Evidence-Based Complementary and Alternative Medicine / 2019 / Article / Tab 4

Research Article

Cardioprotective Effect of Danhong Injection against Myocardial Infarction in Rats Is Critically Contributed by MicroRNAs

Table 4

Primers sequences used for real-time PCR.

mRNA (rat)Sequence

TNF-αForward5′GAAGAGAACCTGGGAGTAGATAAGG3′
Reverse5′GTCGTAGCAAACCACCAAGC3′
IL-1βForward5′TCGTTGCTTGTCTCTCCTTG3′
Reverse5′AAAAATGCCTCGTGCTGTCT3′
Bcl-2Forward5′ACAGCCAGGAGAAATCAAACA3′
Reverse5′GGTGGACAACATCGCTCTG3′
Caspase-3Forward5′AGTTTCGGCTTTCCAGTCAG3′
Reverse5′AGTTGGCATGGTAGCCCTTG3′
GAPDHForward5′GGAGCAGTTTTGTGTGTGTGA3′
Reverse5′CTGGAAGATGGTGATGGGTT3′

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.