BioMed Research International

BioMed Research International / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 9329427 | 9 pages | https://doi.org/10.1155/2020/9329427

Protective Effects of MitoTEMPO on Nonalcoholic Fatty Liver Disease via Regulating Myeloid-Derived Suppressor Cells and Inflammation in Mice

Academic Editor: Stefano Gitto
Received10 Apr 2020
Revised02 Jul 2020
Accepted08 Jul 2020
Published30 Jul 2020

Abstract

MitoTEMPO, a mitochondrial antioxidant, has protective effects on liver-related diseases. However, the role of MitoTEMPO on nonalcoholic fatty liver disease (NAFLD) and its possible mechanisms are largely unknown. Here, we investigated the effects of MitoTEMPO on NAFLD using high fat diet- (HFD-) induced obese mice as animal models. MitoTEMPO was intraperitoneally injected into HFD mice. Liver morphological changes were observed by H&E and Oil Red O staining, and the frequency of MDSCs in peripheral blood was analyzed by flow cytometry. Moreover, real-time quantitative PCR, western blot, and immunohistochemistry were conducted to detect the mRNA and protein expressions in the liver tissues. The results showed that the hepatic steatosis in liver tissues of HFD mice injected with MitoTEMPO was significantly ameliorated. Additionally, MitoTEMPO reduced the frequency of CD11b+Gr-1+ MDSCs in peripheral circulation and decreased Gr-1+ cell accumulation in the livers. Further studies demonstrated that MitoTEMPO administration suppressed the mRNA and protein expressions of MDSC-associated proinflammatory mediators, such as monocyte chemoattractant protein-1 (MCP-1), S100 calcium-binding protein A8 (S100A8), and S100 calcium-binding protein A9 (S100A9). Our results suggest that MitoTEMPO appears to be a potential chemical compound affecting certain immune cells and further ameliorates inflammation in obese-associated NAFLD.

1. Introduction

Nonalcoholic fatty liver disease (NAFLD) is a common pandemic disease [1], which is affecting about 1/3 of the adult population in developed countries [2, 3]. According to disease severity, NAFLD could progress from steatosis to nonalcoholic steatohepatitis (NASH), fibrosis, and cirrhosis and finally develop to hepatocellular carcinoma (HCC) [4].

Accumulating evidence suggests that high fat diet- (HFD-) induced obesity contributes to the development of NAFLD [5, 6]. Moreover, NAFLD induced by obesity closely associates with immune dysfunction in the liver [7] and reflects a generalized chronic proinflammatory state [8, 9]. In the liver of obesity, the resident immune cells such as macrophages (Kupffer cells) and dendritic cells produce proinflammatory chemokines and cytokines, including monocyte chemoattractant protein-1 (MCP-1), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) in response to hepatocellular damage [1012]. MCP-1 further mediates the infiltration of chronic inflammatory cells such as macrophages and monocytes to the liver, resulting in amplification of inflammation in the liver microenvironment [11].

In addition to obesity, oxidative stress appears to be another risk factor aggravating NAFLD [13]. Therefore, antioxidant administration may be an effective way to prevent and ameliorate NAFLD. MitoTEMPO is a new cell permeable mitochondrial antioxidant with the functions of eliminating mitochondrial superoxide and preserving mitochondrial membrane potential [14]. It has been reported that MitoTEMPO could prevent N-nitrosodiethylamine-induced hepatocarcinogenesis in mice [15]. In addition, using a methionine-choline-deficient (MCD) diet-induced NAFLD model, Ma et al. found that MitoTEMPO blockaded reactive oxygen species (ROS) production, reversed NAFLD-induced intrahepatic CD4+ T lymphocyte decrease, and finally delayed NAFLD-promoted hepatocarcinogenesis [16], indicating the potential therapeutic effects of MitoTEMPO on NAFLD. However, the mechanism by which MitoTEMPO ameliorates NAFLD remains unclear. Besides, the pathogenesis is different between humans and the MCD-induced mouse NAFLD model. Therefore, it is necessary to explore the role of MitoTEMPO on immunomodulatory in high fat diet-induced NAFLD, which is much closer to human NAFLD pathogenesis.

Here, we explored immune cell MDSCs and inflammatory activities in obesity-associated NAFLD and further investigated the protective effect of MitoTEMPO on alleviating the severity of NAFLD via regulating immune response in the liver tissues.

2. Materials and Methods

2.1. Animal Experiments

Thirty male healthy C57BL/6J mice (5 weeks old, each weighing 18-22 g) were obtained from Shanghai Sippr-BK Laboratory Animal Co., Ltd. (Certification No. SCXK (Hu) 2013-0016) and housed in standard laboratory conditions. After feeding one week, mice were divided randomly into three groups: a normal diet group (lean, ), a high fat diet group (HFD, ), and a HFD+MitoTEMPO group (HFD+Mito, ). For drug administration, mice were intraperitoneally injected with 5 mg kg-1 MitoTEMPO (Sigma, USA) 5 times at the 6th, 8th, 10th, 12th, and 14th weeks [1719]. Mice were euthanized at the end of the 14th week. For weight detection, mice were weighed every week. For flow analysis, fresh whole blood samples were collected before mice were killed. For morphological evaluation and RNA and protein extraction, each mouse liver was sectioned and one-half was stored in liquid nitrogen immediately, while the other was fixed in 10% neutral buffered formalin. All experiment procedures were used according to the institutional animal care guidelines. The subject was authorized by the Medical Ethical Committee of the Second Affiliated Hospital of Jiaxing University.

2.2. Hematoxylin and Eosin Staining

To evaluate liver morphological change in each group, 10% neutral buffered formalin-fixed liver tissues were embedded into paraffin. Then, tissues were cut into 4 μm sections to conduct hematoxylin and eosin (H&E) (Servicebio, China) staining according to a standard method [20].

2.3. Oil Red O Staining

To detect lipid droplets in mice liver, frozen sections (10 μm) were stained with Oil Red O reagent (Servicebio, China) based on a published procedure [21]. All the staining results were observed under a light microscope (Zeiss, Germany).

2.4. Flow Cytometry

CD11b+Gr-1+ MDSCs in peripheral blood were analyzed by flow cytometry using FITC-labeled CD11b (BD Biosciences, USA) and PE-labeled Gr-1 (BD Biosciences, USA) fluorochrome-conjugated monoclonal antibodies. Briefly, 50 μL of fresh whole blood was incubated with 5 μL of each antibody in the dark for 20 min at 4°C. Then, 1 mL red blood cell lysis buffer was added to each incubated sample for 10 min. Cells were cleaned by PBS and resuspended in 300 μL PBS and finally tested by BD FACSCanto II machine with BD FACSDiva v6.1.3 software (BD Biosciences, USA).

2.5. RNA Extraction and Real-Time Quantitative PCR

Mice liver RNA was extracted using a TRIzol reagent (Invitrogen, USA) in light of the manufacturer’s procedure. RNA was quantified and reversed transcribed into a cDNA-utilizing RT Master Mix reagent (Takara, Japan). Then, PCR amplification was performed in an ABI StepOnePlus machine with SYBR fluorescent dye (Takara, Japan). The primer sequences of MCP-1, S100A8, S100A9, tissue inhibitor of matrix metalloproteinase 1 (TIMP1), Collagen-I, and alpha-smooth muscle actin (α-SMA) are listed in Table 1. Each mRNA level was normalized to the GAPDH gene expression. Relative mRNA expression was calculated by the 2-ΔΔCt method.


GeneForward sequenceReverse sequence

MCP-1CACAACCACCTCAAGCACAAGGGAATACCATAACATCA
S100A8CTTCAAGACATCGTTTGAAAGGATTCTTGTAGAGGGCATGGT
S100A9TTAGCCTTGAAGAGCAAGAAGATGGAGCTCAGCTGATTGTCCTGGT
α-SMAACTGGGACGACATGGAAAAGGTTCAGTGGTGCCTCTGTCA
Collagen-ITGGCCTTGGAGGAAACTTTGCTTGGAAACCTTGTGGACCAG
TIMP1GATATGCCCACAAGTCCCAGAACCGCACACCCCACAGCCAGCACTAT
GAPDHAACAGGGTGGTGGACCTCATGGGATAGGGCCTCTCTTGCT

2.6. Immunoblot Analysis

Mice liver lysates were extracted for immunoblot analysis as previously described [22]. For primary antibody incubation, α-SMA (1 : 500, Proteintech, USA), S100A8 (1 : 500, R&D, USA), S100A9 (1 : 1000, Abcam, UK), MCP-1 (1 : 1000, Abcam, UK), and β-actin (EarthOX, USA) were selected. For secondary antibody incubation, goat anti-mouse IgG (H+L) (Jackson ImmunoResearch, USA), goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch, USA), and rabbit anti-goat IgG-HRP (cwbiotech, China) were used.

2.7. Immunohistochemical Analysis

Mouse Gr-1 (Servicebio, China) protein expression in the paraffin-embedded sections of liver tissues was detected by immunohistochemistry. In brief, paraffin-embedded liver tissues were cut into 5 μm slides. After deparaffinizing and permeabilizing, antigen retrieval was conducted by EDTA buffer. 3% H2O2 was used to block endogenous peroxidase, and 10% goat serum was utilized to suppress the nonspecific bindings. Sections were incubated with diluted Gr-1 primary antibody overnight at 4°C. After washing in PBST, sections were incubated with HRP-labeled goat anti-rabbit IgG (Servicebio, China) for 1 h. The chromogenic reaction solution (DAKO, China) and counter-staining was performed with Harris hematoxylin for 3 min.

2.8. Statistical Analysis

The quantification analysis of immunoblot was conducted with ImageJ v1.8.0 software (National Institutes of Health, Germany). Data were analyzed using GraphPad Prism 6.0 software (GraphPad Software Inc., USA). All numerical calculations were presented as . Unpaired -test was used to evaluate the statistical difference between two groups. A value of was considered as the criterion of statistical significance.

3. Results

3.1. MitoTEMPO Did Not Reduce HFD-Induced Body Weight Gain

The average body weight of the HFD group significantly increased compared with that of the lean group from the third week () (Figure 1(a)). Notably, MitoTEMPO administration at the 6th, 8th, 10th, 12th, and 14th weeks did not effectively reduce the body weight compared with the HFD group () (Figure 1(a)). From the first week to the experimental end points, the average body weight gain in the HFD group () was significantly different compared with that in the lean group () (), whereas there was no statistical difference between the HFD+Mito () and the HFD group () () (Figure 1(b)).

3.2. MitoTEMPO Ameliorated HFD-Induced Hepatic Steatosis and Decreased Lipid Accumulations

Next, we evaluated the effects of MitoTEMPO on changes of high fat diet-induced hepatic steatosis and liver morphology. H&E staining revealed a manifesting appearance of hepatic steatosis, along with accumulation of vacuoles in the HFD group compared with the lean controls (Figure 2(a)). In addition, the number of infiltrated lymphocyte around portal vein areas in the liver tissues of the HFD group was also increased. Interestingly, MitoTEMPO-administered mice exhibited a remarkable reduction in vacuoles and lymphocyte infiltration compared with the HFD group (Figure 2(a)).

Oil Red O staining demonstrated that there were few lipid droplets in the lean group. In contrast, the HFD group mice showed severe and abundant lipid droplets in the hepatocytes. In contrast, MitoTEMPO administration markedly decreased the size and number of hepatic lipid droplets (Figure 2(b)).

3.3. MitoTEMPO Decreased HFD-Induced MDSCs in Peripheral Circulation and Liver Tissues

Next, we investigated the effect of MitoTEMPO on immune activity in peripheral circulation and local tissue of mice. Flow cytometry was used to explore the frequency of CD11b+Gr-1+ MDSCs in peripheral circulation of mice (Figures 3(a) and 3(b)). The average percentage of MDSCs in the peripheral blood of the HFD group () was approximately 3-folds more than that of the lean group () () (Figure 3(b)). In contrast, treatment with MitoTEMPO resulted in a 1.8-fold decrease in the percentage of CD11b+Gr-1+ MDSCs () compared with the HFD group () (Figure 3(b)).

To further explore the recruitment of MDSCs to the liver tissues, we conducted immunohistochemistry to detect the liver-infiltrated Gr-1+ cells. Consistent with the flow cytometry data, there is only a small number of Gr-1+ cells around the hepatic portal vein area in the liver tissues of the lean group (Figure 3(c)). The number of Gr-1+ cells was obviously increased in the liver tissues of the HFD group (Figure 3(c)). Compared with the HFD group, the HFD+Mito group showed a reduction in the number of liver-infiltrated Gr-1+ cells (Figure 3(c)).

3.4. MitoTEMPO Inhibited HFD-Induced Inflammatory Response

We further explored the effect of MitoTEMPO on inflammatory response in the liver of HFD mice. The mRNA level of the chemokine MCP-1, which may mediate the trafficking of MDSCs from circulation to liver tissues and induce chronic inflammation, was increased by 6.8-folds in the HFD group than in the lean group () (Figure 4(a)). However, treatment HFD mice with MitoTEMPO caused about a 3-fold decrease in MCP-1 mRNA expression () (Figure 4(a)). Moreover, MCP-1 protein expression showed a 3-fold increase in the HFD group compared with the lean group () and a 1.4-fold decrease in the HFD+Mito group () (Figure 4(b)). The mRNA level of C-C chemokine receptor 2 (CCR2), the receptor of MCP-1, increased by 2.3-folds in the HFD group () and decreased by 2.5-folds after MitoTEMPO treatment () (Figure S1).

The mRNA levels of S100A8 and S100A9, two MDSC-associated proinflammatory cytokines, were increased about 2.5-folds and 2.3-folds in the HFD group compared with the lean group () but dropped 5.9-folds and 5.2-folds after MitoTEMPO administration () (Figures 4(c) and 4(d)), respectively. Similarly, the protein levels of S100A8 and S100A9 were also increased about 3.1-folds and 1.6-folds in the HFD group compared with the lean group () and decreased 1.9-folds and 1.4-folds after MitoTEMPO administration () (Figures 4(e) and 4(f)), respectively.

3.5. MitoTEMPO Suppressed the Expression of Liver Fibrosis-Associated Genes

Finally, we examined the different expressions of fibrosis-associated genes among these groups. The mRNA levels of α-SMA, Collagen-I, and TIMP1 were moderately elevated in the liver of the HFD group compared with the lean group () (Figures 5(a)5(c)). Decreased mRNA levels of these genes were detected in the liver of the HFD group after MitoTEMPO treatment () (Figures 5(a)5(c)). The protein level of α-SMA was also increased in the HFD group () and decreased after MitoTEMPO treatment () (Figure 5(d)).

4. Discussion

In this study, we used a HFD-induced obese mouse model, which led to NAFLD-associated consequences, such as hepatic steatosis, chronic inflammation, and fibrosis [23]. We found an increased rate of CD11b+Gr-1+ MDSCs in the peripheral circulation of HFD-fed mice. Besides, the expression of chemokine MCP-1, which may mediate MDSC trafficking from peripheral blood to the liver [24, 25], was increased in the liver of HFD mice. Indeed, as we hypothesized, we found an increased accumulation of Gr-1+ cells in the liver of HFD-induced obese mice, which may further contribute to the immune dysregulation and chronic inflammatory response. The expressions of proinflammatory cytokines S100A8 and S100A9, which are secreted by a variety of cells including MDSCs [26], were also upregulated in the liver of obese mice. MitoTEMPO appeared to ameliorate obesity-induced NAFLD-associated symptoms via suppressing MDSC accumulation and inhibiting chronic inflammatory response.

Accumulating evidence has demonstrated that the development of NAFLD is related to adaptive immune responses. It is reported that in the formation of nonalcoholic fatty liver, Th17 cells were increased in the liver, and the Th17/resting Treg ratio was elevated both in the peripheral blood and the liver [27]. Sutti et al. observed increased hepatic CD4+ cells in a methionine-choline-deficient (MCD) diet-induced NASH mouse model [28]. However, a recent report pointed out that in NAFLD, the intrahepatic tumor-suppressive CD4+ T cells were selectively damaged, leading to the disorder of lipid metabolism [16]. The opposite results may be due to different methods for NAFLD model establishment. In this study, we established a NAFLD model using high fat diet-induced mice, which is more similar to the pathogenesis in humans.

MDSCs are a group of heterogeneous immune cells derived from the bone marrow with immunosuppressive function [29]. In mice, MDSCs are characterized with the expressions of cell surface markers CD11b and Gr-1 [30]. To date, studies on the phenotypes and functions of MDSCs in obesity-induced NAFLD are few [31, 32]. A previous study showed mice fed a high fat diet caused accumulation of monocytic-like MDSCs in the liver [33]. Our previous study showed in the peripheral circulation of obese individuals that the frequency of monocytic-like MDSCs was increased compared with that of healthy individuals [34]. In our present study, HFD induced an increased frequency of CD11b+Gr-1+ MDSCs in peripheral circulation and an accumulation of Gr-1+ cells in the liver.

It is reported that dysregulation of MDSCs is relevant with chronic inflammation [35]. A high level of proinflammatory chemokine MCP-1 and numbers of CCR2+ (MCP-1 receptor) MDSCs were present in obese mice bearing renal tumor [36]. In this study, we found increased expressions of MCP-1 and CCR2 in the liver of obese mice, which may accelerate the accumulation of MDSCs in the liver. In addition, the expressions of proinflammatory cytokines S100A8 and S100A9, which were considered as markers of human monocytic MDSCs [37], were increased in the liver tissues of obese mice as well. Moreover, S100A8 and S100A9 are not just markers of MDSCs; they can also be detected in neutrophils, monocytes, and early differentiation stages of macrophages [3840]. Thus, the accumulated MDSCs in the liver exert immunological functions in part by regulating local inflammation. The proinflammatory S100A8 and S100A9 proteins can regulate the accumulation of MDSCs, and in turn, MDSCs can also synthesize and secrete S100A8 and S100A9 proteins [27, 41]. Our data suggested that the increased S100A8 and S100A9 derived from MDSCs may in turn exacerbate chronic inflammatory reaction in the liver during NAFLD progression.

There are a few studies of MitoTEMPO, a mitochondrial antioxidant, in NAFLD. It has been reported that MitoTEMPO prevented lipopolysaccharide- (LPS-) induced inflammatory and liver injury in rats [42]. MitoTEMPO delays NAFLD-promoted HCC in an MCD diet-induced mouse NAFLD model [16]. Treatment with MitoTEMPO prevented insulin resistance and diastolic dysfunction in a HFD-induced diabetic mouse model [43]. The mechanism by which MitoTEMPO functions in these diseases is mostly via regulating oxidative stress. However, whether MitoTEMPO is involved in the regulation of immune activities in HFD-induced NAFLD has not been clarified. On the basis of our studies, we found MitoTEMPO treatment reduced infiltration of local inflammatory cells and alleviated hepatic steatosis in the liver of the HFD mice. These changes by MitoTEMPO may partially depend on reducing the local immunocyte accumulation and suppressing MDSC-associated proinflammatory factors in the liver, suggesting that MitoTEMPO may ameliorate NAFLD at least in part by regulating MDSC functions. However, whether MitoTEMPO directly or indirectly regulates MDSCs has not been clarified.

Extracellular matrix (ECM) proteins are generally produced by activated hepatic stellate cells (HSCs). The activation of HSCs is implicated in hepatic fibrogenesis by producing profibrogenic factors and by remodeling the ECM [44]. Our results showed that MitoTEMPO suppressed fibrosis-associated genes such as α-SMA, Collagen-I, and TIMP1 in HFD mice, indicating MitoTEMPO may have antifibrosis function.

5. Conclusion

In conclusion, our data suggest that dysregulation of immune activities exacerbates high fat diet-induced NAFLD. Antioxidant MitoTEMPO may provide novel pharmacological functions on immune and inflammation regulation in obese-induced NAFLD.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflict of interest.

Authors’ Contributions

BY designed the study and revised the manuscript. WJY carried out the majority of the experiments and data analysis and wrote the manuscript. ZL and MJF performed partial experiments. YXJ and FCL provided technical support for partial experiments. All listed authors approved the final version of the manuscript.

Acknowledgments

This work was supported by the Natural Science Foundation of Zhejiang Province (grant no. LY16H070007), Health Bureau of Zhejiang Province (grant nos. 2016KYB292 and 2020KY952), and Science and Technology Bureau of Jiaxing (grant no. 2018AY32007).

Supplementary Materials

Figure S1: effect of MitoTEMPO on the mRNA expression of CCR2 in the liver tissues of mice. qRT-PCR assay was conducted to measure the CCR2 mRNA level. Data are represented as the . HFD vs. lean: , HFD+Mito vs. HFD: #, unpaired -test. (Supplementary Materials)

References

  1. Z. M. Younossi, A. B. Koenig, D. Abdelatif, Y. Fazel, L. Henry, and M. Wymer, “Global epidemiology of nonalcoholic fatty liver disease-meta-analytic assessment of prevalence, incidence, and outcomes,” Hepatology, vol. 64, no. 1, pp. 73–84, 2016. View at: Publisher Site | Google Scholar
  2. M. Blachier, H. Leleu, M. Peck-Radosavljevic, D. C. Valla, and F. Roudot-Thoraval, “The burden of liver disease in Europe: a review of available epidemiological data,” Journal of Hepatology, vol. 58, no. 3, pp. 593–608, 2013. View at: Publisher Site | Google Scholar
  3. G. Firneisz, “Non-alcoholic fatty liver disease and type 2 diabetes mellitus: the liver disease of our age?” World Journal of Gastroenterology, vol. 20, no. 27, pp. 9072–9089, 2014. View at: Google Scholar
  4. M. M. Yeh and E. M. Brunt, “Pathological features of fatty liver disease,” Gastroenterology, vol. 147, no. 4, pp. 754–764, 2014. View at: Publisher Site | Google Scholar
  5. Y. Chang, H. S. Jung, J. Cho et al., “Metabolically healthy obesity and the development of nonalcoholic fatty liver disease,” The American Journal of Gastroenterology, vol. 111, no. 8, pp. 1133–1140, 2016. View at: Publisher Site | Google Scholar
  6. G. Targher and C. D. Byrne, “Obesity: metabolically healthy obesity and NAFLD,” Nature Reviews. Gastroenterology & Hepatology, vol. 13, no. 8, pp. 442–444, 2016. View at: Publisher Site | Google Scholar
  7. A. Mouralidarane, J. Soeda, C. Visconti-Pugmire et al., “Maternal obesity programs offspring nonalcoholic fatty liver disease by innate immune dysfunction in mice,” Hepatology, vol. 58, no. 1, pp. 128–138, 2013. View at: Publisher Site | Google Scholar
  8. E. Maury and S. M. Brichard, “Adipokine dysregulation, adipose tissue inflammation and metabolic syndrome,” Molecular and Cellular Endocrinology, vol. 314, no. 1, pp. 1–16, 2010. View at: Publisher Site | Google Scholar
  9. A. R. Saltiel and J. M. Olefsky, “Inflammatory mechanisms linking obesity and metabolic disease,” The Journal of Clinical Investigation, vol. 127, no. 1, pp. 1–4, 2017. View at: Publisher Site | Google Scholar
  10. W. Liang, J. H. Lindeman, A. L. Menke et al., “Metabolically induced liver inflammation leads to NASH and differs from LPS- or IL-1β-induced chronic inflammation,” Laboratory Investigation, vol. 94, no. 5, pp. 491–502, 2014. View at: Publisher Site | Google Scholar
  11. F. Marra and F. Tacke, “Roles for chemokines in liver disease,” Gastroenterology, vol. 147, no. 3, pp. 577–594.e1, 2014. View at: Publisher Site | Google Scholar
  12. W. Z. Mehal, “The inflammasome in liver injury and non-alcoholic fatty liver disease,” Digestive Diseases, vol. 32, no. 5, pp. 507–515, 2014. View at: Publisher Site | Google Scholar
  13. C. Garcia-Ruiz and J. C. Fernandez-Checa, “Mitochondrial oxidative stress and antioxidants balance in fatty liver disease,” Hepatology Communications, vol. 2, no. 12, pp. 1425–1439, 2018. View at: Publisher Site | Google Scholar
  14. H. L. Liang, F. Sedlic, Z. Bosnjak, and V. Nilakantan, “SOD1 and MitoTEMPO partially prevent mitochondrial permeability transition pore opening, necrosis, and mitochondrial apoptosis after ATP depletion recovery,” Free Radical Biology & Medicine, vol. 49, no. 10, pp. 1550–1560, 2010. View at: Publisher Site | Google Scholar
  15. S. Shetty, R. Kumar, and S. Bharati, “Mito-TEMPO, a mitochondria-targeted antioxidant, prevents N-nitrosodiethylamine-induced hepatocarcinogenesis in mice,” Free Radical Biology and Medicine, vol. 136, pp. 76–86, 2019. View at: Publisher Site | Google Scholar
  16. C. Ma, A. H. Kesarwala, T. Eggert et al., “NAFLD causes selective CD4+ T lymphocyte loss and promotes hepatocarcinogenesis,” Nature, vol. 531, no. 7593, pp. 253–257, 2016. View at: Publisher Site | Google Scholar
  17. L. Zhang, Y. Zhang, X. Chang, and X. Zhang, “Imbalance in mitochondrial dynamics induced by low PGC-1α expression contributes to hepatocyte EMT and liver fibrosis,” Cell Death & Disease, vol. 11, no. 4, 2020. View at: Publisher Site | Google Scholar
  18. H. J. Ku, J. H. Park, S. H. Kim, and J. W. Park, “Isocitrate dehydrogenase 2 deficiency exacerbates dermis damage by ultraviolet-B via ΔNp63 downregulation,” Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, vol. 1864, no. 4, pp. 1138–1147, 2018. View at: Publisher Site | Google Scholar
  19. M. Ogura, T. Inoue, J. Yamaki, M. K. Homma, T. Kurosaki, and Y. Homma, “Mitochondrial reactive oxygen species suppress humoral immune response through reduction of CD19 expression in B cells in mice,” European Journal of Immunology, vol. 47, no. 2, pp. 406–418, 2017. View at: Publisher Site | Google Scholar
  20. R. D. Cardiff, C. H. Miller, and R. J. Munn, “Manual hematoxylin and eosin staining of mouse tissue sections,” Cold Spring Harbor Protocols, vol. 2014, no. 6, pp. 655–658, 2014. View at: Publisher Site | Google Scholar
  21. A. Mehlem, C. E. Hagberg, L. Muhl, U. Eriksson, and A. Falkevall, “Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease,” Nature Protocols, vol. 8, no. 6, pp. 1149–1154, 2013. View at: Publisher Site | Google Scholar
  22. J. Y. Wu, M. Li, L. J. Cao et al., “Protease Omi cleaving Hax-1 protein contributes to OGD/R-induced mitochondrial damage in neuroblastoma N2a cells and cerebral injury in MCAO mice,” Acta Pharmacologica Sinica, vol. 36, no. 9, pp. 1043–1052, 2015. View at: Publisher Site | Google Scholar
  23. G. Kanuri and I. Bergheim, “In vitro and in vivo models of non-alcoholic fatty liver disease (NAFLD),” International Journal of Molecular Sciences, vol. 14, no. 6, pp. 11963–11980, 2013. View at: Publisher Site | Google Scholar
  24. B. Huang, Z. Lei, J. Zhao et al., “CCL2/CCR2 pathway mediates recruitment of myeloid suppressor cells to cancers,” Cancer Letters, vol. 252, no. 1, pp. 86–92, 2007. View at: Publisher Site | Google Scholar
  25. A. R. Jackson, V. L. Hegde, P. S. Nagarkatti, and M. Nagarkatti, “Characterization of endocannabinoid-mediated induction of myeloid-derived suppressor cells involving mast cells and MCP-1,” Journal of Leukocyte Biology, vol. 95, no. 4, pp. 609–619, 2014. View at: Publisher Site | Google Scholar
  26. P. Sinha, C. Okoro, D. Foell, H. H. Freeze, S. Ostrand-Rosenberg, and G. Srikrishna, “Proinflammatory S100 proteins regulate the accumulation of myeloid-derived suppressor cells,” The Journal of Immunology, vol. 181, no. 7, pp. 4666–4675, 2008. View at: Publisher Site | Google Scholar
  27. M. Rau, A.-K. Schilling, J. Meertens et al., “Progression from nonalcoholic fatty liver to nonalcoholic steatohepatitis is marked by a higher frequency of th17 cells in the liver and an increased Th17/resting regulatory T cell ratio in peripheral blood and in the liver,” The Journal of Immunology, vol. 196, no. 1, pp. 97–105, 2016. View at: Publisher Site | Google Scholar
  28. S. Sutti, A. Jindal, I. Locatelli et al., “Adaptive immune responses triggered by oxidative stress contribute to hepatic inflammation in NASH,” Hepatology, vol. 59, no. 3, pp. 886–897, 2014. View at: Publisher Site | Google Scholar
  29. T. F. Greten, M. P. Manns, and F. Korangy, “Myeloid derived suppressor cells in human diseases,” International Immunopharmacology, vol. 11, no. 7, pp. 802–807, 2011. View at: Publisher Site | Google Scholar
  30. P. Filipazzi, V. Huber, and L. Rivoltini, “Phenotype, function and clinical implications of myeloid-derived suppressor cells in cancer patients,” Cancer Immunology, Immunotherapy, vol. 61, no. 2, pp. 255–263, 2012. View at: Publisher Site | Google Scholar
  31. H. Tsunashima, K. Tsuneyama, Y. Moritoki, M. Hara, and K. Kikuchi, “Accumulated myeloid-derived suppressor cells demonstrate distinct phenotypes and functions in two non-alcoholic steatohepatitis mouse models,” Hepatobiliary Surgery and Nutrition, vol. 4, no. 5, pp. 313–319, 2015. View at: Publisher Site | Google Scholar
  32. S. Ostrand-Rosenberg, “Myeloid derived-suppressor cells: their role in cancer and obesity,” Current Opinion in Immunology, vol. 51, pp. 68–75, 2018. View at: Publisher Site | Google Scholar
  33. Z. B. Deng, Y. Liu, C. Liu et al., “Immature myeloid cells induced by a high-fat diet contribute to liver inflammation,” Hepatology, vol. 50, no. 5, pp. 1412–1420, 2009. View at: Publisher Site | Google Scholar
  34. Y. Bao, J. Mo, L. Ruan, and G. Li, “Increased monocytic CD14+ HLADRlow/- myeloid-derived suppressor cells in obesity,” Molecular Medicine Reports, vol. 11, no. 3, pp. 2322–2328, 2015. View at: Publisher Site | Google Scholar
  35. C. Meyer, A. Sevko, M. Ramacher et al., “Chronic inflammation promotes myeloid-derived suppressor cell activation blocking antitumor immunity in transgenic mouse melanoma model,” Proceedings of the National Academy of Sciences of the United States of America, vol. 108, no. 41, pp. 17111–17116, 2011. View at: Publisher Site | Google Scholar
  36. M. Hale, F. Itani, C. M. Buchta, G. Wald, M. Bing, and L. A. Norian, “Obesity triggers enhanced MDSC accumulation in murine renal tumors via elevated local production of CCL2,” PLoS One, vol. 10, no. 3, article e118784, 2015. View at: Publisher Site | Google Scholar
  37. F. Zhao, B. Hoechst, A. Duffy et al., “S100A9 a new marker for monocytic human myeloid-derived suppressor cells,” Immunology, vol. 136, no. 2, pp. 176–183, 2012. View at: Publisher Site | Google Scholar
  38. K. Odink, N. Cerletti, J. Brüggen et al., “Two calcium-binding proteins in infiltrate macrophages of rheumatoid arthritis,” Nature, vol. 330, no. 6143, pp. 80–82, 1987. View at: Publisher Site | Google Scholar
  39. G. Zwadlo, J. Bruggen, G. Gerhards, R. Schlegel, and C. Sorg, “Two calcium-binding proteins associated with specific stages of myeloid cell differentiation are expressed by subsets of macrophages in inflammatory tissues,” Clinical and Experimental Immunology, vol. 72, no. 3, pp. 510–515, 1988. View at: Google Scholar
  40. M. Pruenster, T. Vogl, J. Roth, and M. Sperandio, “S100A8/A9: from basic science to clinical application,” Pharmacology & Therapeutics, vol. 167, pp. 120–131, 2016. View at: Publisher Site | Google Scholar
  41. P. Cheng, C. A. Corzo, N. Luetteke et al., “Inhibition of dendritic cell differentiation and accumulation of myeloid-derived suppressor cells in cancer is regulated by S100A9 protein,” The Journal of Experimental Medicine, vol. 205, no. 10, pp. 2235–2249, 2008. View at: Publisher Site | Google Scholar
  42. A. Weidinger, A. Müllebner, J. Paier-Pourani et al., “Vicious inducible nitric oxide synthase-mitochondrial reactive oxygen species cycle accelerates inflammatory response and causes liver injury in rats,” Antioxidants & Redox Signaling, vol. 22, no. 7, pp. 572–586, 2015. View at: Publisher Site | Google Scholar
  43. E. M. Jeong, J. Chung, H. Liu et al., “Role of mitochondrial oxidative stress in glucose tolerance, insulin resistance, and cardiac diastolic dysfunction,” Journal of the American Heart Association, vol. 5, no. 5, 2016. View at: Publisher Site | Google Scholar
  44. C. Yin, K. J. Evason, K. Asahina, and D. Y. R. Stainier, “Hepatic stellate cells in liver development, regeneration, and cancer,” The Journal of Clinical Investigation, vol. 123, no. 5, pp. 1902–1910, 2013. View at: Publisher Site | Google Scholar

Copyright © 2020 Jiayuan Wu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

70 Views | 21 Downloads | 0 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.