samples were collected from Yunnan black goats in five regions in Yunnan province (Figure 1), and 38 (4.2%, 95% CI, 2.9-5.5) were G. duodenalis-positive based on the amplification of the bg gene. G. duodenalis prevalence was significantly different among the study areas (χ2=10.933, df=4, P < 0.05), between different age groups (χ2=5.208, df=1, P < 0.05), and between different genders (χ2=1.615, df=1, P > 0.05). The G. duodenalis prevalence in Yunnan black goats was higher than that (2.9%) in goats in Heilongjiang province [22], but lower than that in goats in Anhui (6.3%) [23], Shaanxi (7.9%) [25], and Henan provinces (12.7%) [24], China. The G. duodenalis prevalence in Yunnan black goats was markedly lower than in goats in Greece (40.4%) [34], Spain (42.0%) [20], Uganda (40.7%) [35], and Belgium (35.8%) [21]. The difference in G. duodenalis prevalence may be related to feeding conditions, geographical difference, and animal husbandry practices as well as different susceptibility of different breeds of goats.

G. duodenalis prevalence ranged from 0% to 7.03% among the sampled areas. The highest G. duodenalis prevalence was found in Yunnan black goats in Mohan (7.03%, 9/128), Xishuangbanna prefecture (Table 2), followed by Wuding (5.41%, 24/444) in Chuxiong prefecture, Ninglang (1.96%, 1/51) in Lijiang prefecture, and Yongreng (1.43%, 2/139) and Mouding (1.38%, 2/145) in Chuxiong prefecture. The likely reason for this discrepancy may be due to different geographical conditions.


FactorCategoryNo. testedNo. positive (%)
95% CI
OR [95 % CI]P-value

AreaWuding44424 (5.4, 3.3-7.5)4.086 (0.95-17.50)0.04
Yongreng1392 (1.4, 0.6-3.3)1.044 (0.15-7.51)0.97
Mouding1452 (1.4, 0.5-3.3)RefRef
Ninglang511 (2.0, 1.8-5.8)1.430 (0.13-16.11)0.77
Mohan1289 (7.0, 2.6-11.5)5.408 (1.15-25.51)0.02
GenderFemale63323 (3.6, 2.1-5.1)0.651 (0.33-1.27)0.20
Male27415 (5.5, 2.8-8.2)
Age
(month)
≤1236422 (6.1, 3.6-8.6)2.119 (1.10-4.09)0.02
>1254316 (2.9, 1.2-4.6)
Total90738 (4.2, 2.9-5.5)

3.2. Molecular Characterization of G. duodenalis Isolates

All the bg sequences obtained in the present study were aligned with corresponding G. duodenalis sequences available in GenBank by BLAST. A total of 38 positive samples were clustered in assemblage E, containing one known assemblage E subtype (E5, n=35) and two novel assemblage E subtypes (designated as E14, n=1; E15, n=2) based on sequence analyses of the bg gene loci (Table 3). Additionally, one known assemblage E subtype (E10, n=2) and one novel assemblage E subtype (E13, n=16) based on the gdh gene sequences and two novel assemblage E subtypes (E11, n=1; E12, n=10) based on the tpi gene sequences were also identified among G. duodenalis-positive samples from Yunnan black goats (Table 3).


Subtypes (number) Nucleotide position and substitutionsGenBank ID

tpi
188248
Ref. sequenceGAMF095054
E11 (1)CTMH621338
E12 (10)GAMH621340
gdh
391608623
Ref. sequenceCAAKX813711
E10 (2)TGG
E13 (16)CGGMH621339
bg
62667882365
Ref. sequenceCAATCKY769092
E5 (35)CAATC
E14 (1)A-GGCMH621337
E15 (2)CAATTMH621341

Previous studies have indicated that assemblage E is the predominant genotype infecting a range of hoofed livestock; it is also the most common assemblage found in sheep, goats, and pigs. However, assemblage E has also been identified in cattle, dogs, cats, horses, fallow deer, monkeys, and humans [1, 3, 29, 36] indicating that assemblage E is of zoonotic significance.

MLG analysis based on bg, gdh, and tpi gene sequences is a useful tool to illustrate the diversity of the G. duodenalis genotypes [37]. In this study, 18 of the 38 bg-positive samples were gdh-positive, and 11 were tpi-positive. Ten samples were successfully sequenced at all of the three loci, and three novel MLGs (designated as MLGE9-E11) were identified within assemblage E (Table 4).


subtypeNo. of sequencesMLG type

tpigdhbg
E12E13E151MLGE9
E12E138MLGE10
E11E131MLGE11
-E13E151
-2
-E135
E12-1
--E141
--18

Note: a, b indicate that genotypes have been reported.
-: not determined.
3.3. Phylogenetic Analysis of G. duodenalis Isolates from Yunnan Black Goats

To clarify the genetic relationships of the G. duodenalis isolates in this study with relevant G. duodenalis isolates, the obtained G. duodenalis tpi gene sequences were aligned with corresponding sequences available in the GenBank database. The phylogenetic tree showed that G. duodenalis isolates from Yunnan black goats clustered within assemblage E which contained G. duodenalis isolates (E11 and E12) from other animals and humans (Figure 2), with a high bootstrap value, indicating that G. duodenalis genotypes in Yunnan black goats have zoonotic potential, raising a public health concern.

4. Conclusion

This is the first report of prevalence and molecular characterization of G. duodenalis from Yunnan black goats in Yunnan province, southwestern China, which revealed a 4.2% G. duodenalis prevalence and identified seven subtypes including five novel assemblages E subtypes (E11-E15) and two known assemblages E subtypes (E5 and E10). MLGs analysis identified three novel MLGs within assemblage E of G. duodenalis. These results not only extended the host range of G. duodenalis distribution, but also enriched the genetic diversity of G. duodenalis in humans and animals, which also have implications for controlling G. duodenalis infection in Yunnan black goats.

Data Availability

The Giardia duodenalis prevalence data used to support the findings of this study are included within the article.

Ethical Approval

All Yunnan black goats were handled in strict accordance with good animal practice according to the Animal Ethics Procedures and Guidelines of the People’s Republic of China, and the study was approved by the Animal Administration and Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

Project support was provided by the Excellent Scientist Fund of Yunnan Agricultural University (2015JY03), the Agricultural Science and Technology Innovation Program (ASTIP) (Grant No. CAAS-ASTIP-2016-LVRI-03), and the Elite Program of Chinese Academy of Agricultural Sciences.

References

  1. Y. Feng and L. Xiao, “Zoonotic potential and molecular epidemiology of Giardia species and giardiasis,” Clinical Microbiology Reviews, vol. 24, no. 1, pp. 110–140, 2011. View at: Publisher Site | Google Scholar
  2. W. Li, C. Liu, Y. Yu et al., “Molecular characterization of Giardia duodenalis isolates from police and farm dogs in China,” Experimental Parasitology emphasizes, vol. 135, no. 2, pp. 223–226, 2013. View at: Publisher Site | Google Scholar
  3. U. Ryan and S. M. Cacciò, “Zoonotic potential of Giardia,” International Journal for Parasitology, vol. 43, no. 12-13, pp. 943–956, 2013. View at: Publisher Site | Google Scholar
  4. C. Kourenti, P. Karanis, and H. Smith, “Waterborne transmission of protozoan parasites: a worldwide review of outbreaks and lessons learnt,” Journal of Water and Health, vol. 5, no. 1, pp. 1–38, 2007. View at: Publisher Site | Google Scholar
  5. J. Plutzer, J. Ongerth, and P. Karanis, “Giardia taxonomy, phylogeny and epidemiology: Facts and open questions,” International Journal of Hygiene and Environmental Health, vol. 213, no. 5, pp. 321–333, 2010. View at: Publisher Site | Google Scholar
  6. A. Efstratiou, J. E. Ongerth, and P. Karanis, “Waterborne transmission of protozoan parasites: Review of worldwide outbreaks - An update 2011–2016,” Water Research, vol. 114, pp. 14–22, 2017. View at: Publisher Site | Google Scholar
  7. D. B. Huang and A. C. White, “An Updated Review on Cryptosporidium and Giardia,” Gastroenterology Clinics of North America, vol. 35, no. 2, pp. 291–314, 2006. View at: Publisher Site | Google Scholar
  8. H. Liu, Y. Shen, J. Yin et al., “Prevalence and genetic characterization of Cryptosporidium, Enterocytozoon, Giardia and Cyclospora in diarrheal outpatients in china,” BMC Infectious Diseases, vol. 14, no. 1, 2014. View at: Google Scholar
  9. S. Zhang, Y. Zhou, W. Xu et al., “Impact of co-infections with enteric pathogens on children suffering from acute diarrhea in southwest China,” Infectious Diseases of Poverty, vol. 5, no. 1, 2016. View at: Publisher Site | Google Scholar
  10. J. H. Botero-Garcés, G. M. García-Montoya, D. Grisales-Patiño, D. C. Aguirre-Acevedo, and M. C. Álvarez-Uribe, “Giardia intestinalis and nutritional status in children participating in the complementary nutrition program, Antioquia, Colombia, May to October 2006,” Revista do Instituto de Medicina Tropical de São Paulo, vol. 51, no. 3, pp. 155–162, 2009. View at: Publisher Site | Google Scholar
  11. J. S. Yoder, J. W. Gargano, R. M. Wallace, M. J. Beach et al., “Giardiasis surveillance--United States, 2009-2010,” Morbidity and mortality weekly report. Surveillance Summaries, vol. 61, no. 5, pp. 13–23, 2012. View at: Google Scholar
  12. K. A. Ul Haq, N. A. Gul, H. Muhammad Hammad, Y. Bibi, A. Bibi, and J. Mohsan, “Prevalence of giardia intestinalis and hymenolepis nana in afghan refugee population of mianwali district, pakistan,” African Health Sciences, vol. 15, no. 2, pp. 394–400, 2015. View at: Publisher Site | Google Scholar
  13. J. E. Painter, J. W. Gargano, S. A. Collier, and J. S. Yoder, “Giardiasis surveillance - United States, 2011-2012,” Mmwr Supplements, vol. 64, no. 3, pp. 15–25, 2015. View at: Google Scholar
  14. M. F. Heyworth, “Giardia duodenalis genetic assemblages and hosts,” Parasite, vol. 23, article no. 23, 2016. View at: Publisher Site | Google Scholar
  15. J. Li, H. Wang, R. Wang, and L. Zhang, “Giardia duodenalis infections in humans and other animals in China,” Frontiers in Microbiology, vol. 8, 2017. View at: Google Scholar
  16. T. Gelanew, M. Lalle, A. Hailu, E. Pozio, and S. M. Cacciò, “Molecular characterization of human isolates of Giardia duodenalis from Ethiopia,” Acta Tropica, vol. 102, no. 2, pp. 92–99, 2007. View at: Publisher Site | Google Scholar
  17. R. J. Traub, T. Inpankaew, S. A. Reid et al., “Transmission cycles of Giardia duodenalis in dogs and humans in Temple communities in Bangkok-A critical evaluation of its prevalence using three diagnostic tests in the field in the absence of a gold standard,” Acta Tropica, vol. 111, no. 2, pp. 125–132, 2009. View at: Publisher Site | Google Scholar
  18. P. Foronda, M. D. Bargues, N. Abreu-Acosta et al., “Identification of genotypes of Giardia intestinalis of human isolates in Egypt,” Parasitology Research, vol. 103, no. 5, pp. 1177–1181, 2008. View at: Publisher Site | Google Scholar
  19. National Bureau of Statistics of China, http://www.stats.gov.cn/english/Statisticaldata/AnnualData.
  20. A. Ruiz, P. Foronda, J. F. González et al., “Occurrence and genotype characterization of Giardia duodenalis in goat kids from the Canary Islands, Spain,” Veterinary Parasitology, vol. 154, no. 1-2, pp. 137–141, 2008. View at: Publisher Site | Google Scholar
  21. T. Geurden, P. Thomas, S. Casaert, J. Vercruysse, and E. Claerebout, “Prevalence and molecular characterisation of Cryptosporidium and Giardia in lambs and goat kids in Belgium,” Veterinary Parasitology, vol. 155, no. 1-2, pp. 142–145, 2008. View at: Publisher Site | Google Scholar
  22. W. Zhang, X. Zhang, R. Wang et al., “Genetic characterizations of Giardia duodenalis in sheep and goats in Heilongjiang Province, China and possibility of zoonotic transmission,” PLOS Neglected Tropical Diseases, vol. 6, no. 9, Article ID e1826, 2012. View at: Publisher Site | Google Scholar
  23. Y. F. Gu, L. K. Wang, Y. Li, L. Li et al., “Prevalence and molecular characterization of Giardia lamblia isolates from goats,” Chinese Journal of Parasitology and Parasitic Diseases, vol. 32, no. 5, pp. 401–403, 2014. View at: Google Scholar
  24. X.-Q. Peng, G.-R. Tian, G.-J. Ren et al., “Infection rate of Giardia duodenalis, Cryptosporidium spp. and Enterocytozoon bieneusi in cashmere, dairy and meat goats in China,” Infection, Genetics and Evolution, vol. 41, pp. 26–31, 2016. View at: Publisher Site | Google Scholar
  25. Y.-L. Yin, H.-J. Zhang, Y.-J. Yuan et al., “Prevalence and multi-locus genotyping of Giardia duodenalis from goats in Shaanxi province, northwestern China,” Acta Tropica, vol. 182, pp. 202–206, 2018. View at: Publisher Site | Google Scholar
  26. C. Wielinga, U. Ryan, R. C. Andrew Thompson, and P. Monis, “Multi-locus analysis of Giardia duodenalis intra-Assemblage B substitution patterns in cloned culture isolates suggests sub-Assemblage B analyses will require multi-locus genotyping with conserved and variable genes,” International Journal for Parasitology, vol. 41, no. 5, pp. 495–503, 2011. View at: Publisher Site | Google Scholar
  27. I. M. Sulaiman, R. Fayer, C. Bern et al., “Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis,” Emerging Infectious Diseases, vol. 9, no. 11, pp. 1444–1452, 2003. View at: Publisher Site | Google Scholar
  28. C. M. Read, P. T. Monis, and R. C. A. Thompson, “Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP,” Infection, Genetics and Evolution, vol. 4, no. 2, pp. 125–130, 2004. View at: Publisher Site | Google Scholar
  29. S. M. Caccio and U. Ryan, “Molecular epidemiology of giardiasis,” Molecular Biochemical Parasitology, vol. 160, no. 2, pp. 75–80, 2008. View at: Publisher Site | Google Scholar
  30. T. Geurden, P. Geldhof, B. Levecke et al., “Mixed Giardia duodenalis assemblage A and E infections in calves,” International Journal for Parasitology, vol. 38, no. 2, pp. 259–264, 2008. View at: Publisher Site | Google Scholar
  31. K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, “MEGA6: Molecular Evolutionary Genetics Analysis version 6.0,” Molecular Biology and Evolution, vol. 30, no. 12, pp. 2725–2729, 2013. View at: Publisher Site | Google Scholar
  32. M. Fantinatti, A. R. Bello, O. Fernandes, and A. M. Da-Cruz, “Identification of Giardia lamblia Assemblage E in humans points to a new anthropozoonotic cycle,” The Journal of Infectious Diseases, vol. 214, no. 8, pp. 1256–1259, 2016. View at: Publisher Site | Google Scholar
  33. N. Saitou and M. Nei, “The neighbor-joining method: a new method for reconstructing phylogenetic trees,” Molecular Biology and Evolution, vol. 4, no. 4, pp. 406–425, 1987. View at: Google Scholar
  34. N. Tzanidakis, S. Sotiraki, E. Claerebout et al., “Occurrence and molecular characterization of Giardia duodenalis and Cryptosporidium spp. in sheep and goats reared under dairy husbandry systems in Greece,” Parasite, vol. 21, article 45, 2014. View at: Publisher Site | Google Scholar
  35. A. R. Johnston, T. R. Gillespie, I. B. Rwego, T. L. T. McLachlan, A. D. Kent, and T. L. Goldberg, “Molecular epidemiology of cross-species Giardia duodenalis transmission in Western Uganda,” PLOS Neglected Tropical Diseases, vol. 4, no. 5, Article ID e683, 2010. View at: Google Scholar
  36. M. Santin, D. Dargatz, and R. Fayer, “Prevalence of Giardia duodenalis assemblages in weaned cattle on cow-calf operations in the United States,” Veterinary Parasitology, vol. 183, no. 3-4, pp. 231–236, 2012. View at: Publisher Site | Google Scholar
  37. S. M. Cacciò, R. Beck, M. Lalle, A. Marinculic, and E. Pozio, “Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B,” International Journal for Parasitology, vol. 38, no. 13, pp. 1523–1531, 2008. View at: Publisher Site | Google Scholar

Copyright © 2018 Shi-Chen Xie et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

1184 Views | 318 Downloads | 3 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.