BioMed Research International / 2020 / Article / Tab 1

Research Article

Protective Effects of MitoTEMPO on Nonalcoholic Fatty Liver Disease via Regulating Myeloid-Derived Suppressor Cells and Inflammation in Mice

Table 1

Primer sequences for quantitative PCR.

GeneForward sequenceReverse sequence

MCP-1CACAACCACCTCAAGCACAAGGGAATACCATAACATCA
S100A8CTTCAAGACATCGTTTGAAAGGATTCTTGTAGAGGGCATGGT
S100A9TTAGCCTTGAAGAGCAAGAAGATGGAGCTCAGCTGATTGTCCTGGT
α-SMAACTGGGACGACATGGAAAAGGTTCAGTGGTGCCTCTGTCA
Collagen-ITGGCCTTGGAGGAAACTTTGCTTGGAAACCTTGTGGACCAG
TIMP1GATATGCCCACAAGTCCCAGAACCGCACACCCCACAGCCAGCACTAT
GAPDHAACAGGGTGGTGGACCTCATGGGATAGGGCCTCTCTTGCT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.