BioMed Research International

BioMed Research International / 2020 / Article

Corrigendum | Open Access

Volume 2020 |Article ID 6942710 | https://doi.org/10.1155/2020/6942710

Bo Qiu, Ming Gong, Qi-Ting He, Pang-Hu Zhou, "Corrigendum to “Controlled Release of Interleukin-1 Receptor Antagonist from Hyaluronic Acid-Chitosan Microspheres Attenuates Interleukin-1β-Induced Inflammation and Apoptosis in Chondrocytes”", BioMed Research International, vol. 2020, Article ID 6942710, 2 pages, 2020. https://doi.org/10.1155/2020/6942710

Corrigendum to “Controlled Release of Interleukin-1 Receptor Antagonist from Hyaluronic Acid-Chitosan Microspheres Attenuates Interleukin-1β-Induced Inflammation and Apoptosis in Chondrocytes”

Received22 Jul 2020
Accepted20 Aug 2020
Published26 Sep 2020

In the article titled “Controlled Release of Interleukin-1 Receptor Antagonist from Hyaluronic Acid-Chitosan Microspheres Attenuates Interleukin-1β-Induced Inflammation and Apoptosis in Chondrocytes” [1], there were several errors including the inadvertent reuse of images from the authors’ earlier work, errors in the primers, and a lack of a reference to the authors’ related article from which they reused wording.

The authors raised to the attention of the journal an error in Figure 1, where the images were incorrectly reused from those in the article titled “Inhibition of interleukin-1beta-stimulated dedifferentiation of chondrocytes via controlled release of CrmA from hyaluronic acid-chitosan microspheres” in BMC Musculoskeletal Disorders [2]. The authors sincerely apologize for their carelessness and for this error. The figure should be corrected as follows:

The authors did not discuss their related work in Molecular Medicine Reports, from which they reused around 1000 words [3]. That article mainly exploited the controlled release of interleukin-1 receptor antagonist from chitosan microspheres without hyaluronic acid. In this study, the authors investigated the protective effect of interleukin-1 receptor antagonist on IL-1β-induced inflammation and apoptosis including MTT assay, NO2-, prostaglandin E2, B-cell lymphoma 2, Bcl-2-associated X protein, and caspase-3 expressions at mRNA or protein levels; the previous work only studied the effect of inhibition of matrix metalloproteinases induced by IL-1β.

The primers for Bcl-2, Bax, Caspase-3, and beta-actin are specific to the human genes (as checked using Primer BLAST and BLASTn), but the cells used in the study are Sprague-Dawley rat chondrocytes. The authors say the incorrect primer information was collected during the writing of the article. Table 1 should be corrected as follows:


GeneSenseSequence 5→3

Bcl-2FCTTCAGGGATGGGGTGAACT
RATCAAACAGAGGTCGCATGC
BaxFGAGACACCTGAGCTGACCTT
RCGTCTGCAAACATGTCAGCT
Caspase-3FCATGCACATCCTCACTCGTG
RCCCACTCCCAGTCATTCCTT
β-ActinFAGTGCTGTGGGTGTAGGTAC
RGCAAAGAGGGCAAGAACACA

The Western Blots in Figure 7 were adjusted for contrast and exposure, and the original images are available in the supplementary materials.

Supplementary Materials

Original images for the Western Blots in Figure 7 (BMRI 6290957 Figure 7 Western Blots.zip). (Supplementary materials)

References

  1. B. Qiu, M. Gong, Q.-T. He, and P.-H. Zhou, “Controlled release of interleukin-1 receptor antagonist from hyaluronic acid-chitosan microspheres attenuates interleukin-1β-induced inflammation and apoptosis in chondrocytes,” BioMed Research International, vol. 2016, Article ID 6290957, 12 pages, 2016. View at: Publisher Site | Google Scholar
  2. B.-l. Ma, P.-H. Zhou, T. Xie, L. Shi, B. Qiu, and Q. Wang, “Inhibition of interleukin-1beta-stimulated dedifferentiation of chondrocytes via controlled release of CrmA from hyaluronic acid-chitosan microspheres,” BMC Musculoskeletal Disorders, vol. 16, no. 1, p. 61, 2015. View at: Publisher Site | Google Scholar
  3. P. Zhou, B. Ma, L. Shi, T. Xie, and B. Qiu, “Inhibition of interleukin-1β-stimulated matrix metalloproteinases via the controlled release of interleukin-1Ra from chitosan microspheres in chondrocytes,” Molecular Medicine Reports, vol. 11, no. 1, pp. 555–560, 2015, https://www.spandidos-publications.com/10.3892/mmr.2014.2743. View at: Publisher Site | Google Scholar

Copyright © 2020 Bo Qiu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views36
Downloads27
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.