Abstract
Evidences for an involvement of the bacterial type IV secretion system (T4SS) in the symbiotic relationship between rhizobia and legumes have been pointed out by several recent studies. However, information regarding this secretion system in Mesorhizobium is still very scarce. The aim of the present study was to investigate the phylogeny and expression of the traG gene, which encodes a substrate receptor of the T4SS. In addition, the occurrence and genomic context of this and other T4SS genes, namely, genes from tra/trb and virB/virD4 complexes, were also analyzed in order to unveil the structural and functional organization of T4SS in mesorhizobia. The location of the T4SS genes in the symbiotic region of the analyzed rhizobial genomes, along with the traG phylogeny, suggests that T4SS genes could be horizontally transferred together with the symbiosis genes. Regarding the T4SS structural organization in Mesorhizobium, the virB/virD4 genes were absent in all chickpea (Cicer arietinum L.) microsymbionts and in the Lotus symbiont Mesorhizobium japonicum MAFF30309. Interestingly, the presence of genes belonging to another secretion system (T3SS) was restricted to these strains lacking the virB/virD4 genes. The traG gene expression was detected in M. mediterraneum Ca3 and M. ciceri LMS-1 strains when exposed to chickpea root exudates and also in the early nodules formed by M. mediterraneum Ca3, but not in older nodules. This study contributes to a better understanding of the importance of T4SS in mutualistic symbiotic bacteria.
1. Introduction
Rhizobia are able to fix atmospheric nitrogen when in symbiosis with legumes, providing ammonia to these plants. The rhizobial symbiosis genes include two main classes of genes, namely, nodulation and nitrogen fixation genes [1]. Nodulation genes (e.g., nodABC) are implicated in biosynthesis and secretion of Nod factors, molecules involved in root infection, and nodule development. Nitrogen fixation genes include genes involved in the synthesis, processing, and assembly of nitrogenase complex (e.g., nifHDK, fixGH), responsible for N2-fixation [2–4]. The expression of these sets of genes is regulated by two key transcriptional regulators, namely, NodD for nodulation genes and NifA for nitrogen fixation genes [3, 5]. Nevertheless, the involvement of other bacterial genes in legume-rhizobia symbioses has been described. Some studies have shown that genes commonly found among prokaryotes and involved in a diversity of cellular mechanisms have also a role in legume-Rhizobium symbiosis, as, for example, stress response genes [6–8], quorum sensing, or secretion system genes [9–12].
Although several studies have shown the involvement of the rhizobial secretion systems in the symbiotic rhizobia-legume relationship [11–13], their precise role is far from being fully understood. Such transfer systems are ancestrally related to virulence (transmission of antibiotic resistance genes and virulence genes) and to the mating pair formation complexes in pathogenic bacteria [14]. However, with the increasing number of available rhizobia genomes, the occurrence of these systems has also been described in symbiotic bacteria [12]. These systems allow DNA uptake or release, i.e., the translocation of genetic material between bacterial strains or between bacteria and eukaryotic cells [15, 16]. In addition, types III (T3SS), IV (T4SS), and VI (T6SS) systems have the ability to directly translocate bacterial proteins into the cells of eukaryotic susceptible hosts [17, 18]. Therefore, several studies suggest a role for this translocated bacterial material in the primary interplay between bacteria and their hosts for the establishment of a mutualistic symbiosis [10, 13].
In rhizobia, the studies regarding the T4SS are restricted to Mesorhizobium japonicum [19, 20], Rhizobium etli [16], Ensifer meliloti, and Ensifer medicae [12, 21]. However, it is considered that, in general, the rhizobial T4SS protein apparatus is similar to the bacterial pathogen Agrobacterium tumefaciens. In the A. tumefaciens strain C58 three types of T4SS genes were described: vir, avh, and trb [21]. The Tra/Trb and VirB/VirD4 protein complexes are the most studied. The first one is responsible for the conjugative transfer of the Ti plasmid between bacteria and the second one for the delivery T-DNA and effectors proteins to plant cells [22]. In these complexes, the TraG and VirD4 proteins (coupling proteins) have a role as substrate receptors, corresponding to the first T4SS components that contact the substrate (effector proteins or DNA), recruiting specific substrates to the translocation channel [17, 18, 22, 23]. On the other hand, the Trb and VirB proteins are involved in the assembly of the translocation channels [22].
One of the evidences that points out the symbiotic importance of T4SS is the genomic location of the T4SS genes. In M. japonicum R7A strain, the genes coding for the Tra/Trb and VirB/VirD4 complexes were found to be located in the symbiosis island [20]. Besides that, the expression of T4SS virB/virD4 genes seems to be regulated by NodD, which is the main regulator of nod genes expression [19, 21]. Therefore, the T4SS virB/virD4 genes expression could be temporally coordinated with Nod Factors production, suggesting a function of T4SS VirB/VirD4 proteins in the early steps of the legume-rhizobia symbioses [9, 11, 20]. Nevertheless, this finding of coordinated expression between T4SS and nod genes [20] did not include the analysis of genes coding for the T4SS Tra/Trb complex. Up to now, it is unknown if any relation exists between the expression of tra/trb genes and some crucial step for the establishment of symbiotic rhizobia-legume relationship.
In addition to the findings mentioned above, an interesting aspect observed in some Lotus symbionts is that strains harboring the T4SS virB/virD4 genes do not present T3SS genes and vice versa [19]. This suggests that the symbiotic role of T4SS could be analogous to the symbiotic role of T3SS, even more because in some rhizobia the expression of T3SS genes is also regulated by NodD, and this secretion system is located in the symbiotic island [9].
The present study aimed to contribute to our understanding of the structural and functional organization of T4SS in mesorhizobia, using mesorhizobia strains able to nodulate chickpea (Cicer arietinum L.) as a study case. The phylogeny and expression of the T4SS traG gene, which belongs to the T4SS tra/trb complex, were investigated. Moreover, the occurrence and genomic context of this and other T4SS genes from the tra/trb and virB/virD4 complexes were also analyzed in several mesorhizobia strains. Interestingly, the T4SS tra/trb complex is present in all the studied Mesorhizobium strains, contrarily to the T4SS virB/virD4 complex, which was not detected in the Cicer arietinum mesorhizobia analyzed.
2. Materials and Methods
2.1. Bacterial Strains, Growth Conditions, and DNA Extraction
The bacterial strains used in this work are listed in Table 1. From the 35 rhizobia strains analysed, 21 are Cicer arietinum symbionts and, from these, 16 are native isolates obtained from a collection of Portuguese Cicer arietinum mesorhizobia previously characterized [25–27]. The remaining 14 rhizobia strains are able to nodulate a diverse range of plant hosts (Table 1).
The total DNA of 18 Cicer arietinum mesorhizobia strains grown in TY medium during 16 hours at 28°C was extracted using the E.Z.N.A. bacterial DNA kit (Omega Bio-Tek), according to the manufacturer’s instructions.
2.2. Amplification of traG, nod, and nifA Genes
The traG gene was amplified using the primers traGF 5′-ATGCTGACCTACCAGACGCC-3′ and traGRint 5′-CGGAAACTCGTCCAGCATCA-3′, designed to target conserved regions of this gene in Mesorhizobium, which allow the amplification of an internal region of ~ 1155 bp. The nodD and nifA genes were amplified using primers NodDF 5′-ATGCGTTTCAAAGGACTTG-3′, NodDR 5′-TCACAGCGGGGCAGCCATCC-3′, NifAF 5′-ATGGGCTGCCAAATGGAACG-3′, and NifAR 5′-TCAGAGACGCTTGATCTCGA-3′. These primers allow the amplification of nearly complete sequences of these two genes (918 bp for nodD and 1059 bp for nifA,). The PCR reactions were performed in a final volume of 50 μL, using 20 ng of total DNA, 1× reaction buffer, 0.2 mM of each dNTP, 1.5mM of MgSO4 (traG and nifA) or 1 mM of MgSO4 (nodD), 15 pmol of each primer, and 0.02 U/μL of KOD Hot Start DNA polymerase (Merck Millipore). The amplification programs were 2 min of initial denaturation at 95°C and 30 cycles of 20 s at 95°C, followed by 10 s of annealing at 58°C (traG and nodD) or 62°C (nifA) and an extension step of 15 s (nodD), 17 s (nifA), or 23 s (traG) at 70°C. PCR products were purified using the GFX DNA purification kit (GE Healthcare) or MinElute Gel Extraction kit (QIAGEN) following the manufacturer’s instructions. Sequencing reactions were performed by Macrogen Europe (Amsterdam, Netherlands).
The sequences of nodD, nifA, and traG genes from the Cicer arietinum mesorhizobia strains have been deposited in the GenBank database under the accession numbers KT966793 to KT966810, KT966811 to KT966828 and KT966829 to KT966846, respectively (Table 1).
2.3. Phylogenetic Analysis
The nodD, nifA, traG, and 16S rRNA nucleotide sequences from several rhizobia strains able to nodulate different plant hosts (Anthyllis vulneraria, Biserrula pelecinus, Bituminaria bituminosa, Cicer arietinum, Glycine max, Lotononis carinata, Lotus spp., and Medicago sativa) were either obtained in this study or retrieved from NCBI or JGI IMG database [24, 28] (Table 1). Sequences were analyzed and aligned using BIOEDIT (version 7.0.4.1) [29]. Molecular phylogenies for nodD, nifA, traG, and 16S rRNA nucleotide sequences were generated with MEGA6 version 6.0.6 [30], using the Maximum Likelihood method, with the distance correction calculated by Tamura 3-parameter model, with rate among sites gamma distributed for nodD phylogeny and rate among sites gamma distributed with invariant sites for nifA, traG, and 16S rRNA gene phylogenies. The phylogenetic trees were rooted using the Bradyrhizobium elkanii and E. meliloti species as outgroup. Robustness of tree nodes was evaluated using bootstrap analyses, with 1000 replicates.
2.4. Analysis of the Genomic Regions Containing the T4SS Genes, Symbiosis Genes, and T3SS Genes
The occurrence and genome context of T4SS genes, symbiosis genes, and two T3SS genes were analyzed in the genomes of Cicer arietinum symbionts (Mesorhizobium mediterraneum UPM-Ca3, M. muleiense CGMCC 1.1102, M. ciceri LMS-1, M. ciceri CMG6, and M. ciceri CC1192), Biserrula pelecinus symbionts (M. ciceri bv. biserrulae WSM1271, M. australicum WSM207, and M. opportunistum WSM207), and Lotus spp. symbionts (M. loti NZP2037, M. japonicum R7A, and M. japonicum MAFF30309) (former M. loti strains, reclassification according to [31]) using local BLAST tool from BIOEDIT (version 7.0.4.1) [29]. All these genomes are available in JGI IMG or NCBI genome database. The M. ciceri LMS-1 genome sequencing data were obtained in our lab (Bioproject accession PRJNA507072) and the contigs used in this work were submitted to NCBI (accession numbers MK226192 to MK226197).
In total, the localization of 38 genes was analyzed, namely, nod genes (nodA, nodB, nodC, and nodD), nif genes (nifA, nifH, nifD, nifK, nifE, and nifN), fix genes (fixG, fixH), vir genes (virA, virG, virB1, virB2, virB3, virB4, virB5, virB6, virB7, virB8, virB9, virB10, virB11, and virD4), tra/trb genes (traG, trbB, trbC, trbD, trbE, trbJ, trbL, trbF, trbG, and trbI), and the T3SS genes rhcJ and rhcN (named as in [32]). This analysis was based on the comparison of these mesorhizobial genomes with the well-characterized symbiosis island of M. japonicum R7A, in which the T4SS genes are located [33].
2.5. Analysis of traG and nodA Genes Expression in M. ciceri LMS-1 and M. mediterraneum UPM-Ca36T
To evaluate the traG and nodA genes expression in the Cicer arietinum-nodulating M. mediterraneum UPM-Ca3 and M. ciceri LMS-1, the total RNA from those strains was extracted from free-living cell cultures with and without exposure to Cicer arietinum root exudates and also from the bacteroids at two different time points.
The root exudates were obtained as described by [34], with slight modifications, namely using minimal medium described by [35]. For expression analysis in free-living conditions, with and without root exudates, cell cultures were grown in five mL of liquid TY medium at 28°C until exponential-phase. After centrifugation at 8000 g during five minutes, cells were resuspended in five mL of root exudates and incubated for 24 hours at 28°C. Five mL of minimal medium [35] was used to resuspend cells not exposed to root exudates and these were incubated under the same conditions as previously mentioned.
For expression analysis in bacteroids, Cicer arietinum plants were grown and inoculated as described by [36], being then used to collect root nodules at 15 and 25 days after rhizobial inoculation (dpi). The nodules were treated for posterior RNA extraction as described by [37]. Total RNA of free-living bacteria and bacteroids was extracted using the GeneJET™ RNA Purification Kit (ThermoFisher Scientific). DNA contamination was removed by digestion with DNase I (Roche Diagnostics), followed by RNA cleanup using the same RNA Purification Kit mentioned before. Approximately, 1 μg of total RNA was subjected to reverse transcription for cDNA synthesis, using the RevertAid First Strand cDNA Synthesis kit (ThermoFisher Scientific).
The traG and nodA genes expression was analyzed by semiquantitative RT-PCR analyses as described in [38]. The cDNA previously obtained was used for PCR amplification of partial sequences of the traG and nodA genes (primers traGIntF 5′- GGCCAATCTACAAGCCGTGG -3′ and traGIntR3 5′- GCCCACCGTGAAGACCCATA -3′ for traG; primers NodAIntF 5′- ccgaatgtcgagtggaagtt -3′ and NodAIntR3 5′- ctcgccaactttgatgaagc -3′ for nodA), which generates a fragment of 193 and 234 bp, respectively. These PCR reactions were performed in a final volume of 50 μL, using 2 μL of cDNA (~40 ng), 1× reaction Green GoTaq® Flexi buffer, 0.2 mM of each dNTP, 1.5 mM MgCl2, 15 pmol of each primer and 0.025U/μL of GoTaq® G2 Flexi DNA Polymerase (Promega, Fitchburg, U.S.A). The amplification program was 2 min of initial denaturation at 95°C, 30 cycles of 60 s at 95°C, 60 s at 59°C (traG) or 54°C (nodA), 12 s (traG), or 14 s (nodA) at 72°C and a final extension of 5 min at 72°C.
The amplification of the 16S rRNA gene was used to normalize the relative traG and nodA transcript abundance. Primers IntF and IntR [25] were used to generate a fragment of 199 bp. This PCR reaction was performed in a final volume of 50 μL, using 2 μL of cDNA (~40 ng), 1× reaction Green GoTaq® Flexi buffer, 0.2 mM of each dNTP, 1.5 mM MgCl2, 15 pmol of each primer, and 0.025U/μL of GoTaq® G2 Flexi DNA Polymerase (Promega, Fitchburg, USA). The amplification program was 2 min of initial denaturation at 95°C, 30 cycles of 60 s at 95°C, 60 s at 56°C, 12 s at 72°C, and a final extension of 5 min at 72°C. Densitometric analyses of ethidium bromide-stained agarose gels were performed using Kodak Digital Science 1D version 2.0.3 (Eastman Kodak Company). Positive controls with total DNA of M. ciceri LMS-1 and M. mediterraneum UPM-Ca3 as template and negative controls without reverse transcriptase enzyme were performed. Three biological replicates were used for the expression analysis of the genes mentioned above.
The data obtained from the RT-PCR analyses were compared using Student’s t-test (differences were considered statistically significant at P<0.05, representing the 95% confidence interval).
3. Results
3.1. Phylogenetic Analysis
With the purpose of comparing the phylogeny of the traG gene with that of symbiosis genes, the nodD, nifA, and traG nucleotide sequences of these genes were analyzed for 33 mesorhizobia strains able to nodulate different plant hosts (Anthyllis vulneraria, Biserrula pelecinus, Bituminaria bituminosa, Cicer arietinum, Glycine max, Lotononis carinata, Lotus spp., and Medicago sativa) (Figures 1, 2, and 3, respectively). In order to also compare the traG phylogeny with the species tree, a phylogeny based on the taxonomic marker 16S rRNA gene was also generated using the same set of strains (Figure 4).
As expected, the phylogenetic trees based on sequences of the symbiosis genes nodD (Figure 1) and nifA (Figure 2) showed similar topologies. Well defined clusters that correspond to the different host plants were identified, reflecting the high level of sequence conservation among strains that nodulate the same host legume. Three main clusters of mesorhizobia strains could be distinguished: mesorhizobia able to nodulate Cicer arietinum; strains that were isolated from Biserrula pelecinus grouping closer with a strain nodulating Anthyllis vulneraria; and mesorhizobia able to nodulate several Lotus species. M. ciceri WSM 4083, a symbiont of Bituminaria bituminosa, grouped apart from these clusters (Figures 1 and 2). Contrary to the nodD phylogenetic analysis, the nifA phylogeny reflects the fact that Lotus symbionts share a higher nifA sequence similarity with Bradyrhizobium strains than with other mesorhizobia, which nodulate Cicer arietinum and Biserrula pelecinus (Figure 2).
Similarly to the phylogenies based on symbiosis genes (nodD and nifA), the traG based-phylogeny also showed rhizobia strains clustering according to their host range (Figure 3), rather than species affiliation. For instance, all symbionts of Cicer arietinum, Biserrula pelecinus, or Lotus spp. formed separated clusters. The traG gene is conserved among the Mesorhizobium species able to nodulate the same host plant, which suggests that this gene was prone to horizontal gene transfer events.
As expected, the 16S rRNA-based phylogeny presented a different topology from those based on the nodD or nifA genes. This phylogeny comprises three main clusters, corresponding to different genera, namely, Mesorhizobium, Ensifer, and Bradyrhizobium (Figure 4). Cicer arietinum mesorhizobia native isolates are found scattered along the Mesorhizobium cluster.
3.2. Genomic Localization and Organization of T4SS Genes, T3SS Genes, and Symbiosis Genes
In silico analyses for genomic localization of the T4SS genes (both the tra/trb and virB/virD4 complexes), symbiosis genes, and two T3SS genes were performed using genomic data from several mesorhizobia strains (Figure 5). Symbionts of Cicer arietinum, Biserrula pelecinus, and Lotus spp. were included in these analyses. Nevertheless, we need to consider that the genomes of majority of the Cicer arietinum symbionts analyzed are in draft status, with the exception of the M. ciceri CC1192 genome, which is complete [39].
In all the genomes analyzed, the T4SS traG/trb genes complex was always found near nitrogen fixation genes, namely, fixG and fixH (Figure 5). In addition, BLAST analyses suggest that none of the five Cicer arietinum microsymbionts (M. mediterraneum UPM-Ca3, M. muleiense CGMCC 1.1102, M. ciceri LMS-1, M. ciceri CMG6, and M. ciceri CC1192) include the T4SS virB/virD4 gene complex, homologous to the virB/virD4 of the M. japonicum R7A. Nevertheless, all the analyzed Cicer arietinum mesorhizobia strains encode genes assigned to the T3SS, namely, rhcJ and rhcN, which were not found in the M. japonicum R7A and M. loti NZP2037 genomes or in the genomes of Biserrula pelecinus nodulating strains. For two Cicer arietinum mesorhizobia species the genomic data available shows the localization of these T3SS genes near the tra/trb complex and consequently close to the fixG and fixH genes. Similarly to the Cicer arietinum-nodulating mesorhizobia strains, the M. japonicum MAFF30309, a Lotus spp. symbiont, does not encode the virB/virD4 genes and also shows the T3SS rhcJ and rhcN genes located close to the tra/trb complex (Figure 5).
Interestingly, in strains M. japonicum R7A and M. loti NZP2037, the nod genes are localized nearby the virB/virD4 T4SS genes and not close to the nif genes as in symbionts of Biserrula pelecinus (M. ciceri bv. biserrulae WSM1271, M. australicum WSM207, and M. opportunistum WSM207). In M. japonicum MAFF30309, the nod cluster is neither close to the nif genes nor close to the T4SS or T3SS analysed genes. For most of Cicer arietinum mesorhizobia genomes analysed, the nod genes were detected in a different scaffold from that of nif, T4SS, or T3SS genes. Nevertheless, these data are consistent with an organization similar to the one found in the complete genome of M. ciceri CC1192, a Cicer arietinum symbiont (Figure 5).
3.3. Analyses of traG and nodA Genes Expression by Semiquantitative RT-PCR
To understand the timing of the T4SS traG gene expression, the expression of this gene and of the nodA gene was evaluated by semiquantitative RT-PCR in free-living bacteria grown in the presence and absence of Cicer arietinum root exudates and also in bacteroids from root nodules collected at two different time points (15 and 21 days after inoculation) (Figure 6). The traG and nodA gene expression analyses were performed for M. mediterraneum UPM-Ca3 and M. ciceri LMS-1 strains, both Cicer arietinum symbionts. In free-living conditions, the traG gene expression was only detected when bacteria were exposed to Cicer arietinum root exudates (Figures 6(a) and 6(c)). In bacteroids, the traG gene expression was only detected in developing nodules (collected at 15 dpi) and exclusively for nodules induced by M. mediterraneum UPM-Ca3. In older nodules (21 dpi) the traG transcripts were no longer detected. For the strain UPM-Ca3, approximately the same levels of traG transcripts were detected for bacteria exposed to exudates and bacteroids within 15 dpi nodules. As expected, in both strains, the nodA gene expression (regulated by NodD) was only observed in free-living bacteria when exposed to Cicer arietinum root exudates and in early stage of the nodulation process (15 dpi nodules) (Figures 6(b) and 6(d)). Nevertheless, the abundance of nodA transcripts in those nodules was significantly lower compared to the levels of transcription detected for this gene when free-living bacteria were exposed to Cicer arietinum root exudates.
(a)
(b)
(c)
(d)
4. Discussion
Although some studies have already analyzed rhizobia nodulating Lotus and Medicago species [12, 19–21], little is known about the T4SS in Cicer arietinum mesorhizobia. Herein, the mesorhizobia traG phylogeny and expression of this gene in Cicer arietinum mesorhizobia strains, as well as the occurrence and genomic context of this and other T4SS genes, were investigated.
The phylogenetic analysis performed using the T4SS traG gene sequences from native Cicer arietinum mesorhizobia isolates, together with traG sequences from other mesorhizobia with genomes completely or partially sequenced, shows that mesorhizobia strains nodulating the same host plant group in the same cluster, regardless of their species affiliation. The traG-based phylogeny is similar to the ones obtained by the phylogenetic analysis of the symbiosis genes nodD and nifA and consistent with previous studies reporting phylogenies of symbiosis genes [36, 40]. This suggests that the traG gene may be prone to horizontal gene transfer together with the symbiosis genes. This is further supported by the genomic context analysis performed in this work for 11 mesorhizobia, which shows proximity in terms of localization between the traG/trb genes and the symbiosis genes fixG and fixH, involved in bacterial nitrogen fixation [3]. Moreover, our analysis also verified that the traG gene is localized within the previously identified symbiosis island of Biserrula pelecinus and Lotus spp. symbionts, namely, for M. ciceri bv. biserrulae WSM1271 [41], M. australicum WSM207 [42], M. opportunistum WSM207 [43], M. japonicum R7A [33], Mesorhizobium loti NZP2037 [44], and M. japonicum MAFF30309 [45].
Horizontal transfer of symbiosis genes between different species on the soil would allow a rhizobia strain to acquire the ability to nodulate a new host, when receiving a specific set of symbiosis genes [40, 46–52]. A well-known example of this event was reported for the strains M. australicum WSM207 and M. opportunistum WSM207, which seem to have received the complete symbiotic island from the inoculant strain M. ciceri bv. biserrulae WSM1271 and therefore gained the ability to nodulate the introduced legume Biserrula pelecinus [53, 54]. The present work suggests that the nonsymbiotic gene traG may have been transferred horizontally between strains that nodulate the same host. In fact, the TraG protein could be involved in the effective transference of the symbiotic region in these mesorhizobia strains, since this protein has been described as having a crucial function in bacterial conjugation [55] and was shown to be required for horizontal gene transfer of the symbiosis island from Azorhizobium caulinodans to other rhizobia [56].
Analysis of the M. japonicum R7A genome [33, 57] suggested at least two types of T4SS genes clusters in Mesorhizobium genomes, namely, the tra/trb and the virB/virD4 genes. Similar organization of these genes clusters was reported for Ensifer strains, namely, the T4SSb/c (virB/virD4) and T4SSe (tra/trb) clusters [21]. Our analysis shows that this is true for other mesorhizobia strains, namely, M. ciceri bv. biserrulae WSM1271 [40, 57], M. australicum WSM207 [42], M. opportunistum WSM207 [43], and M. loti NZP2037 [44, 58]. However, the work of Hubber and collaborators [19] shows that the structural organization of the T4SS in mesorhizobia is not always composed by both tra/trb and virB/virD4 gene clusters. In the Lotus symbiont M. japonicum MAFF30309, the absence of the T4SS virB/virD4 complex was reported [19]. These authors proposed that in M. japonicum MAFF30309 the absence of these genes is somehow compensated by the presence of T3SS genes, which are not encoded in the M. japonicum R7A genome. The present analysis of Cicer arietinum symbionts contributes to our understanding about this topic, supporting the idea that the absence of the T4SS virB/virD4 gene cluster could be more common in mesorhizobia genomes than initially assumed, since in these Cicer arietinum mesorhizobia strains the T4SS virB/virD4 complex seems to be absent, while the T3SS genes were detected in all the strains. Altogether, these data could also suggest that, in mesorhizobia, the role(s) of the T4SS VirB/VirD4 proteins could be at least partially substituted by the role(s) of the T3SS proteins. Further studies are required to verify this putative functional redundancy.
The analysis of the traG gene expression in two Cicer arietinum symbionts, M. mediterraneum UPM-Ca3, and M. ciceri LMS-1 shows that this gene is expressed in free-living bacteria when exposed to Cicer arietinum root exudates and may also be expressed in recently formed root nodules. A very similar expression profile is observed for the nodulation gene nodA. Although these findings are consistent with a putative regulation of the traG gene by NodD, which would be similar to what was previously reported for T4SS virB/virD4 genes as well as T3SS genes [21], no nod-box was detected upstream the traG gene in the mesorhizobia genomes analyzed. The expression of traG during nodulation was also supported by another study reporting high-resolution transcriptome analyses in bacteroids of Ensifer sp. NGR234, which detected T4SS gene expression (at very low levels), in Vigna unguiculata and Leucaena leucocephala nodules [59]. Ling and collaborators [56], using a gene knockout approach, showed that TraG is required for conjugative DNA transfer in rhizobia. A role of TraG in horizontal transfer events of symbiosis islands is consistent with the timing of expression detected for this gene, which in this work was seen to be activated by legume exudates and even in developing nodules.
5. Conclusions
The location of T4SS genes clusters in the symbiotic regions of rhizobia genomes, as well as the timing of the traG gene expression, supports the previously reported role of TraG in the horizontal transfer events of symbiosis genes. Moreover, the phylogeny of traG is similar to the nodD and nifA phylogenies, which suggests that traG is horizontally transferred together with these symbiosis genes. This study addressing several aspects of the traG gene in mesorhizobia contributes to a better understanding of the structural and functional organization of this secretion system in mutualistic symbiotic bacteria.
Data Availability
The NCBI accession data that support the results are within the manuscript.
Disclosure
S. Oliveira is deceased.
Conflicts of Interest
The authors declare no conflicts of interest.
Authors’ Contributions
A. Alexandre and S. Oliveira designed the experiments; A. Paço, J. R. da-Silva, F. Eliziário, and C. Brígido performed the experiments and analyzed the data. A. Paço wrote the manuscript with support from A. Alexandre and C. Brígido.
Funding
This work was supported by funds from FEDER through the Operational Programme for Competitiveness Internationalisation (POCI), COMPETE 2020, National Funds through FCT (Fundação para a Ciência e a Tecnologia), under the Strategic Project PEst-OE/AGR/UI0115/2014, Project FCOMP-01-0124-FEDER-028316 (PTDC/BIA-EVF/4158/2012), POCI-01-0145-FEDER-016810 (PTDC/AGR-PRO/2978/2014), and InAlentejo ALENT-07-0262-FEDER-001871. C. Brígido acknowledges a post-doc fellowship (SFRH/BPD/94751/2013) from FCT and J. R. da-Silva acknowledges a Ph.D. fellowship (BEX 1254138) from CAPES, Brazil.