BioMed Research International

BioMed Research International / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 1216926 | https://doi.org/10.1155/2020/1216926

MinQian Shen, YiFan Feng, Jing Wang, YuanZhi Yuan, Fei Yuan, "CXCR7 Inhibits Fibrosis via Wnt/β-Catenin Pathways during the Process of Angiogenesis in Human Umbilical Vein Endothelial Cells", BioMed Research International, vol. 2020, Article ID 1216926, 10 pages, 2020. https://doi.org/10.1155/2020/1216926

CXCR7 Inhibits Fibrosis via Wnt/β-Catenin Pathways during the Process of Angiogenesis in Human Umbilical Vein Endothelial Cells

Academic Editor: Klaus Wimmers
Received17 Feb 2020
Revised01 May 2020
Accepted12 May 2020
Published05 Jun 2020

Abstract

Although SDF-1/CXCR7 plays an important role in angiogenesis, the function and the pathway of the SDF-1/CXCR7 axis might depend on the cell type or tissue origin and not fully understood. In this study, we investigated the effect of CXCR7 in SDF-1-induced proliferation, migration, apoptosis, tube formation, and endothelial-to-mesenchymal transition (EndMT) of human umbilical vein endothelial cells (HUVECs), and the potential pathway of SDF-1/CXCR7. We confirmed that the silencing of CXCR7 inhibited the proliferation of HUVECs and contributed the apoptosis, while overexpressed CXCR7 increased SDF-1-induced HUVECs migration and tube formation. However, upregulated CXCR7 inhibited the expression of α-SMA, suggesting that CXCR7 might attenuate EndMT. In addition, overexpressed CXCR7 activated AKT and ERK signaling pathways but suppressed Wnt/β-catenin pathways in HUVECs. The inhibition of Wnt/β-catenin pathways decreased the expression of α-SMA. Altogether, these results suggest that CXCR7 might inhibit fibrosis via Wnt/β-catenin pathways during the process of angiogenesis.

1. Introduction

Angiogenesis is a key component of many pathological conditions, including corneal neovascularization (CorNV). Corneal neovascularization, resulting from a variety of etiologies, is a sight-threatening pathological change and part of a wound healing response culminating in fibrosis and scar formation [1, 2]. Although the mechanism of CorNV has been unclear, the mounting evidence shows that lymphangiogenesis and angiogenesis are closely related to CorNV [3]. Chemokines, including stromal-derived factor 1 (SDF-1), are small molecules for leukocyte migration and recruitment [4] and have been reported involved with lymphangiogenesis and angiogenesis [5].

SDF-1, also known as CXCL12, has been confirmed to be associated with pathological angiogenesis including CorNV [6, 7]. For many years, CXCR4 has been considered the exclusive receptor for SDF-1 until CXCR7 was discovered [8, 9]. CXCR7 is involved with the proliferation, invasion, migration, and adhesion of several cancer cells [1018] and plays a role in the pathophysiological processes of diabetic limb ischemia [19], cerebral ischemia [20], coronary artery disease [21], and vascular eye diseases [2226]. The previous literature shows SDF-1/CXCR7 axis can not only activate MAPK/ERK [21, 2729] and PI3K/AKT pathway [13, 15, 19, 30], but also STAT3 [31] and Notch pathway [32]. Thus, the function and the pathway of the SDF-1/CXCR7 axis might depend on the cell type or tissue origin [26]. In our pilot study [23], we found that TC14012, a CXCR7 agonist, initially enhanced alkali burn-induced CorNV, but this effect did not maintain over time. The results indicated that CXCR7 might play a role in the pathogenesis of CorNV in addition to CXCR4, but the mechanism was not fully understood.

The cornea is transparent and devoid of blood and lymphatic vessels. In certain pathological conditions, the corneal host cells, including corneal epithelial, stromal, and endothelial cells can play intricate roles in angiogenesis via releasing series factors, which shift the balance toward CorNV [33]. Then, the process of neovascularization includes the activation, proliferation, and migration of endothelial cells, and the formation of vascular tubes and networks [34]. Therefore, endothelial cells are the effector cells. Human umbilical vein endothelial cells (HUVECs) exhibit key endothelial cell phenotypes [35] and are widely used in the in vitro research of CorNV. In the current study, we determined the role of CXCR7 in angiogenesis and fibrosis as well as the potential pathway of SDF-1/CXCR7 axis in HUVECs.

2. Materials and Methods

2.1. Cell Culture

HUVECs (Jennio Biotech, Guangzhou, China) were maintained in DMEM/F12 medium (Biological Industries, Beit Haemek, Israel) containing 1% endothelial cell growth supplement (ECGS, Sciencell, CA, USA), 20% fetal bovine serum, 5 U/ml of penicillin, and 5 mg/ml of streptomycin and were used at passage 8-10.

2.2. CXCR7 Knockdown and Overexpression

To knockdown CXCR7 expression, specific siRNAs against human CXCR7, alone with the negative control, were transfected into HUVECs using Lipofectamine 3000 (Thermo Fisher, Waltham, MA). We selected 3 target sequences for CXCR7 and the negative control as follows: CXCR7-siRNA 1, forward (GCUAUGACACGCACUGCUATT), and reverse (UAGCAGUGCGUGUCAUAGCTT); CXCR7-siRNA 2, forward (GCAGCCGGAAGAUCAUCUUTT), and reverse (AAGAUGAUCUUCCGGCUGCTT); CXCR7-siRNA 3, forward (GCUUCAUCAAUCGCAACUATT), and reverse (UAGUUGCGAUUGAUGAAGCTT); negative control, forward (UUCUCCGAACGUGUCACGUTT), and reverse (ACGUGACACGUUCGGAGAATT). After transfection for 48 h, the expression of CXCR7 was determined by quantitative real-time PCR and western blot.

To upregulate the CXCR7 expression in HUVECs, the plasmid encoding overexpressed CXCR7 was constructed by cloning the CXCR7 gene into XhoI and EcoRI sites on pEX-1 vector (Shanghai GenePharma, Shanghai, China). The CXCR7 cDNA was amplified using the following primers: forward (CGCAAATGGGCGGTAGGCGTG) and reverse (TAGAAGGCACAGTCGAGG). HUVECs were transfected with recombinant CXCR7 or control vector using Lipofectamine 3000 overnight. After transfection for 48 h, the efficiency was determined by quantitative real-time PCR and western blot.

2.3. Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reversed transcribed with PrimeScript® RT Master Mix (TaKaRa, Otsu, Japan). qRT- PCR was performed using the ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA) and using the SYBR Premix Ex Taq™ II Kit (Takara) according to the manufacturer’s instructions. The primes were as follows: CXCR7, forward (ACGTGGTGGTCTTCCTTGTC), and reverse (AAGGCCTTCATCAGCTCGTA); GAPDH, forward (CTCAGACACCATGGGGAAGGT), and reverse (TGATCTTGAGGCTGTTGTCATA). Relative mRNA expression levels were calculated by the 2-∆∆Ct method. GAPDH was used as a reference gene.

2.4. Western Blot

The cells were lysed in RIPA Lysis Buffer (Beyotime, China) supplemented with protease inhibitors. The total protein concentration was measured using a BCA protein assay kit (Pierce, MA, USA) according to the manufacturer’s instruction. A total of 20 μg protein was separated on 10% SDS-PAGE and transferred onto PVDF membranes (Beyotime). Blocking was performed in 5% nonfat dried milk in Tris-buffered saline containing 0.1% Tween 20 at room temperature for 2 hours. The membranes were incubated overnight at 4°C with primary antibodies, including the following: polyclonal anti-CXCR7 (1 : 400; Abcam, Cambridge, MA, USA), polyclonal anti-pan-AKT (1 : 1000; Abcam), polyclonal anti-phospho-AKT (1 : 500; Abcam), monoclonal anti-ERK1/2 (1 : 5000; Abcam), monoclonal anti-phospho-ERK1/2 (1 : 1000; Abcam), monoclonal anti-β-catenin (1 : 400; Abcam), monoclonal anti-c-Myc (1 : 500; Abcam), polyclonal anti-cyclinD1 (1 : 1000; Abcam), polyclonal anti-survivin (1 : 5000; Abcam), monoclonal anti-α-SMA (1 : 1000; Abcam), and monoclonal anti-GAPDH (1 : 10000; Abcam). The membranes were then washed with TBST three times, incubated with HRP-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA) for 2 hours at room temperature, then detected with ECL detection reagents (Thermo Fisher Scientific, Waltham, MA, USA). GAPDH was used as a loading control.

2.5. Cell Proliferation Assay

After CXCR7 siRNA or overexpressed CXCR7 transfection for 48 h, the HUVECs were seeded into 96-well plate (3000 cells/well). Cell proliferation was detected after SDF-1 (100 ng/ml) treatment for 24 h with CCK-8 kit (Dojindo, Kumamoto, Japan) according to the manufacturer’s instruction. The optical density was measured with a microplate reader at 450 nm.

2.6. Flow Cytometry Analysis of Cell Apoptosis

Apoptosis was detected by annexin V-FITC kit (Beyotime). In brief, HUVECs were transfected with CXCR7 siRNA or overexpressed CXCR7 for 48 h, then cultured with SDF-1 (100 ng/ml) for 24 h. After experimental treatment, HUVECs were collected and washed 2 times, then incubated with annexin V-FITC and propidium iodide (PI) for 15 min at room temperature in the dark. Cells were then immediately analyzed by flow cytometry.

2.7. Transwell Migration Assay

Cell migration assay was performed in a 6-well plate with 8.0 μm pore-size transwell inserts (Corning, Corning, NY, USA). The upper surface chamber was pretreated with Matrigel (Corning) and serum-free DMEM/F12 (1 : 8) medium. After CXCR7 siRNA or overexpressed CXCR7 transfection for 48 h, a total of HUVECs were seeded to the upper chamber with serum-free DMEM/F12 media. The lower chamber was filled with 500 μl DMEM/F12 medium containing SDF-1 (100 ng/ml) and 10% FBS. After incubation at 37°C for 24 h, the cells that migrated to the lower membrane surface were fixed with 4% paraformaldehyde and stained by 0.1% crystal violet. The number of cells in randomized 5 fields was counted under a microscope.

2.8. Scratch Wound Assay

A total of upregulated or downregulated CXCR7 HUVECs were seeded onto a 6-well plate for 24 h, and then exposed to SDF-1(100 ng/ml). A wound was created after manually scraping the cell monolayer with a p200 pipet tip. The initial wound quantification was performed on images collected at 0 hour after wounding, and further images were collected randomly in wound areas at 18 h after wounding. The wound width was measured, and the migration was represented as percentage migration considering migration in untreated control as 100%.

2.9. Tube Formation Assay

Aliquots (50 μl) of Matrigel (Corning) were added to a 96-well plate and were incubated at 37°C for 1 h. HUVECs were pretreated as below: (1) control; (2) SDF-1 (100 ng/ml); (3) SDF-1 and siRNA negative control transfection; (4) SDF-1 and CXCR7 siRNA transfection; (5) SDF-1 and over-expression control; (6) SDF-1 and CXCR7 overexpression transfection. The cells were resuspended in supernatants collected from each pretreatment and then seeded onto the gel ( cells/well). Five random fields from each well were chosen and photographed after 4 h. Networks of tube-like structures were measured using Image-Pro Plus software, version 6.0 (Media Cybernetic, Silver Spring, MA, USA).

2.10. Immunofluorescence Staining

HUVECs were pretreated as before. The cells were fixed with 4% paraformaldehyde in for 15 min at room temperature, blocked with PBS/0.3% Triton™ X-100 for 1 h. Then, cells were incubated with anti- α-SMA (1 : 500; Abcam) overnight at 4°C. After 3 washes in PBS, cells were incubated for 1 h with Alexa Fluor® 488-conjugated secondary antibody(1 : 1000; Abcam). Cells were rinsed in PBS and incubated with DAPI for 5 min. Images were captured with an inverted microscope (Leica, Wetzlar, Germany).

2.11. Statistical Analysis

The data were presented as the mean values of 3 or 4 independent experiments. Student’s test and one-way ANOVA analysis were performed using SPSS 20.0 (SPSS, Chicago, Ill, USA) for all statistical data. All analyses were carried out using GraphPad Prism (GraphPad Software, La Jolla, CA). Values were expressed as the , and statistical significance was set at .

3. Results

3.1. The Downregulation and Upregulation of CXCR7 in HUVECs

After selection with puromycin, the expression of CXCR7 in HUVECs was detected by qRT-PCR and western blotting. The level of CXCR7 mRNA and protein in HUVECs transfected with CXCR7-siRNA 3 was decreased () (Figures 1(a) and 1(b)). On the contrary, the level of CXCR7 mRNA was significantly increased with overexpressed CXCR7 plasmid vector transfected () (Figures 1(c) and 1(d)). These results indicated that CXCR7 knockdown and overexpressed HUVECs could be available to further researches.

3.2. The Effects of CXCR7 on the Proliferation and Apoptosis of HUVECs

SDF-1 enhanced cell proliferation of HUVECs by 55.7% () compared to the control cells. We next evaluated the role of CXCR7 in regulating the proliferation of HUVECs. The CXCR7-siRNA cells displayed decreased proliferation ability compared to the SDF-1-treated cells ( versus , ), while CXCR7 overexpressed HUVECs showed increased proliferation rates ( versus , ). These findings indicate that CXCR7 enhances the proliferation of HUVECs and silencing of CXCR7 inhibits the proliferation ability of HUVECs induced by SDF-1 (Figure 2(a)).

Then, we investigated the potential role of CXCR7 in the survival of HUVECs under SDF-1 treatment by flow cytometry to determine the cell apoptosis. SDF-1 alone prevented the cells from apoptosis ( versus , ). Blocking CXCR7 with CXCR7-siRNA promoted the apoptotic effect on HUVECs ( versus , ) while upregulated CXCR7 inhibited the HUVECs apoptosis ( versus , ). These results suggest that SDF-1 mediates HUVECs survival via CXCR7 (Figures 2(b) and 2(c)).

3.3. The Effects of CXCR7 on Migration and Tube Formation of HUVECs

To investigate the contribution of CXCR7 to SDF-1-induced migration of HUVECs, we performed transwell migration assay and scratch wound assay. The migration response to SDF-1 of HUVECs was suppressed by blocking CXCR7 ( versus cells/filed, ), while enhanced by overexpressing CXCR7 ( versus cells/filed, ) (Figure 3(a)). The same results were obtained by the scratch wound assay (Figure 3(b)). Thus, CXCR7 increases the SDF-1-induced migration of HUVECs.

As shown in Figure 3(c), SDF-1 also boosted tube formation in HUVECs ( versus , ). CXCR7-siRNA significantly reduced the number of nodes ( versus , ), while overexpression of CXCR7 enhanced the tube formation ability ( versus , ). These data suggest that CXCR7 is essential to SDF-1-induced tube formation in HUVECs.

3.4. CXCR7 Activates ERK and AKT Pathways but Suppresses the Wnt/β-Catenin Pathway in HUVECs

To investigate the signaling pathway of CXCR7, we assessed total ERK1/2, phospho-ERK1/2, pan AKT, phospho-AKT, and β-catenin protein levels in the presence of SDF-1 by western blotting. The phosphorylation of ERK1/2 and AKT increased when CXCR7 was overexpressed, while the level of phosphorylated ERK1/2 and AKT was decreased in CXCR7 downregulated HUVECs (Figure 4(a)). In contrast, the protein level of β-catenin decreased when CXCR7 was overexpressed. In addition, the levels of Wnt/β-catenin downstream target proteins c-Myc, survivin, and cyclinD1 significantly decreased by upregulating CXCR7 (Figure 4(b)). These data suggest that overexpressed CXCR7 suppresses the Wnt/β-catenin pathway in HUVECs.

3.5. CXCR7 Inhibits Endothelial-to-Mesenchymal Transition (EndMT) by Wnt/β-Catenin Pathway in HUVECs

As CXCR7 ameliorates fibrosis partially due to inhibition β-catenin-dependent induction of Jag1 [36], we detected the expression of α-SMA by western blotting and immunofluorescence staining in knockdown and overexpressed CXCR7 treated HUVECs (Figure 5(a)). The protein level of α-SMA increased in CXCR7 downregulated HUVECs and decreased in CXCR7 upregulated cells (Figure 5(b)). In addition, the expression of α-SMA decreased by pretreatment of the Wnt/β-catenin inhibitor (ICG001) compared to the CXCR7 downregulated group (Figure 5(c)). These results indicate that CXCR7 inhibits EndMT by Wnt/β-catenin pathway in HUVECs.

4. Discussion

Angiogenesis refers to many neovascular diseases when the balance is damaged between angiogenic factors and angiogenic inhibitors. In most pathological conditions, angiogenesis is part of a wound healing response culminating, via an angiofibrotic switch, in fibrosis, and scar formation [2]. Our pilot research showed that CXCR7 might be involved in CorNV [23]. However, the role and the mechanism of CXCR7 in CorNV were not fully understood. In this study, we determined the role of SDF-1/CXCR7 axis in angiogenesis in HUVECs.

CXCR7, one of the chemokine receptor for SDF-1, has been demonstrated to regulate the proliferation [11, 37], migration [16, 26, 27, 29, 31, 37], invasion [11, 16, 38], adhesion [11, 21, 37], and tube formation [11, 15, 24, 26, 29, 30, 37, 39] in different cell lines. The function of the CXCR7 depends on the cell type or tissue origin [26]. In this study, we found CXCR7 enhanced the proliferation, migration, and tube formation of HUVECs and inhibited the apoptosis. Consistent with most of the previous researches, these results demonstrate that CXCR7 is essential to the angiogenesis induced by SDF-1. However, we also found that overexpressed CXCR7 reduced the expression of α-SMA, suggesting that CXCR7 might attenuate EndMT. Cao et al. [36] reported TC14012, a CXCR7 agonist, promoted lung alveolar repair and reduced fibrosis. Guan and Zhou [40] also proposed that CXCR7 upregulation during angiogenesis was a feedback mechanism to ameliorate pulmonary fibrosis. Together, these results suggest that CXCR7 might inhibit fibrosis during the process of angiogenesis. Besides, TC14012 seemed to have an inhibitory effect on angiogenesis at the late stage of CorNV [23]. Thus, upregulation of CXCR7 might not result in excessive neovascularization along with the inhibition of fibrosis.

CXCR7 belongs to the superfamily of 7-transmembrane G-protein-coupled receptors, but cannot stimulate typical G-protein-dependent pathways [41]. CXCR7 could not only form heterodimers with CXCR4 to recruit β-arrestin and activate β-arrestin-linked signaling pathways, including the ERK1/2, p38 MAPK, and SAPK/JNK pathways, but also independently activate the AKT and ERK1/2 pathways [42]. In our study, we confirmed CXCR7 simultaneously activated AKT and ERK signaling pathways in HUVECs, which has recently been shown to regulate angiogenesis in tumors [43]. Besides, we unexpectedly found that CXCR7 inhibited Wnt pathway and its downstream target proteins. Wnt signaling is a major regulator of VEGF and plays a role in CorNV [44]. Beyond its role in development, Wnt/β-catenin pathway functionally contributes to fibrosis in several organs [45]. The inhibition of the Wnt/β-catenin pathway plays a role on antifibrosis [36, 4648]. A previous study showed that the expression of CXCR7 was controlled by the restriction activation of Wnt/β-catenin signaling [49] and conversely CXCR7 inhibited β-catenin-dependent induction of Jag1 [36] to ameliorate fibrosis, indicating that CXCR7 and Wnt/β-catenin pathways might be functionally linked. In our study, we confirmed that CXCR7 inhibited EndMT via Wnt/β-catenin pathway.

Until CXCR7 was discovered, CXCR4 has been considered the exclusive receptor for SDF-1 [8, 9]. Activation of the CXCR4/SDF-1 axis initiates HUVECs migration and angiogenesis via the MAPK/ERK, PI3K/AKT, and Wnt/β-catenin pathways [50]. These suggest that both CXCR4 and CXCR7 contribute to the migration and tube formation of HUVECs via ERK and AKT signaling pathways. However, CXCR4 and CXCR7 exert an opposite effect on the Wnt/β-catenin pathway in HUVECs. CXCR7 binds to SDF-1 with a higher affinity than CXCR4 and functions as a scavenger of SDF-1 to modulate CXCR4 signaling [51]. Thus, we supposed that continuously overexpressed CXCR7 could inhibit fibrosis along with neovascularization via Wnt/β-catenin pathway in vivo.

5. Conclusion

In summary, overexpressed CXCR7 might inhibit fibrosis via Wnt/β-catenin pathways during the process of angiogenesis in HUVECs. CXCR7 could be a regulator for the pathophysiology of angiogenesis via an angiofibrotic switch.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Acknowledgments

This study was supported by grants from the National Nature Science Foundation of China (grant No. 81600703; grant No. 81600735).

References

  1. J. H. Chang, E. E. Gabison, T. Kato, and D. T. Azar, “Corneal neovascularization,” Current Opinion in Ophthalmology, vol. 12, no. 4, pp. 242–249, 2001. View at: Publisher Site | Google Scholar
  2. M. J. Siemerink, A. J. Augustin, and R. O. Schlingemann, “Mechanisms of ocular angiogenesis and its molecular mediators,” Developments in Ophthalmology, vol. 46, pp. 4–20, 2010. View at: Publisher Site | Google Scholar
  3. D. Roshandel, M. Eslani, A. Baradaran-Rafii et al., “Current and emerging therapies for corneal neovascularization,” The Ocular Surface, vol. 16, no. 4, pp. 398–414, 2018. View at: Publisher Site | Google Scholar
  4. M. Baggiolini, “Chemokines and leukocyte traffic,” Nature, vol. 392, no. 6676, pp. 565–568, 1998. View at: Publisher Site | Google Scholar
  5. D. Bosisio, V. Salvi, V. Gagliostro, and S. Sozzani, “Angiogenic and antiangiogenic chemokines,” Chemical Immunology and Allergy, vol. 99, pp. 89–104, 2014. View at: Publisher Site | Google Scholar
  6. L. L. Du and P. Liu, “CXCL12/CXCR4 axis regulates neovascularization and lymphangiogenesis in sutured corneas in mice,” Molecular Medicine Reports, vol. 13, no. 6, pp. 4987–4994, 2016. View at: Publisher Site | Google Scholar
  7. R. Zhao, J. Zhang, Y. Wang et al., “Activation of toll-like receptor 3 promotes pathological corneal neovascularization by enhancement of SDF-1-mediated endothelial progenitor cell recruitment,” Experimental Eye Research, vol. 178, pp. 177–185, 2019. View at: Publisher Site | Google Scholar
  8. K. Balabanian, B. Lagane, S. Infantino et al., “The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes,” The Journal of Biological Chemistry, vol. 280, no. 42, pp. 35760–35766, 2005. View at: Publisher Site | Google Scholar
  9. J. M. Burns, B. C. Summers, Y. Wang et al., “A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development,” The Journal of Experimental Medicine, vol. 203, no. 9, pp. 2201–2213, 2006. View at: Publisher Site | Google Scholar
  10. A. Nazari, H. Khorramdelazad, and G. Hassanshahi, “Biological/pathological functions of the CXCL12/CXCR4/CXCR7 axes in the pathogenesis of bladder cancer,” International Journal of Clinical Oncology, vol. 22, no. 6, pp. 991–1000, 2017. View at: Publisher Site | Google Scholar
  11. D. M. Ma, D. X. Luo, and J. Zhang, “SDF-1/CXCR7 axis regulates the proliferation, invasion, adhesion, and angiogenesis of gastric cancer cells,” World Journal of Surgical Oncology, vol. 14, no. 1, p. 256, 2016. View at: Publisher Site | Google Scholar
  12. S. Nambara, T. Iguchi, E. Oki, P. Tan, Y. Maehara, and K. Mimori, “Overexpression of CXCR7 is a novel prognostic indicator in gastric Cancer,” Digestive Surgery, vol. 34, no. 4, pp. 312–318, 2017. View at: Publisher Site | Google Scholar
  13. H. Zhang, X. Teng, Z. Liu, L. Zhang, and Z. Liu, “Gene expression profile analyze the molecular mechanism of CXCR7 regulating papillary thyroid carcinoma growth and metastasis,” Journal of Experimental & Clinical Cancer Research, vol. 34, no. 1, p. 16, 2015. View at: Publisher Site | Google Scholar
  14. H. Zhang, L. Yang, X. Teng et al., “The chemokine receptor CXCR7 is a critical regulator for the tumorigenesis and development of papillary thyroid carcinoma by inducing angiogenesis in vitro and in vivo,” Tumour Biology, vol. 37, no. 2, pp. 2415–2423, 2016. View at: Publisher Site | Google Scholar
  15. Y. Chen, F. Teng, G. Wang, and Z. Nie, “Overexpression of CXCR7 induces angiogenic capacity of human hepatocellular carcinoma cells via the AKT signaling pathway,” Oncology Reports, vol. 36, no. 4, pp. 2275–2281, 2016. View at: Publisher Site | Google Scholar
  16. Y. Wu, L. Tian, Y. Xu et al., “CXCR7 silencing inhibits the migration and invasion of human tumor endothelial cells derived from hepatocellular carcinoma by suppressing STAT3,” Molecular Medicine Reports, vol. 18, no. 2, pp. 1644–1650, 2018. View at: Publisher Site | Google Scholar
  17. I. Ghanem, M. E. Riveiro, V. Paradis, S. Faivre, P. M. de Parga, and E. Raymond, “Insights on the CXCL12-CXCR4 axis in hepatocellular carcinoma carcinogenesis,” American Journal of Translational Research, vol. 6, no. 4, pp. 340–352, 2014. View at: Google Scholar
  18. T. Qian, Y. Liu, Y. Dong et al., “CXCR7 regulates breast tumor metastasis and angiogenesis in vivo and in vitro,” Molecular Medicine Reports, vol. 17, no. 3, pp. 3633–3639, 2018. View at: Publisher Site | Google Scholar
  19. X. Dai, X. Yan, J. Zeng et al., “Elevating CXCR7 improves angiogenic function of EPCs via Akt/GSK-3β/Fyn-Mediated Nrf2 activation in diabetic limb ischemia,” Circulation Research, vol. 120, no. 5, pp. e7–e23, 2017. View at: Publisher Site | Google Scholar
  20. X. Cheng, H. Wang, X. Zhang et al., “The role of SDF-1/CXCR4/CXCR7 in neuronal regeneration after cerebral ischemia,” Frontiers in Neuroscience, vol. 11, p. 590, 2017. View at: Publisher Site | Google Scholar
  21. Z. Cao, X. Tong, W. Xia et al., “CXCR7/p-ERK-signaling is a novel target for therapeutic vasculogenesis in patients with coronary artery disease,” PLoS One, vol. 11, no. 9, p. e0161255, 2016. View at: Publisher Site | Google Scholar
  22. J. Jin, W. C. Zhao, and F. Yuan, “CXCR7/CXCR4/CXCL12 axis regulates the proliferation, migration, survival and tube formation of choroid-retinal endothelial cells,” Ophthalmic Research, vol. 50, no. 1, pp. 6–12, 2013. View at: Publisher Site | Google Scholar
  23. M. Shen, F. Yuan, J. Jin, and Y. Yuan, “The effect of TC14012 on alkali burn-induced corneal neovascularization in mice,” Ophthalmic Research, vol. 52, no. 1, pp. 17–24, 2014. View at: Publisher Site | Google Scholar
  24. Y. Feng, J. Wang, Y. Yuan, X. Zhang, M. Shen, and F. Yuan, “miR-539-5p inhibits experimental choroidal neovascularization by targeting CXCR7,” The FASEB Journal, vol. 32, no. 3, pp. 1626–1639, 2018. View at: Publisher Site | Google Scholar
  25. Y. F. Feng, H. Guo, F. Yuan, and M. Q. Shen, “Lipopolysaccharide promotes choroidal neovascularization by up-regulation of CXCR4 and CXCR7 expression in choroid endothelial cell,” PLoS One, vol. 10, no. 8, p. e0136175, 2015. View at: Publisher Site | Google Scholar
  26. Y. F. Feng, F. Yuan, H. Guo, and W. Z. Wu, “TGF-β1 enhances SDF-1-induced migration and tube formation of choroid-retinal endothelial cells by up-regulating CXCR4 and CXCR7 expression,” Molecular and Cellular Biochemistry, vol. 397, no. 1-2, pp. 131–138, 2014. View at: Publisher Site | Google Scholar
  27. Q. Chen, M. Zhang, Y. Li et al., “CXCR7 mediates neural progenitor cells migration to CXCL12 independent of CXCR4,” Stem Cells, vol. 33, no. 8, pp. 2574–2585, 2015. View at: Publisher Site | Google Scholar
  28. K. Hattermann, J. Held-Feindt, R. Lucius et al., “The chemokine receptor CXCR7 is highly expressed in human glioma cells and mediates antiapoptotic effects,” Cancer Research, vol. 70, no. 8, pp. 3299–3308, 2010. View at: Publisher Site | Google Scholar
  29. K. Yamada, N. Maishi, K. Akiyama et al., “CXCL12-CXCR7 axis is important for tumor endothelial cell angiogenic property,” International Journal of Cancer, vol. 137, no. 12, pp. 2825–2836, 2015. View at: Publisher Site | Google Scholar
  30. A. K. Azab, I. Sahin, M. Moschetta et al., “CXCR7-dependent angiogenic mononuclear cell trafficking regulates tumor progression in multiple myeloma,” Blood, vol. 124, no. 12, pp. 1905–1914, 2014. View at: Publisher Site | Google Scholar
  31. N. Wani, M. W. Nasser, D. K. Ahirwar et al., “C-X-C motif chemokine 12/C-X-C chemokine receptor type 7 signaling regulates breast cancer growth and metastasis by modulating the tumor microenvironment,” Breast Cancer Research, vol. 16, no. 3, p. R54, 2014. View at: Publisher Site | Google Scholar
  32. L. Asnaghi, A. Tripathy, Q. Yang et al., “Targeting Notch signaling as a novel therapy for retinoblastoma,” Oncotarget, vol. 7, no. 43, pp. 70028–70044, 2016. View at: Publisher Site | Google Scholar
  33. H. Yu, L. Sun, J. Cui et al., “Three kinds of corneal host cells contribute differently to corneal neovascularization,” eBioMedicine, vol. 44, pp. 542–553, 2019. View at: Publisher Site | Google Scholar
  34. S. M. Weis and D. A. Cheresh, “Tumor angiogenesis: molecular pathways and therapeutic targets,” Nature Medicine, vol. 17, no. 11, pp. 1359–1370, 2011. View at: Publisher Site | Google Scholar
  35. R. D. Makin, I. Apicella, Y. Nagasaka et al., “RF/6A chorioretinal cells do not display key endothelial phenotypes,” Investigative Ophthalmology & Visual Science, vol. 59, no. 15, pp. 5795–5802, 2018. View at: Publisher Site | Google Scholar
  36. Z. Cao, R. Lis, M. Ginsberg et al., “Targeting of the pulmonary capillary vascular niche promotes lung alveolar repair and ameliorates fibrosis,” Nature Medicine, vol. 22, no. 2, pp. 154–162, 2016. View at: Publisher Site | Google Scholar
  37. Y. Liu, E. Carson-Walter, and K. A. Walter, “Chemokine receptor CXCR7 is a functional receptor for CXCL12 in brain endothelial cells,” PLoS One, vol. 9, no. 8, p. e103938, 2014. View at: Publisher Site | Google Scholar
  38. J. E. Totonchy, L. Clepper, K. G. Phillips, O. J. McCarty, and A. V. Moses, “CXCR7 expression disrupts endothelial cell homeostasis and causes ligand-dependent invasion,” Cell Adhesion & Migration, vol. 8, no. 2, pp. 165–176, 2014. View at: Publisher Site | Google Scholar
  39. M. Zhang, L. Qiu, Y. Zhang, D. Xu, J. C. Zheng, and L. Jiang, “CXCL12 enhances angiogenesis through CXCR7 activation in human umbilical vein endothelial cells,” Scientific Reports, vol. 7, no. 1, p. 8289, 2017. View at: Publisher Site | Google Scholar
  40. S. Guan and J. Zhou, “CXCR7 attenuates the TGF-β-induced endothelial-to-mesenchymal transition and pulmonary fibrosis,” Molecular BioSystems, vol. 13, no. 10, pp. 2116–2124, 2017. View at: Publisher Site | Google Scholar
  41. S. Rajagopal, J. Kim, S. Ahn et al., “arrestin- but not G protein-mediated signaling by the "decoy" receptor CXCR7,” Proceedings of the National Academy of Sciences, vol. 107, no. 2, pp. 628–632, 2010. View at: Publisher Site | Google Scholar
  42. L. Wang, X. Li, Y. Zhao et al., “Insights into the mechanism of CXCL12-mediated signaling in trophoblast functions and placental angiogenesis,” Acta Biochim Biophys Sin (Shanghai), vol. 47, no. 9, pp. 663–672, 2015. View at: Publisher Site | Google Scholar
  43. X. Li, X. Wang, Z. Li, Z. Zhang, and Y. Zhang, “Chemokine receptor 7 targets the vascular endothelial growth factor via the AKT/ERK pathway to regulate angiogenesis in colon cancer,” Cancer Medicine, vol. 8, no. 11, pp. 5327–5340, 2019. View at: Publisher Site | Google Scholar
  44. Z. Wang, C. H. Liu, S. Huang, and J. Chen, “Wnt signaling in vascular eye diseases,” Progress in Retinal and Eye Research, vol. 70, pp. 110–133, 2019. View at: Publisher Site | Google Scholar
  45. O. Burgy and M. Konigshoff, “The WNT signaling pathways in wound healing and fibrosis,” Matrix Biology, vol. 68-69, pp. 67–80, 2018. View at: Publisher Site | Google Scholar
  46. C. Zhang, X. Q. Liu, H. N. Sun et al., “Octreotide attenuates hepatic fibrosis and hepatic stellate cells proliferation and activation by inhibiting Wnt/β-catenin signaling pathway, c-Myc and cyclin D1,” International Immunopharmacology, vol. 63, pp. 183–190, 2018. View at: Publisher Site | Google Scholar
  47. W. R. Henderson Jr., E. Y. Chi, X. Ye et al., “Inhibition of Wnt/beta-catenin/CREB binding protein (CBP) signaling reverses pulmonary fibrosis,” Proceedings of the National Academy of Sciences of the United States of America, vol. 107, no. 32, pp. 14309–14314, 2010. View at: Publisher Site | Google Scholar
  48. J. H. Cheng, H. She, Y. P. Han et al., “Wnt antagonism inhibits hepatic stellate cell activation and liver fibrosis,” American Journal of Physiology Gastrointestinal and Liver Physiology, vol. 294, no. 1, pp. G39–G49, 2008. View at: Publisher Site | Google Scholar
  49. A. Aman and T. Piotrowski, “Wnt/β-Catenin and Fgf signaling control collective cell migration by restricting chemokine receptor expression,” Developmental Cell, vol. 15, no. 5, pp. 749–761, 2008. View at: Publisher Site | Google Scholar
  50. Z. Y. Song, F. Wang, S. X. Cui, and X. J. Qu, “Knockdown of CXCR4 inhibits CXCL12-induced angiogenesis in HUVECs through downregulation of the MAPK/ERK and PI3K/AKT and the Wnt/β-catenin pathways,” Cancer Investigation, vol. 36, no. 1, pp. 10–18, 2018. View at: Publisher Site | Google Scholar
  51. A. K. Singh, R. K. Arya, A. K. Trivedi et al., “Chemokine receptor trio: CXCR3, CXCR4 and CXCR7 crosstalk via CXCL11 and CXCL12,” Cytokine & Growth Factor Reviews, vol. 24, no. 1, pp. 41–49, 2013. View at: Publisher Site | Google Scholar

Copyright © 2020 MinQian Shen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views190
Downloads158
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.