BioMed Research International / 2020 / Article / Tab 1

Research Article

Protective Effects of MitoTEMPO on Nonalcoholic Fatty Liver Disease via Regulating Myeloid-Derived Suppressor Cells and Inflammation in Mice

Table 1

Primer sequences for quantitative PCR.

GeneForward sequenceReverse sequence

MCP-1CACAACCACCTCAAGCACAAGGGAATACCATAACATCA
S100A8CTTCAAGACATCGTTTGAAAGGATTCTTGTAGAGGGCATGGT
S100A9TTAGCCTTGAAGAGCAAGAAGATGGAGCTCAGCTGATTGTCCTGGT
α-SMAACTGGGACGACATGGAAAAGGTTCAGTGGTGCCTCTGTCA
Collagen-ITGGCCTTGGAGGAAACTTTGCTTGGAAACCTTGTGGACCAG
TIMP1GATATGCCCACAAGTCCCAGAACCGCACACCCCACAGCCAGCACTAT
GAPDHAACAGGGTGGTGGACCTCATGGGATAGGGCCTCTCTTGCT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.