Biochemistry Research International

Biochemistry Research International / 2013 / Article

Erratum | Open Access

Volume 2013 |Article ID 347567 |

Nataša Nikolić, Magdalena Rhedin, Arild C. Rustan, Len Storlien, G. Hege Thoresen, Maria Strömstedt, "Erratum to “Overexpression of PGC-1 Increases Fatty Acid Oxidative Capacity of Human Skeletal Muscle Cells”", Biochemistry Research International, vol. 2013, Article ID 347567, 2 pages, 2013.

Erratum to “Overexpression of PGC-1 Increases Fatty Acid Oxidative Capacity of Human Skeletal Muscle Cells”

Received03 Mar 2013
Accepted07 Mar 2013
Published26 Mar 2013

Unfortunately there was a mistake in Figure 7. The primer used for mRNA expression was actually MYH1, which regulates expression of MHC type IIx muscle fibers and not MHC type I as stated in the figure. However, we have repeated the experiment with the correct primer MYH7 (acc_no. NM000257.2, F: CTCTGCACAGGGAAAATCTGAA, R: CCCCTGGAGACTTTGTCTCATT), and the new Figure 7 is shown here. This makes no difference to the conclusions of the paper. There was no significant change in mRNA of MHCI (MYH7), neither was the MHCI/MHCIIa mRNA ratio significantly increased. However, the last sentence in Section 3 (page 7) should be slightly changed: “Thus, the MHCI/MHCIIa mRNA ratio was approximately doubled in cells overexpressing PGC-1   compared to control cells infected with empty vector (from 4.5 to 9.2, resp.).”

Copyright © 2013 Nataša Nikolić et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.