Gastroenterology Research and Practice

Gastroenterology Research and Practice / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 3956838 | https://doi.org/10.1155/2020/3956838

Sinem Oktem-Okullu, Zehra Cekic-Kipritci, Elif Kilic, Nogayhan Seymen, Nesteren Mansur-Ozen, Ugur Sezerman, Yesim Gurol, "Analysis of Correlation between the Seven Important Helicobacter pylori (H. pylori) Virulence Factors and Drug Resistance in Patients with Gastritis", Gastroenterology Research and Practice, vol. 2020, Article ID 3956838, 7 pages, 2020. https://doi.org/10.1155/2020/3956838

Analysis of Correlation between the Seven Important Helicobacter pylori (H. pylori) Virulence Factors and Drug Resistance in Patients with Gastritis

Academic Editor: Amosy M'Koma
Received11 Jul 2020
Revised07 Aug 2020
Accepted08 Aug 2020
Published29 Aug 2020

Abstract

The aim of this study is to evaluate the association between seven important H. pylori virulence factors and antibiotic resistance in patients with gastritis. H. pylori strains isolated from 33 patients with gastritis were examined. Antimicrobial susceptibilities were tested by GenoType® HelicoDR (Hain Life Science, Germany) test kit and RT-PCR. The virulence-factors were determined using conventional PCR. 39% of patients were resistant for clarithromycin and 27% of patients were resistant for fluoroquinolone. 15% of patients were resistant to both clarithromycin and fluoroquinolone. The H. pylori vacA m1/s2 genotype was the most frequent allelic combination. Patients were possessed the vacA s1, m1 (6.1%); s1, m2 (6.1%); s2, m1 (15.1%); and s2, m2 (3.0%) genotypes. 94% of patients with gastritis were positive for H. pylori napA gene. Also, there were no dupA gene-positive gastritis patients. There was no significant correlation between the vacA, cagA, oipA, hpaA, babA, napA, dupA, ureA, ureB virulence genes, clarithromycin, and fluoroquinolone resistance. Herein, we report that the relationship between the H. pylori napA gene and gastritis. Although we found a correlation between H. pylori virulence factor and clinical outcome, there is a need for further studies to enlighten the relation between H. pylori virulence genes and antibiotic resistance.

1. Introduction

Helicobacter pylori (H. pylori) is one of the most important human pathogenic microorganisms with its spiral shape that can endure asymptomatic or can cause several gastrointestinal diseases, ranging in acute and chronic gastritis, gastric and duodenal ulcers, gastric adenocarcinoma, and MALT (mucosa-associated lymphoid tissue) lymphoma [1]. The prevalence rate of H. pylori differs between the developed countries that have low prevalence and developing countries that have a high prevalence. H. pylori infection is usually gained during childhood and if it is not treated, it will continue to lifespan [2].

For the treatment of H. pylori, multiple antibiotic regimens have been evaluated including triple therapy, sequential therapy, quadruple therapy, and levofloxacin-based triple therapy. Antimicrobial susceptibility testing is the best approach to choosing the treatment therapy method. Besides this eradication rates, previous antibiotic exposure and regional antibiotic-resistance patterns should be considered for successful treatment.

In the first-line treatment, a triple therapy regimen is applied including usually a proton pump inhibitor (PPI) combined with clarithromycin and amoxicillin or metronidazole as an antibiotic [3]. Clarithromycin-based therapies were considered to be the best tolerated and safest therapies; However, the efficacy of these triple regimens has decreased due to bacterial resistance to antibiotics [4]. To overcome antimicrobial resistance seen in H. pylori treatment, new antibiotics and different drug combinations have been evaluated, using fluoroquinolones, rifabutin, furazolidone, and azithromycin 14-day levofloxacin or 5-day levofloxacin concomitant therapy could be an alternative fluoroquinolone therapy regimes where fluoroquinolone resistance is rare [5].

As a highly heterogeneous bacterium virulence of H. pylori varies geographically. Due to the research in the literature, it is clearly explained that H. pylori virulence factors have a very important effect on both bacterial pathogenicity and treatment outcome [6].

Vacuolating cytotoxin gene A (vacA), cytotoxin-associated gene A (cagA), outer inflammatory protein A (oipA), the blood group antigen-binding adhesin gene A (babA), neutrophil-activating protein A (napA), the putative neuraminyllactose-binding hemagglutinin homolog (hpaA), duodenal ulcer promoting gene A (dupA), urease A (ureA), and urease B (ureB) are the most important virulence genes of this bacterium that take the role in the invasion, adhesion, and colonization of H. pylori strains in gastric epithelial cells [7, 8].

The present study is aimed at assessing the relationship between clarithromycin and fluoroquinolone resistance with the seven important H. pylori virulence factor status.

2. Material and Methods

2.1. Ethical Approval

A written informed consent about the participation in this study was provided to each patient included in this study. The ethical committee of Yeditepe University approved this study.

2.2. Patient Selection

33 patients were included in the study who underwent endoscopy because of gastroduodenal diseases at the Gastroenterology Department of Yeditepe University, in Istanbul, Turkey. They were selected due to the who fulfilled the obtaining expulsion criteria.

2.3. Gastric Biopsy Specimens

Gastric biopsy specimens of the patients were taken from the antrum part of the stomach. Freshly taken biopsy specimens were placed into the Nucliswab® Solution (Salubris, USA) and kept at +4°C for overnight, then put at –80°C deep freezer until DNA isolation.

2.4. DNA Isolation

To study virulence factors of H. pylori, DNA was extracted by using QIAamp DNA mini DNA isolation kit (Qiagen, Hilden, Germany)) following the manufacturer’s description. All DNA samples were quantified using NanoDrop (ND-2000, THERMO) and maintained in –80°C deep freezer.

2.5. Antimicrobial Susceptibility Testing

Fluoroquinolone and clarithromycin resistance were tested by using GenoType® HelicoDR(Hain Life Science, Germany) test kit as described by the following the manufacturer’s description. The point mutations related to the clarithromycin resistance was detected by using a real-time PCR- (RT-PCR-) based hybridization assay. H. pylori 23SrRNA gene-specific primers with probes shown in Table 1 were used, and melting curve analysis was done. For the RT-PCR experiments and hybridization reactions, LightCycler thermocycler (Roche Diagnostics, Neuilly Sur Seine, France) was used.


Virulence factorPrimer namePrimer sequences (5–3)Product size (bp)Reference

23SrRNAHPYS/FTATGGTACCCGCATGATATTCCCATTAGCAGT267[9, 10]
HPYA/RTAAGAGCTCAGGTTAAGAGGATGCGTCAGTC[9, 10]
Sensor probe 5 labeled with LC-red 640GGCAAGACGGAAAGACC2504 to 2520[9, 10]
Anchor probe 3 labeled with fluoresceinTGTAGTGGAGGTGAAAATTCCTCCTACCC2473 to 2501[9, 10]

Real-time PCR reactions were done by using glass capillary tubes with 20 μl volume. 3 μl template DNA, 0.4 μl forward and reverse primers (20 μM each), 0.2 μl sensor and anchor probes (20 μM each), and 2 μl of FastStart DNA Master Hybridization Probes (Roche Diagnostics) were included into each tube. The RT-PCR reaction conditions were 95°C for 10 min as an initial denaturation, 95°C for 0 s for 50 amplification cycles, 60°C for 10 s as annealing, and 72°C for 17 s as an extension. Also, a melting curve step was added to the reaction composed of 95°C for 0 s, 45°C for 30 s to cool (temperature transition rate of 20°C/s), and in the final step, a slow increase in the temperature to 85°C at a rate of 0.1°C/s with the continuous acquisition of fluorescence decrease [11].

2.6. Virulence Factor Testing

Extracted patients’ DNA samples were used as a template DNA in PCR to detect virulence factors of H. pylori which are vacA, cagA, oipA, hpaA, babA, napA, dupA, ureA, and ureB genes. The primer sequences and the size of PCR products used in this study were summarized in Table 2. Genomic DNA of H. pylori isolated from the H. pylori G27 strain was used as a positive control DNA for PCR assay. Negative control was used by replacing templated DNA with distilled water. Each PCR amplification was carried out in a volume of 15 μl containing 3 μl of 5X Dye Hot Start Master Mix (GeneMark Bio, TAİWAN), 10 μM of forward and reverse primers, and 3 μl of templated DNA. The remaining volume was adjusted with distilled water Different amplification mixtures were prepared using primer pairs belonging to each virulence factor. Each PCR set was included in the negative and positive controls. Conventional PCR reaction conditions were initial denaturation 3 minutes at 95°C, 40 cycles of denaturation 30 seconds at 95°C, annealing 45 second at 60°C and extension 1 minute at 72°C, and final extension 5 minutes at 72°C. Only for oipA gene, annealing temperature was used as 59.2°C instead of 60°C. PCR amplifications were performed in a thermal cycler (Bio-Rad T100).


Virulence factorPrimer namePrimer sequences (5–3)Product size (bp)Reference

ureAure A/FTGATGGGACCAACTCGTAACCGT244[12]
ure A/RCGCAATGTCTAAGCGTTTGCCGAA
ureBure B/FAGTAGCCCGGTGAACACAACATCCT645[12]
ure B/RATGCCTTTGTCATAAGCCGCTTGG
napAnap A/FGAATGTGAAAGGCACCGATT304[12]
nap A/RATCGTCCGCATAAGTTACGG
babAbab A/FAATCCAAAAAGGAGAAAAAGTATGAAA832/601[12]
bab A/RTGTTAGTGATTTCGGTGTAGGACA
dupAdup A/FTGAGCGTGGTAGCTCTTGAC584[12]
dup A/RGAGCGCGTTAGCGATATAGG
hpaAhpa A/FTAGTGGGATGCAGCCCGCATATTA534[12]
hpa A/RCGCTATGGCTTGAATGGGTGGTTT
oipAoip A/FCATTAAGCGGTGGTTTTGTG1093This study
oip A/RAGCCAACTAAAGAGCGGTAA
cagAcagA/FGTTGATAACGCTGTCGCTTC350[13]
cagA/RGGGTTGTATGATATTTTCCATAA
VacA s1/s2VAI/FATGGAAATACAACAAACACAC259/286[14]
VAI/RCTGCTTGAATGCGCCAAAC
VacA m1/m2VAG/FCAATCTGTCCAATCAAGCGAG567/642[14]
VAG/RGCGTCAAAATAATTCCAAGG
16S rRNArRNA/FTAAGAGATCAGCCTATGTCC534[15]
rRNA/RTCCCACGCTTTAAGCGCAAT

7 μl of PCR products was loaded to agarose gel electrophoresis in 1% agarose gel in 1X Tris Acetic Acid Edta (TAE) buffer at 100 V for 60 min and stained with ethidium bromide. Then, the agarose gels were visualized by the gel imaging system (ChemiDoc™ MP imaging system, Bio-Rad).

2.7. Statistical and Bioinformatic Analyses

Our data consists of the presence of virulence factors (cagA, ureA, ureB, napA, hpaA, oipA, and dupA) and drug resistances (clarithromycin resistance and fluoroquinolone resistance), all binary values depicting absence/presence, WT/MUT, and resistant/susceptible, respectively. There is a total of 33 H. pylori-positive samples with a mean age of 37.3. Since none of the patients have dupA, that virulence factor was excluded from the study as there will be no meaningful comparison.

For the creation of the correlation tables, we have used Pearson’s correlation and performed all analysis in Python, scipy v1.0.0. To observe meaningful differences in outcomes, we performed two-proportion -test. Two-proportion -test was the test of choice here as the sample size is quite small and this test better reflects proportional differences in different sample groups. An alpha value less than or equal to 0.05 was considered significant for both the Pearson and two-proportion -tests.

Our initial tests showed no significant difference in the occurrence of the H. pylori virulence factors between clarithromycin and fluoroquinolone susceptible/resistance samples. We, therefore, tried a combinatorial approach where we performed the same tests with coupled virulence factors. If both given virulence factors were not present in a patient—for example, both VacA m1 and OipA are absent—then, the new combined feature VacA m1/OipA will also be absent. However, if any or both are present in that patient, then the new feature will be present. In addition to expanding our search space, this also enabled us to check whether these virulence factors occur in tandem or not.

After two proportions of -tests, we have observed a significant difference in combined VacA m1 and VacA s2 ( value = 0.03) between patients susceptible/resistant to clarithromycin. While VacA_m1/VacA_s2 is present in 55% (11/20) of susceptible patients, it is present in only 23.1% (3/13) of resistant patients.

3. Results

3.1. Antibiotic Resistance

Due to the antibiotic resistance test results, 39% of patients were resistant for clarithromycin and 27% of patients were resistant for fluoroquinolone. 15% of patients were resistant to both clarithromycin and fluoroquinolone. Resistance rates were shown in Table 3.


Drug resistancePatient number and percentage, (%)

Clarithromycin resistance13 (39)
Fluoroquinolone resistance9 (27)
Clarithromycin and fluoroquinolone resistance5 (15)

3.2. Association between Virulence Genotypes and Gastritis

According to the conventional PCR results which were performed using 33 patients with gastritis, virulence gene distributions are shown in Table 4. H. pylori ureA and ureB gene amplification were found in 73% and 24% of all isolates, respectively. H. pylori vacA s2/m1 (15.1%) genotypes were detected as the most frequent allelic combination of the vacA gene among gastritis patients followed by vacA s1, m1 (6.1%); s1, m2 (6.1%); and s2, m2 (3.0%) genotypes. 94% of patients with gastritis were positive for H. pylori napA gene. Additionally, no gastritis patients were positive for dupA gene.


Virulence genesStatusGastritis, (%)

cagAAbsent22 (67)
Present11 (33)
vacA m1Absent24 (73)
Present9 (27)
vacA m2Absent30 (91)
Present3 (9)
vacA s1Absent30 (91)
Present3 (9)
vacA s2Absent23 (70)
Present10 (30)
ureAAbsent9 (27)
Present24 (73)
ureBAbsent25 (76)
Present8 (24)
napAAbsent2 (6)
Present31 (94)
dupAAbsent33 (100)
Present0 (0)
oipAAbsent32 (97)
Present1 (3)
hpaAAbsent22 (67)
Present11 (33)

3.3. Correlation between Antibiotic Resistance and Virulence Factor Genotype

The relation between the clarithromycin and fluoroquinolone resistance with H. pylori virulence genes was evaluated (Tables 5 and 6). Due to our data results, there was no significant correlation between the vacA, cagA, oipA, hpaA, babA, napA, dupA, ureA, ureB virulence genes, and clarithromycin, and fluoroquinolone resistance. However, our data showed that there was a significant relationship between vac A s1/m2 allelic variation and clarithromycin susceptibility ( value < 0.05).


Virulence genesStatusSusceptible, (%)Resistant, (%) value

oipAAbsent20 (100)12 (92.31)0.9
Present0 (0)1 (7.69)
hpaAAbsent14 (70)8 (61.54)0.69
Present6 (30)5 (38.46)
napAAbsent1 (5)1 (7.69)0.38
Present19 (95)12 (92.31)
ureBAbsent15 (75)10 (76.92)0.45
Present5 (25)3 (23.08)
ureAAbsent5 (25)4 (30.77)0.36
Present15 (75)9 (69.23)
cagAAbsent13 (65)9 (69.23)0.4
Present7 (35)4 (30.77)
vacA s1/s2Absent11 (55)9 (69.23)0.21
Present9 (45)4 (30.77)
vacA s2Absent13 (65)10 (76.92)0.23
Present7 (35)3 (23.08)
vacA s1Absent18 (90)12 (92.31)0.41
Present2 (10)1 (7.69)
vacA m1/m2Absent13 (65)9 (69.23)0.4
Present7 (35)4 (30.77)
vacA m2Absent18 (90)12 (92.31)0.41
Present2 (10)1 (7.69)
vacA m1Absent14 (70)10 (76.92)0.33
Present6 (30)3 (23.08)
VacA_m1_VacA_s2Absent9 (45)10 (76.92)0.03
Present11 (55)3 (23.08)


Virulence genesStatusSusceptible, (%)Resistant, (%) value

oipAAbsent23 (95.83)9 (100)0.27
Present1 (4.17)0 (0)
hpaAAbsent15 (62.5)7 (77.78)0.2
Present9 (37.5)2 (22.22)
napAAbsent2 (8.33)0 (0)0,81
Present22 (91.67)9 (100)
ureBAbsent18 (75)7 (77.78)0.43
Present6 (25)2 (22.22)
ureAAbsent7 (29.17)2 (22.22)0.66
Present17 (70.83)7 (77.78)
cagAAbsent15 (62.5)7 (77.78)0.2
Present9 (37.5)2 (22.22)
vacA s1/s2Absent15 (62.5)5 (55.56)0.64
Present9 (37.5)4 (44.44)
vacA s2Absent17 (70.83)6 (66.67)0.59
Present7 (29.17)3 (33.33)
vacA s1Absent22 (91.67)8 (88.89)0.6
Present2 (8.33)1 (11.11)
vacA m1/m2Absent16 (66.67)6 (66.67)0.5
Present8 (33.33)3 (33.33)
vacA m2Absent23 (95.83)7 (77.78)0.95
Present1 (4.17)2 (22.22)
vacA m1Absent17 (70.83)7 (77.78)0,34
Present7 (29.17)2 (22.22)
VacA_m1_VacA_s2Absent14 (58.33)5 (55.56)0.56
Present10 (41.67)4 (44.44)

4. Discussion

Helicobacter pylori is a common pathogenic bacteria colonizer of the human stomach, and the bacteria have an essential role in the development of different gastroduodenal diseases including gastritis, peptic ulcers, and gastric cancer. Approximately, half of the world’s population has been presumed to be infected with this pathogenic bacterium, but only a small amount of infected people develop gastroduodenal diseases. H. pylori is a highly heterogeneous bacterium, and bacterial virulence genes play a pivotal role in determining the clinical outcome of H. pylori infection. For the treatment of H. pylori infection, different types of antibiotic therapy are applied to patients. However, similar to other bacterial infections, drug resistance is the most important cause of eradication failure for this bacterium. Different factors could affect H. pylori drug resistance. Age and gender, socioeconomic status, host disease status, and virulence factors of the pathogens are the most important factors that influence H. pylori drug resistance [16].

Clarithromycin and fluoroquinolones are important drugs for the treatment of H. pylori infection and resistance to these drugs has been associated with eradication failure. In this present study, it was aimed at evaluating the association between seven important H. pylori virulence genes, vacA, cagA, oipA, hpaA, babA, napA, dupA, ureA, and ureB, with the clarithromycin and fluoroquinolone resistance in H. pylori-infected patients with gastritis. Due to the PCR results H. pylori ureA and ureB virulence gene amplification were found in 73% and 24% of all isolates. The analysis results of H. pylori virulence genes revealed a specific association between the H. pylori napA virulence gene and H. pylori-related gastritis. It was found that 94% of patients with gastritis were positive for the H. pylori napA gene that is one of the most important virulence factors and taking a role in bacterial colonization and gastric inflammation. H. pylori napA virulence gene behaves as an immune modulator, and it can induce the production of oxygen radicals by the neutrophils [17]. Also, this bacterial virulence factor stimulates neutrophils, monocytes, and dendritic cells to cause induction of interleukin-12 (IL-12), IL-23, and IL-8 expressions [18, 19].

To the best of our knowledge, no report has shown that the direct association of the H. pylori napA gene with H. pylori-induced gastritis. H. pylori napA virulence gene could serve as a biomarker for the development of diagnostic kits to foresee the evolution of H. pylori-associated gastritis.

H. pylori vacA and cagA virulence genes are the most important virulence-associated genes that play an important role in the pathogenesis of H. pylori-related gastrointestinal disease. These two genes have different allelic variations, and these variations affect the disease progression. Most of the H. pylori strains isolated from the patients’ biopsy samples have the vacA gene. However, the distinction at the signal (s) and mid (m) regions of this gene are responsible for different levels of its cytotoxicity. In this present study, vacA s2/m1 allelic genotype was the most frequently detected allelic combination of the vacA gene detected among gastritis patients. 55% of clarithromycin susceptible gastritis patients had this allelic variation. In the literature, it was shown that s2-type VacA proteins lack detectable vacuolating activity, and our results support this information [20]. In the previous studies, a high level of genetic heterogeneity has been found among H. pylori strains isolated from various patients, and it is well known that genetic diversity in H. pylori is geographically and ethnically structured [21].

In the present study, it was also observed in the results that no gastritis patients were positive for the dupA gene. Duodenal ulcer promoting (dupA) gene is one of the H. pylori virulence factors that are highly associated with duodenal ulcer development and reduced risk of gastric cancer. Due to our results, dupA virulence gene could be used as a specific biomarker for the detection of peptic ulcer diseases [22].

In the literature, some articles show the association between virulence factors and antibiotic resistance in H. pylori with controversial results. In one of the studies, the absence of cagA was correlated with metronidazole resistance [23] and in other studies vacA S1 and cagE are associated with clarithromycin and metronidazole resistance [24]. However, in some articles, it was found that neither vacA nor cagA correlates with resistance. In our present study, no statistically significant association was found between the vacA, cagA, oipA, babA, napA, hpaA, dupA, ureA, and ureB virulence genes of H. pylori with the clarithromycin and fluoroquinolone resistance in H. pylori-infected patients with gastritis. A major limitation of our work was a relatively low number of patients with specific clinical manifestations. Studies to be carried out by increasing the number and variety of patients may give more accurate results for the virulence factor and drug resistance relation and H. pylori virulence factors could be used to predict the clinical outcome as well as to determine antibiotic susceptibility.

In conclusion, our current data showed that the analysis results of virulence genes expose a specific association between H. pylori napA virulence gene and clinical outcome; furthermore, no significant association could be detected among virulence genes and resistance or susceptibility. Also, the dupA gene was not found in any patient with gastritis that is thought to be one of the major markers for ulcer diseases. Our data results for the significant correlation between the vacA s1/m2 and clarithromycin supports the literature information for the lack of vacuolating ability of vacA s2 variation. Despite advances in our understanding of the correlation between H. pylori virulence factor and clinical outcome with antibiotic resistance, it is necessary to carry out further investigations to learn more information about the relation between the H. pylori virulence genes and the antibiotic resistance and clarify the roles of H. pylori virulence factors.

Data Availability

The data in the article can be used with reference.

Ethical Approval

This study was approved by the ethics board of the Yeditepe University, Istanbul, Turkey (date of approval: January 2016).

Conflicts of Interest

The authors have no conflicts of interest to declare.

References

  1. M. Sirous, J. F. Mehrabadi, N. E. Daryani, S. Eshraghi, S. Hajikhani, and M. H. Shirazi, “Prevalence of antimicrobial resistance in Helicobacter pylori isolates from Iran,” African Journal of Biotechnology, vol. 9, no. 36, pp. 5962–5965, 2011. View at: Google Scholar
  2. L. Pacifico, C. Anania, J. F. Osborn, F. Ferraro, and C. Chiesa, “Consequences of Helicobacter pylori infection in children,” World Journal of Gastroenterology, vol. 16, no. 41, pp. 5181–5194, 2010. View at: Publisher Site | Google Scholar
  3. A. Pilotto and M. Franceschi, “Helicobacter pylori infection in older people,” World Journal of Gastroenterology, vol. 20, no. 21, pp. 6364–6373, 2014. View at: Publisher Site | Google Scholar
  4. S. Agudo, T. Alarcón, P. Urruzuno, M. J. Martínez, and M. López-Brea, “Detection of Helicobacter pylori and clarithromycin resistance in gastric biopsies of pediatric patients by using a commercially available real-time polymerase chain reaction after NucliSens semiautomated DNA extraction,” Diagnostic Microbiology and Infectious Disease, vol. 67, no. 3, pp. 213–219, 2010. View at: Publisher Site | Google Scholar
  5. M. Guslandi, “Review article: alternative antibacterial agents for Helicobacter pylori eradication,” Alimentary Pharmacology & Therapeutics, vol. 15, no. 10, pp. 1543–1547, 2001. View at: Publisher Site | Google Scholar
  6. T. Uotani, M. Miftahussurur, and Y. Yamaoka, “Effect of bacterial and host factors on Helicobacter pylori eradication therapy,” Expert Opinion on Therapeutic Targets, vol. 19, no. 12, pp. 1637–1650, 2015. View at: Publisher Site | Google Scholar
  7. J. F. Tomb, O. White, A. R. Kerlavage et al., “The complete genome sequence of the gastric pathogen Helicobacter pylori,” Nature, vol. 388, no. 6642, pp. 539–547, 1997, Epub 1997/08/07. View at: Publisher Site | Google Scholar
  8. F. Sommer, G. Faller, P. Konturek et al., “Antrum- and corpus mucosa-infiltrating CD4+ lymphocytes in Helicobacter pyloriGastritis display a Th1 phenotype,” Infection and immunity, vol. 66, no. 11, pp. 5543–5546, 1998. View at: Publisher Site | Google Scholar
  9. C. T. Wittwer, K. M. Ririe, R. V. Andrew, D. A. David, R. A. Gundry, and U. J. Balis, “The LightCyclerTM: a microvolume multisample fluorimeter with rapid temperature control,” Biotechniques, vol. 22, no. 1, pp. 176–181, 1997. View at: Publisher Site | Google Scholar
  10. A. Ménard, A. Santos, F. Mégraud, and M. Oleastro, “PCR-restriction fragment length polymorphism can also detect point mutation A2142C in the 23S rRNA gene, associated with Helicobacter pylori resistance to clarithromycin,” Antimicrobial Agents and Chemotherapy, vol. 46, no. 4, pp. 1156-1157, 2002. View at: Publisher Site | Google Scholar
  11. M. Oleastro, A. Ménard, A. Santos et al., “Real-time PCR assay for rapid and accurate detection of point mutations conferring resistance to clarithromycin in Helicobacter pylori,” Journal of Clinical Microbiology, vol. 41, no. 1, pp. 397–402, 2003. View at: Publisher Site | Google Scholar
  12. S. Oktem-Okullu, A. Tiftikci, M. Saruc et al., “Multiplex-PCR-based screening and computational modeling of virulence factors and T-cell mediated immunity in Helicobacter pylori infections for accurate clinical diagnosis,” PLoS One, vol. 10, no. 8, article e0136212, 2015. View at: Publisher Site | Google Scholar
  13. S. Chattopadhyay, R. Patra, T. Ramamurthy et al., “Multiplex PCR assay for rapid detection and genotyping of Helicobacter pylori directly from biopsy specimens,” Journal of Clinical Microbiology, vol. 42, no. 6, pp. 2821–2824, 2004. View at: Publisher Site | Google Scholar
  14. Y. Yamaoka, T. Kodama, O. Gutierrez, J. G. Kim, K. Kashima, and D. Y. Graham, “Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries,” Journal of Clinical Microbiology, vol. 37, no. 7, pp. 2274–2279, 1999. View at: Publisher Site | Google Scholar
  15. S. Kumar, A. Kumar, and V. K. Dixit, “Direct detection and analysis of vacA genotypes and cagA gene of Helicobacter pylori from gastric biopsies by a novel multiplex polymerase chain reaction assay,” Diagnostic Microbiology and Infectious Disease, vol. 62, no. 4, pp. 366–373, 2008. View at: Publisher Site | Google Scholar
  16. D. E. Brennan, C. Dowd, C. O’Morain, D. McNamara, and S. M. Smith, “Can bacterial virulence factors predict antibiotic resistantHelicobacter pyloriinfection?” World Journal of Gastroenterology, vol. 24, no. 9, pp. 971–981, 2018. View at: Publisher Site | Google Scholar
  17. D. J. Evans Jr., D. G. Evans, T. Takemura et al., “Characterization of a Helicobacter pylori neutrophil-activating protein,” Infection and Immunity, vol. 63, no. 6, pp. 2213–2220, 1995. View at: Publisher Site | Google Scholar
  18. M. M. D'Elios, A. Amedei, A. Cappon, G. Del Prete, and M. de Bernard, “The neutrophil-activating protein of Helicobacter pylori (HP-NAP) as an immune-modulating agent,” FEMS Immunology and Medical Microbiology, vol. 50, no. 2, pp. 157–164, 2007. View at: Publisher Site | Google Scholar
  19. M. de Bernard and M. M. D'Elios, “The immune-modulating activity of the Helicobacter pylori HP-NAP: friend or foe?” Toxicon, vol. 56, no. 7, pp. 1186–1192, 2010. View at: Publisher Site | Google Scholar
  20. S. L. Palframan, T. Kwok, and K. Gabriel, “Vacuolating cytotoxin A (VacA), a key toxin for helicobacter pylori pathogenesis,” Frontiers in Cellular and Infection Microbiology, vol. 2, p. 92, 2012. View at: Publisher Site | Google Scholar
  21. J. L. Rhead, D. P. Letley, M. Mohammadi et al., “A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer,” Gastroenterology, vol. 133, no. 3, pp. 926–936, 2007. View at: Publisher Site | Google Scholar
  22. A. Talebi Bezmin Abadi and G. Perez-Perez, “Role of dupA in virulence of Helicobacter pylori,” World Journal of Gastroenterology, vol. 22, no. 46, pp. 10118–10123, 2016. View at: Publisher Site | Google Scholar
  23. I. Taneike, A. Nami, A. O’Connor et al., “Analysis of drug resistance and virulence-factor genotype of Irish Helicobacter pylori strains: is there any relationship between resistance to metronidazole and cagA status?” Alimentary Pharmacology & Therapeutics, vol. 30, no. 7, pp. 784–790, 2009. View at: Publisher Site | Google Scholar
  24. H. Karabiber, M. A. Selimoglu, B. Otlu, O. Yildirim, and A. Ozer, “Virulence factors and antibiotic resistance in children with Helicobacter pylori gastritis,” Journal of Pediatric Gastroenterology and Nutrition, vol. 58, no. 5, pp. 608–612, 2014. View at: Publisher Site | Google Scholar

Copyright © 2020 Sinem Oktem-Okullu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views181
Downloads56
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.