Research Article
Analysis of Correlation between the Seven Important Helicobacter pylori (H. pylori) Virulence Factors and Drug Resistance in Patients with Gastritis
Table 1
Real-time PCR primers and probe sequence.
| Virulence factor | Primer name | Primer sequences (5ā3) | Product size (bp) | Reference |
| 23SrRNA | HPYS/F | TATGGTACCCGCATGATATTCCCATTAGCAGT | 267 | [9, 10] | HPYA/R | TAAGAGCTCAGGTTAAGAGGATGCGTCAGTC | [9, 10] | Sensor probe 5 labeled with LC-red 640 | GGCAAGACGGAAAGACC | 2504 to 2520 | [9, 10] | Anchor probe 3 labeled with fluorescein | TGTAGTGGAGGTGAAAATTCCTCCTACCC | 2473 to 2501 | [9, 10] |
|
|