International Journal of Genomics

International Journal of Genomics / 2015 / Article
Special Issue

Environment-Living Organism’s Interactions from Physiology to Genomics

View this Special Issue

Research Article | Open Access

Volume 2015 |Article ID 875497 |

Xu Zhang, Xiaoxue Liu, Lei Wu, Guihong Yu, Xiue Wang, Hongxiang Ma, "The SsDREB Transcription Factor from the Succulent Halophyte Suaeda salsa Enhances Abiotic Stress Tolerance in Transgenic Tobacco", International Journal of Genomics, vol. 2015, Article ID 875497, 13 pages, 2015.

The SsDREB Transcription Factor from the Succulent Halophyte Suaeda salsa Enhances Abiotic Stress Tolerance in Transgenic Tobacco

Academic Editor: Marián Brestič
Received19 Apr 2015
Accepted07 Jun 2015
Published04 Oct 2015


Dehydration-responsive element-binding (DREB) transcription factor (TF) plays a key role for abiotic stress tolerance in plants. In this study, a novel cDNA encoding DREB transcription factor, designated SsDREB, was isolated from succulent halophyte Suaeda salsa. This protein was classified in the A-6 group of DREB subfamily based on multiple sequence alignments and phylogenetic characterization. Yeast one-hybrid assays showed that SsDREB protein specifically binds to the DRE sequence and could activate the expression of reporter genes in yeast, suggesting that the SsDREB protein was a CBF/DREB transcription factor. Real-time RT-PCR showed that SsDREB was significantly induced under salinity and drought stress. Overexpression of SsDREB cDNA in transgenic tobacco plants exhibited an improved salt and drought stress tolerance in comparison to the nontransformed controls. The transgenic plants revealed better growth, higher chlorophyll content, and net photosynthesis rate, as well as higher level of proline and soluble sugars. The semiquantitative PCR of transgenics showed higher expression of stress-responsive genes. These data suggest that the SsDREB transcription factor is involved in the regulation of salt stress tolerance in tobacco by the activation of different downstream gene expression.

1. Introduction

The abiotic stresses like salinity, drought, and low and high temperature negatively affect plant growth and productivity [1]. They are major limiting factors for sustainable food production as they reduce yields by more than 50% in crop plants [2]. To overcome these limitations, plants have generated mechanisms to trigger a cascade of events leading to changes in gene expression and subsequently to biochemical physiological modifications that can enhance their stress tolerance [3]. Molecular and cellular responses to abiotic stresses involve signal perception, transduction of the signal to the cytoplasm and nucleus, alteration of gene expression and, finally, metabolic changes that lead to stress tolerance [4]. Numerous abiotic stress-related genes and transcription factors (TFs) have been isolated from different plant species and overexpressed in homologous and heterologous systems to engineer stress tolerance [5]. The Dehydration-responsive element-binding proteins (DREBs) are members of the APETALA2/ethylene-responsive element-binding factor (AP2/ERF) family of transcription factors in the promoters of stress-inducible genes [6].

Genes included in the DREB subfamily are divided into six small subgroups (A-1 to A-6) based on similarities in the binding domain. The A-1 subgroup, which includes the DREB1/CBF- (C-repeat binding factor-) like genes, are mainly induced by low temperature and activate the expression of many cold stress-responsive genes, whereas the A-2 subgroup, which is comprised of the DREB2 genes, mainly functions in osmotic stress [7]. In addition, multiple research reports indicated that the genes on the CBF/DREB family play very important roles in regulating abiotic stress via ABA-independent/dependent pathway [810]. It suggested that CBF/DREB plays distinctive roles in plant response to stress [11] and that there might also be a crosstalk between drought and cold responsive genes with a DRE element [6]. DREB2 homologous genes have been isolated from a variety of species [12]. Transgenic plants overexpressing either DREB1 or DREB2A genes enhanced tolerance to abiotic stress [1316].

To date, only few efforts are made in halophytes in response to salt stress. The expression of AhDREB1 from Atriplex hortensis was observed in salt stress [17], while AsDREB from Atriplex halimus was induced by only dehydration [18]. PpDBF1 from Physcomitrella patens was induced under salt, dehydration as well as cold stress [19], while SbDREB2A from Salicornia brachiata was induced by NaCl, drought, and heat stress [20].

Suaeda salsa is a native halophyte in China for both industrial application and scientific research [21]. Fresh branches of S. salsa are highly valuable as a vegetable, and the seeds can produce edible oil [21]. It can grow both in saline soils and in the intertidal zone where soil salt reaches up to 3%. Treatment of S. salsa with 200 mM NaCl could significantly increase its growth and net photosynthetic rate [22]. The high salt tolerance might be partly the result of its efficient antioxidative system [22]. For instance, Mn-SOD and Fe-SOD activities in the leaves of S. salsa seedlings were significantly higher under NaCl stress conditions (100 mmol L-1) than those under non-NaCl stress conditions [22]. However, the mechanism of abiotic-stress-tolerance in S. salsa is still poorly understood. In the present study, we report the cloning and characterization of the SsDREB cDNA. Its expression pattern was investigated in response to exogenous ABA, salt, cold, and drought stress treatments. Overexpression of this cDNA in transgenic tobacco led to enhanced tolerance to salinity and dehydration stresses.

2. Materials and Methods

2.1. Plant Materials and Stress Treatment

Seeds of S. salsa were germinated and precultured in pots containing vermiculite with Hoagland nutrient solution in a growth chamber (20/25°C, 16 h light/8 h dark) under 250  light intensity.

Salinity, dehydration, and ABA stress treatments were performed on S. salsa by transferring 3-week-old seedlings in Hoagland nutrient solution supplemented with 250 mM NaCl, 20% PEG6000, and 100 μm/L ABA, respectively. Low temperature treatments were performed by transferring plants to a growth chamber set to 4°C under the light and the photoperiodic conditions described above. Samples were harvested at 0, 0.5, 2, 4, 8, 12, and 24 h after treatment and immediately stored at −80°C for further study. All experiments were repeated in biological triplicates.

2.2. Gene Isolation and Sequencing Analyses

Total RNA was extracted from the leaves of S. salsa, treated with 400 mM NaCl for 6 h utilizing SV Total RNA Extraction Kit (Promega, USA) according to the instruction. The conserved AP2/ERF domain of DREB genes in S. salsa was amplified by primers DREB-C1 and DREB-C2, designed from the known DREB/CBF genes in the GenBank database. Isolation of the cDNA sequences was carried out using the RNA ligase-mediated rapid amplification of 5′ and 3′ ends (RLM-RACE) method, according to the GeneRacer Kit (Invitrogen, USA). Gene-specific nested primes 5GSP1, 5GSP2, 3GSP1, and 3GSP2 were designed based on the known genomic sequences. Sequences of all relevant primers are listed in Table 1.

Primer nameOligonucleotides (5′-3′)Use


The 5′- and 3′-RACE fragments were cloned into separate pGEM-T Easy plasmid vectors (Promega, USA) and sequenced. The cDNA sequences of SsDREB were amplified by PCR using the forward primer SsDREB-G1 and the reverse primer SsDREB-G2 (Table 1). PCR was performed with a 5-min 94°C denaturation step, followed by 30 cycles of 45 s at 94°C, 45 s annealing at 55°C, a 1-min extension at 72°C, and a final extension period of 10 min.

Sequence analyses were performed using the program BLASTX (National Centre for Biotechnology Information, USA). The ORF of SsDREB genes and the properties of protein encoded by them were predicted by DNAStar software. The conserved AP2 domains (Accession number: smart00380) were originally applied as a seed sequence to search the NCBI database ( and 33 proteins were retrieved with an expected value of 100. Multiple alignments were prepared using ClustalW [23] using default parameters (gap opening penalty = 10, gap extension penalty = 0.2). The resulting alignments of complete protein sequences were used in MEGA (version 5) [24] for the construction of unrooted phylogenetic trees using the neighbor-joining (NJ) method according to Jones-Taylor-Thornton model with uniform rates among sites and complete deletion of gaps data. The reliability of the obtained trees was tested using bootstrapping with 500 replicates.

2.3. DRE Binding and Transcriptional Activity of FeDREB1 in Yeast

The DNA-binding activity of SsDREB protein was measured using a yeast one-hybrid system. Three tandem repeats of the core sequence of the DRE (TACCGACAT) and its mutant (mDRE) sequence (TATTTTCAT) were cloned into the Sac I/Spe I restriction sites of the plasmid pHIS2.1 cloning reporter vector upstream to the HIS3 minimal promoter according to the protocol described by Clontech (Clontech, Mountain View, CA, USA). The entire coding region of SsDREB was cloned into the Sma I site of the YepGAP expression vector containing no GAL4 activation domain (AD) [25]. The recombinant YepGAP expression vector containing SsDREB cDNA and the pHIS2.1 vector containing three tandem repeats of the DRE or mDRE were cotransformed into the yeast strain Y187. The growth status of the transformed yeast was compared on SD/-Leu-Ura-His+ 10 mM 3-AT plates to test the expression of the HIS reporter gene. Empty YepGAP was used as a negative control.

2.4. Gene Expression Assay by Quantitative Real-Time RT-PCR

Total RNA was extracted from the roots, stem, and leaves using SV Total RNA Extraction Kit (Promega, USA) according to the instruction. First-strand cDNA was produced from 1 μg of RNA using PrimeScript RT reagent Kit (Takara, Dalian, China), according to the manufacturer’s protocol. Each sample was amplified in biological and technical triplicate by quantitative real-time RT-PCR using a Roche 2.0 Real-Time PCR Detection System with the SYBR Green Supermix (Takara, Dalian, China). The reaction mixture was cycled as follows: 30 s denaturation at 95°C, then 40 cycles of 5 s at 95°C, 10 s at 60°C, and 20 s at 72°C. The amplification of S. salsa Actin gene (FJ587488) was used as the normalization control. The mRNA fold difference was relative to that of untreated samples used as calibrator. The relative quantification value for SsDREB was calculated by the method [26]. All relevant primers used in this work are listed in Table 2.

Primer NameOligonucleotides (5′-3′)Use


2.5. Generation of Transgenic Tobacco

To generate transgenic plants, SsDREB cDNA was amplified using a specific primer pair: forward, 5′-GCCTCTAGAATGGCAGCTACAACAAT GGATATG-3′ (XbaI site underlined) and reverse, 5′-GCCCCCGGGTTAAGATGATGATGAT AAGATAGC-3′ (SmaI site underlined). The PCR product was fused into the binary plant transformation vector pCAMBIA2301 under the control of the CaMV 35S promoter. The constructs were mobilized to Agrobacterium tumefaciens strain EHA105. This Agrobacterium strain was used for transformation in tobacco leaf discs following the standard protocol [27]. The putative transgenic lines selected on medium containing hygromycin were confirmed by PCR with gene-specific primers.

The seeding of transgenic tobacco plants was selected on solid 1/2 MS medium containing 100 μg/mL kanamycin under long-day condition (16 h light/8 h dark) at 25°C. The transgenic lines of tobacco plants were confirmed by qRT-PCR analysis.

2.6. Salinity and Drought Stress Tolerance Evaluation in Transgenic Plants

Independent homozygous transgenic plants lines and homozygous wild-type transgenic with pCAMBIA2301 empty vector (WT) were precultured in MS liquid medium for 4 days in growth chamber (20/25°C, 16 h light/8 h dark) under 250 mE/m2/s light intensity. Then, both plants were transferred in an aqueous MS medium supplemented with PEG6000 (0, 5, 10 15, and 20%) or NaCl (0, 50, 100, 150, 200, 250, and 300 mM) for 2 days. Leaves with and without stress treatments were sampled for physiological parameters.

2.7. Measurement of Photosynthetic and Chlorophyll Fluorescence Parameters

Leaf net photosynthetic rate was measured using a portable infrared gas analyzer (LI 6400XT portable photosynthetic system, Lincoln, USA). Chlorophyll index was measured using chlorophyll content meter (FMS-2 Pulse Modulated Fluorometer, Hansatech Inc., UK).

2.8. Measurement of Free Proline and Soluble Sugars Content

Fresh leaf material (0.3 g) was extracted with 5 mL of deionized water at 100°C for 10 min, and shaken with 0.03 g of permutit for 5 min. The extract was separated by centrifugation at 3,000 rpm for 10 min, and then the proline content of the aqueous extract was determined using the acid ninhydrin method. The organic phase was determined at 515 nm. The resulting values were compared with a standard curve constructed using known amounts of proline (Sigma).

Fresh leaf material (0.2 g) was extracted with 80% (v/v) ethanol at 70°C for 30 min. The extract was separated by centrifugation at 12,000 rpm for 10 min and diluted with water to 10 mL. Then, the soluble sugar content of the aqueous extract was determined using sulfuric acid anthrone colorimetric method. The resulting values were compared with a standard curve constructed using known amounts of sugar.

2.9. Semiquantitative RT-PCR for Expression Analysis of Downstream Genes of SsDREB

Semiquantitative RT-PCR amplification was performed with selected gene primers (Table 3), using the first strand cDNA, synthesized from RNA samples collected from WT and transgenic tobacco seedlings. The reaction mixture was cycled as follows: 3 m denaturation at 95°C, then 35 cycles of 45 s at 94°C, 45 s at 55°C, and 1 m at 72°C. The amplification of S. salsa α-tublin gene was used as the normalization control. PCR-amplified products were visualized on ethidium bromide-stained 1.5% agarose gels.

Gene (GeneBankID)Oligonucleotides (5′-3′)


Glutathione S-transferase (D10524)TTGGCCTTCTACTTCCATCC



lipid transferase (ltp1) (X62395)AATAGCTGGGAAAATTGCATG





3. Results

3.1. Isolation and Phylogenetic Analysis of SsDREB cDNA

A full length-cDNA sequence, designated as SsDREB, was isolated from S. salsa. This cDNA is 1095-bp long corresponding to a protein of 364 amino acids. SsDREB possesses two regions rich in serine, one region rich in glutamine, and an acidic C-terminal sequence, PSXEIDW, which is known to function in transcriptional activation activity [25, 28]. The putative amino acid sequence showed that the SsDREB had a conserved EREBP/AP2 domain of 64 amino acids with valine (V) and leucine (L) at the 14th and 19th residues, respectively (Figure 1(a)). Phylogenic tree analysis of DREB proteins showed that SsDREB, together with Arabidopsis RAP2.4, ZmDREB1, OsDBF1, and ChDREB2, is attributable to the DREB (A-6) lineage (Figure 1(b)).

3.2. SsDREB Protein Specifically Binds to the DRE Element

To verify the possible binding function between SsDREB protein and DRE element, the recombinant plasmid pAD-SsDREB was separately transformed into yeast strain Y187 containing the reporter genes HIS3 under the control of DRE. As negative controls, pAD-SsDREB was also separately transformed into Y187 harboring the reporter genes HIS3 under the control of a mutant DRE (mDRE) (Figure 2(a)). These results suggested that the DRE::pAD-SsDREB transgenic yeast cells grew well on SD/-His 10 mM 3-AT, whereas the yeast cells harboring mDRE::pAD-SsDREB transgenic yeast cells could not grow on the same medium (Figure 2(b)). These results strongly indicated that the SsDREB can bind the normal DRE element exclusively to drive target gene expression in vivo.

3.3. Expression of SsDREB in Response to Various Abiotic Stresses

The expression pattern of SsDREB in different organs of S. salsa was examined under normal conditions. The expression level of MsDREB2C was highest in leaves followed by roots and stem (Figure 3(a)). Therefore, expression of SsDREB in leaf was investigated under different abiotic stresses. Quantitative reverse transcription-PCR (qRT-PCR) revealed that the transcript of SsDREB was induced by salt and drought stress. SsDREB expression was induced by salt treatment at 0.5 hours after treatment and peaked at 4 h, with the highest abundance of about 16-fold increase (Figure 3(b)). The expression increased slowly from 0.5 h but rapidly peaked at 8 h and then decreased gradually under mimic dehydration stress (Figure 3(b)). Under cold stress (4°C) treatment, SsDREB expression was gradually declined and then slightly recovered after 4 h after treatment (Figure 3(c)). Similarly, there was no significant expression change of SsDREB after exogenous ABA application, indicating that StDREB1 may function in an ABA-independent signaling pathway (Figure 3(c)).

3.4. Confirmation of Putative Transgenic Tobacco Plants Expressing SsDREB

The putative transgenic lines selected on medium containing hygromycin were confirmed by PCR with gene-specific primers using primers the pCAMBIA2301 binary vector corresponding to sequences flanking the SsDREB cDNA. As expected, a PCR product of 1095 bp was obtained (Figure 4(a)). PCR-positive plants were successfully transferred to green house for further analysis. Positive transgenic lines also showed expression of SsDREB by semiquantitative RT-PCR, whereas expression of SbDREB was not observed in WT plants (Figure 4(b)). No phenotypic modification such as dwarfism was noticed in these SsDREB transgenic plant lines.

3.5. Tobacco Plants Overexpressing SsDREB Enhance Salinity and Dehydration Tolerance
3.5.1. Morphological Features of Plants

All of the transgenic lines and WT tobacco plants grew well under normal condition (Figure 5(a)). After dehydration and salinity treatment, decrease in leaf size was observed in both transgenic and WT plants. The salt stress proved more detrimental in the WT plants as compared to transgenic seedlings. At 300 mM NaCl, the transgenic plants showed better growth under salt stress with larger leaf area and higher turgor maintenance pressure (Figure 5(b)) as compared to WT. At 20% PEG, the transgenic plants showed significantly better growth under stress with larger leaf area and higher turgor maintenance pressure (Figure 5(c)) as compared to WT.

3.5.2. Photosynthesis and Chlorophyll Fluorescence Parameters

Net photosynthesis rate () and stomatal conductance () in WT and transgenic plants were similar under control condition. Net photosynthesis rate () was 13.8 and 14.0 μmol in WT and transgenic plants while stomatal conductance was 0.37 and 0.38 μmol under control condition. Under salinity stress net photosynthesis rate and stomatal conductance reduced drastically as compared to control conditions in WT and transgenic lines. Transgenics showed significantly higher net photosynthetic rate and stomatal conductance at all five NaCl concentration gradients, compared to WT plants indicating. Net photosynthesis rate was reduced to 12.6, 11.1, 8.7, 6.3, and 2.2 μmol in WT plants 2 days after 50, 100, 150, 200, and 250 mM NaCl treatment, respectively. But transgenic plants maintained net photosynthesis rate at 13.6, 12.5, 11.6, 10.3, and 8.9 μmol in the same treatment (Figure 6(a)). In addition, stomatal conductance was reduced to 0.34 and 0.04 mol in WT plants, while transgenic plants maintained around 0.37 and 0.21 days after 50 and 250 mM NaCl treatment, respectively (Figure 6(b)). Similarly, transgenics showed significantly higher net photosynthetic rate and stomatal conductance at all four PEG concentration gradients, compared to WT plants (Figures 6(g)-6(h)). The results showed that SsDREB transgenic plants showed higher tolerance to salt stress.

Chlorophyll fluorescence parameters were also investigated. Maximal PS II quantum efficiency (Fv/Fm) and effective PS II quantum yield (Y II) in WT and transgenic plants were similar under control condition. Fv/Fm was 0.84 and 0.83 in WT and transgenic plants while Y (II) was 0.78 and 0.77 under control condition. The transgenics showed higher Fv/Fm and Y (II) at all five NaCl concentration gradients, compared to WT plants (Figures 6(c)-6(d)). Fv/Fm was reduced to 0.82, 0.81, 0.78, 0.75, and 0.71 in WT plants 2 days after 50, 100, 150, 200, and 250 mM NaCl treatment, respectively. But transgenic plants maintained Fv/Fm at 0.83 under 50 and 100 mM NaCl stress and then drop slightly to 0.82, 0.81, and 0.80 under 150, 200, and 250 mM NaCl treatment (Figure 6(c)). In addition, Y (II) was reduced to 0.74 and 0.38 in WT plants, while transgenic plants were maintained around 0.76 and 0.59 2 days after 50 and 250 mM NaCl treatment, respectively (Figure 6(d)). Similarly, the transgenics showed higher chlorophyll fluorescence parameters at all four PEG gradients, compared to WT plants (Figures 6(i)-6(j)), indicating that expression of SsDREB in transgenic tobacco enhanced abiotic tolerance.

3.5.3. Proline and Soluble Sugar Content

Proline and soluble sugar content accumulate in plants subjected to salinity and dehydration stress conditions to confer stress tolerance in both transgenic and WT plants. The contents of soluble sugar and free proline in transgenic plants were slightly richer than that of the WT plants with all salinity and dehydration stress, demonstrating that the overexpression of SsDREB gene could enhance plant salinity and dehydration tolerance in transgenic tobacco (Figures 6(e)-6(f), 6(k)-6(l)).

3.6. Overexpression of StDREB1 Activates the Expression of Stress-Responsive Genes

Given that the SsDREB transgenic plants showed enhanced tolerance to salinity and drought and freezing stress, we decided to quantify the molecular responses of eight stress-responsive genes in the transgenic lines to see the level of expression under stress conditions. Semiquantitative RT-PCR analyses of these target genes were performed for the WT and for the SsDREB transgenic tobacco plants. An increase in transcription level of these genes was noticed in almost all transgenic plants cultivated under standard growth conditions in comparison to those in WT ones (Figure 7). This most significant increase was in expression of ltp1, Lea5, and H+-ATPase genes, while expression of Cu/Zn SOD, TOBPXD, and GST was slightly higher in transgenic plants under the same situation. All these findings strongly suggested that SsDREB might upregulate the expression of stress-related functional genes.

4. Discussion

This study describes the isolation and characterization of a DREB factor from halophyte Suaeda salsa, termed SsDREB. To date, only few efforts are made in halophytes in response to salt stress. The AhDREB1 from Atriplex hortensis expression was observed in salt stress [17], while AsDREB from Atriplex halimus was induced by dehydration but not in salt stress [18]. PpDBF1 from Physcomitrella patens was induced under salt, dehydration as well as cold stress [19]. DREB2-type TFs SbDREB2A from halophytic plants Salicornia brachiata was induced by NaCl, drought and heat stress [20].

The sequence analysis of SsDREB identified an AP2/ERF domain of 64 amino acids that is predicted to fold into a structure containing three anti-parallel β-sheets and one α-helix. SsDREB possessed two regions rich of serine, one region rich of glutamine, and an acidic C-terminal sequence, PSXEIDW, which is known to function in transcriptional activation activity [25, 28]. This structure is thought to play a key role in recognizing and binding to specific cis-elements [7]. Sequence alignment and phylogenetic analyses revealed that the SsDREB grouped with the DREB (A-6) lineage. In this study, the DSAW and LWSY motif, the conserved sequences in A1-subgroup (DREB1) [29], was not found in SsDREB.

A number of reports have suggested that Val14 and Glu19 in the AP2/ERF domain are essential for specific binding to DRE [7, 25]. The absolutely conserved 14th valine residue, an important site that acts in DNA binding, has also been found in the AP2/ERF domain of SsDREB protein [7]. However, the 19th glutamic acid residue is replaced by leucine residue in the SsDREB (Figure 1(a)). Similar amino acid changes have also been observed in other plant species. In rice, wheat, and barley, the DREB1-type factors harbor a valine residue at position 19 in the AP2/ERF domain [30, 31]. The Glu (E) 19 is also replaced by Gln (Q) in potato (Solanum tuberosum L.) and by His (H) in Buckwheat (Fagopyrum esculentum). In Broussonetia papyrifera, the 19th glutamic acid residue in BpDREB2 protein was replaced by leucine residue, and the DNA binding assay in the yeast one-hybrid system suggested that the 14th residue is more crucial than the 19th residue in the DRE binding activity of DREB [32]. Other research also reported that mutation in the 19th residue had little effect on DRE binding activity [33]. Our DNA binding assay in the yeast one-hybrid system also suggested that the change in the 19th residue had little effect on DRE binding activity (Figure 3(b)). The mutation of the 19th residue in the AP2/ERF domain indicated that the conserved 14th valine residue may be crucial in the regulation of the DRE binding activity of DREB.

It was reported that the expression of DREB1 (A-1) genes was induced by low temperature, whereas the expression of DREB2 (A-2) genes was attributed to dehydration or salt stress [25]. Quantitative real-time RT-PCR analysis showed that the transcripts of the SsDREB were induced by drought and salt stress but not by cold treatment, which is in agreement with previous reports describing the role of DREB factors in plant response to abiotic stress [4, 34]. However, the transcripts of the SsDREB were not induced by exogenous ABA application in S. salsa (Figure 5). Many studies showed that ABA phytohormone, whether endogenous or exogenous, is involved in several physiologic processes and in the adaptation of plants to different abiotic stresses and plays a crucial role in inducing the expression of some stress-responsive genes [35, 36]. Transcript accumulation of StDREB1 gene from potato (Solanum tuberosum L.) was significantly induced by exogenous application of 50 μM ABA, indicating that StDREB1 may function in an ABA-dependent signaling pathway [19]. The transcripts of the FeDREB1 from buckwheat were induced by low-/high-temperature treatment, drought stress, and exogenous ABA application [14]. However, several exceptions regarding this expression pattern have been reported. For instance, Glycine max GmDREB2A, a member of the DREB (A-2) group was highly induced not only by dehydration and heat but also by low temperature [37], and PeDREB2 from Populus euphratica was induced by drought and salt, as well as cold stress [38]. Moreover, a ZmDBP4, belonging to DREB (A-1) gene, was activated by cold and drought, but not ABA [39]. GmDREB2 and BpDREB2 were also reported not to be responsive to ABA treatment [32, 40]. Our research results indicated that SsDREB genes were not responsive to ABA treatment, which suggests that SsDREB genes are involved in the dehydration and salinity stress responses through ABA-independent pathways.

Morphological and physiological parameters are actual indicators of stress endurance of transgenic plants. The SsDREB transgenic plants imparted both salinity and dehydration tolerance with better morphological growth like larger leaf area and higher turgor maintenance pressure. In contrast to the data reported by Yamaguchi-Shinozaki and Shinozaki [41], the overexpression of StDREB1 gene in transgenic plants did not show any phenotypic changes such as dwarfism. Fluorescence-based photosynthetic activity of leaves plays an important role in adaptation to abiotic stress. Under salinity and dehydration stress, the SsDREB transgenic plants kept higher photosynthesis and chlorophyll fluorescence parameters than WT plants, revealing better abiotic stress tolerance.

During stress conditions, proline helps the plant cell by stabilizing subcellular structures such as membranes and proteins, scavenging free radicals and buffering cellular redox potential [42]. Previous studies reported that AtDREB1 could enhance the drought tolerance of transgenic Arabidopsis by activating the expression of downstream genes involved in sugar biosynthesis and proline biosynthesis [43]. Transgenic tobacco overexpressing SsDREB accumulated higher free proline and soluble sugar than WT plants under salinity and dehydration stress, revealing the improved salinity and drought tolerance of the transgenic plants. Similarly, overexpression of SbDREB in Salicornia brachiata [20] and OsDREB2A in rice [44] also resulted in higher accumulation of proline under salt stress.

The constitutive expression of SsDREB conferred improved tolerance to drought and salinity in transgenic plants, possibly because of the overexpression of stress-inducible DREB2-responsive genes. LEA proteins were quite hydrophilic and were believed to protect plant cells from these stresses. Furthermore, the activity of LEA genes was associated with cold stress in plants [45]. In this study, expression level of LEA5 increased significantly in transgenic plants, indicating that SsDREB had activated the expression of downstream genes like LEA5. The expression of glutathioneS-transferase (GST) and superoxide dismutase (SOD) was not high in transgenics, indicating that SsDREB was not responsive to oxidative stress.

In conclusion, a novel SsDREB transcription factor was cloned from Suaeda salsa andclassified in the A-6 group based on phylogenetic characterization. Yeast one-hybrid assays verified that SsDREB protein specifically binds to the DRE element. Real-time RT-PCR showed that SsDREB was significantly induced under salinity and drought stress. Overexpression of SsDREB cDNA in transgenic tobacco plants exhibited an improved salt and drought stress tolerance, suggesting that the SsDREB transcription factor is involved in the regulation of abiotic stress tolerance in tobacco by the activation of different downstream gene expression.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Authors’ Contribution

Xu Zhang and Xiaoxue Liu contributed equally to this paper.


This work was financially supported by the National Science and Technology Major Project (2014ZX08002-005B), China Agriculture Research System (CARS-03-2-12), and the National Natural Science Foundation of China (31201201).


  1. Y. Sakuma, K. Maruyama, Y. Osakabe et al., “Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression,” Plant Cell, vol. 18, no. 5, pp. 1292–1309, 2006. View at: Publisher Site | Google Scholar
  2. E. A. Bray, J. Bailey-Serres, and E. Weretilnyk, “Responses to abiotic stresses,” in Biochemistry and Molecular Biology of Plants, W. Gruissem, B. Buchannan, and R. Jones, Eds., American Society of Plant Biologists, Rockville, Md, USA, 2000. View at: Google Scholar
  3. S. Ramanjulu and D. Bartels, “Drought- and desiccation-induced modulation of gene expression in plants,” Plant, Cell and Environment, vol. 25, no. 2, pp. 141–151, 2002. View at: Publisher Site | Google Scholar
  4. P. K. Agarwal, P. Agarwal, M. K. Reddy, and S. K. Sopory, “Role of DREB transcription factors in abiotic and biotic stress tolerance in plants,” Plant Cell Reports, vol. 25, no. 12, pp. 1263–1274, 2006. View at: Publisher Site | Google Scholar
  5. P. K. Agarwal, P. S. Shukla, K. Gupta, and B. Jha, “Bioengineering for salinity tolerance in plants: state of the art,” Molecular Biotechnology, vol. 54, no. 1, pp. 102–123, 2013. View at: Publisher Site | Google Scholar
  6. K. Yamaguchi-Shinozaki and K. Shinozaki, “Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses,” Annual Review of Plant Biology, vol. 57, pp. 781–803, 2006. View at: Publisher Site | Google Scholar
  7. Y. Sakuma, Q. Liu, J. G. Dubouzet, H. Abe, K. Shinozaki, and K. Yamaguchi-Shinozaki, “DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression,” Biochemical and Biophysical Research Communications, vol. 290, no. 3, pp. 998–1009, 2002. View at: Publisher Site | Google Scholar
  8. Q. Wang, Y. Guan, Y. Wu, H. Chen, F. Chen, and C. Chu, “Overexpression of a rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both Arabidopsis and rice,” Plant Molecular Biology, vol. 67, no. 6, pp. 589–602, 2008. View at: Publisher Site | Google Scholar
  9. C.-T. Wang, Q. Yang, and C. T. Wang, “Isolation and functional characterization of ZmDBP2 encoding a dehydration-responsive element-binding protein in Zea mays,” Plant Molecular Biology Reporter, vol. 29, no. 1, pp. 60–68, 2011. View at: Publisher Site | Google Scholar
  10. A. Karaba, S. Dixit, R. Greco et al., “Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene,” Proceedings of the National Academy of Sciences of the United States of America, vol. 104, no. 39, pp. 15270–15275, 2007. View at: Publisher Site | Google Scholar
  11. P. Xianjun, M. Xingyong, F. Weihong et al., “Improved drought and salt tolerance of Arabidopsis thaliana by transgenic expression of a novel DREB gene from Leymus chinensis,” Plant Cell Reports, vol. 30, no. 8, pp. 1493–1502, 2011. View at: Publisher Site | Google Scholar
  12. C. Lata and M. Prasad, “Role of DREBs in regulation of abiotic stress responses in plants,” Journal of Experimental Botany, vol. 62, no. 14, pp. 4731–4748, 2011. View at: Publisher Site | Google Scholar
  13. S. Matsukura, J. Mizoi, T. Yoshida et al., “Comprehensive analysis of rice DREB2-type genes that encode transcription factors involved in the expression of abiotic stress-responsive genes,” Molecular Genetics and Genomics, vol. 283, no. 2, pp. 185–196, 2010. View at: Publisher Site | Google Scholar
  14. Z. W. Fang, X. H. Zhang, J. F. Gao et al., “A buckwheat (Fagopyrum esculentum) DRE-binding transcription factor gene, FeDREB1, enhances freezing and drought tolerance of transgenic Arabidopsis,” Plant Molecular Biology Reporter, 2015. View at: Publisher Site | Google Scholar
  15. A. Sadhukhan, Y. Kobayashi, M. Tokizawa et al., “VuDREB2A, a novel DREB2-type transcription factor in the drought-tolerant legume cowpea, mediates DRE-dependent expression of stress-responsive genes and confers enhanced drought resistance in transgenic Arabidopsis,” Planta, vol. 240, no. 3, pp. 645–664, 2014. View at: Publisher Site | Google Scholar
  16. D. Bouaziz, J. Pirrello, M. Charfeddine et al., “Overexpression of StDREB1 transcription factor increases tolerance to salt in transgenic potato plants,” Molecular Biotechnology, vol. 54, no. 3, pp. 803–817, 2013. View at: Publisher Site | Google Scholar
  17. Y.-G. Shen, W.-K. Zhang, S.-J. He, J.-S. Zhang, Q. Liu, and S.-Y. Chen, “An EREBP/AP2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold, dehydration and ABA stress,” Theoretical and Applied Genetics, vol. 106, no. 5, pp. 923–930, 2003. View at: Google Scholar
  18. A. H. A. Khedr, M. S. Serag, M. M. Nemat-Alla et al., “A DREB gene from the xero-halophyte Atriplex halimus is induced by osmotic but not ionic stress and shows distinct differences from glycophytic homologues,” Plant Cell, Tissue and Organ Culture, vol. 106, no. 2, pp. 191–206, 2011. View at: Publisher Site | Google Scholar
  19. N. Liu, N.-Q. Zhong, G.-L. Wang et al., “Cloning and functional characterization of PpDBF1 gene encoding a DRE-binding transcription factor from Physcomitrella patens,” Planta, vol. 226, no. 4, pp. 827–838, 2007. View at: Publisher Site | Google Scholar
  20. K. Gupta, B. Jha, and P. K. Agarwal, “A dehydration-responsive element binding (DREB) transcription factor from the succulent halophyte Salicornia brachiata enhances abiotic stress tolerance in transgenic tobacco,” Marine Biotechnology, vol. 16, no. 6, pp. 657–673, 2014. View at: Publisher Site | Google Scholar
  21. Z. Kefu, F. Hai, and I. A. Ungar, “Survey of halophyte species in China,” Plant Science, vol. 163, no. 3, pp. 491–498, 2002. View at: Publisher Site | Google Scholar
  22. B. Wang, U. Lüttge, and R. Ratajczak, “Specific regulation of SOD isoforms by NaCl and osmotic stress in leaves of the C3 halophyte Suaeda salsa L,” Journal of Plant Physiology, vol. 161, no. 3, pp. 285–293, 2004. View at: Publisher Site | Google Scholar
  23. M. A. Larkin, G. Blackshields, N. P. Brown et al., “Clustal W and Clustal X version 2.0,” Bioinformatics, vol. 23, no. 21, pp. 2947–2948, 2007. View at: Publisher Site | Google Scholar
  24. K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar, “MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods,” Molecular Biology and Evolution, vol. 28, no. 10, pp. 2731–2739, 2011. View at: Publisher Site | Google Scholar
  25. Q. Liu, M. Kasuga, Y. Sakuma, H. Abe, S. Miura, and K. Yamaguchi-Shinozaki, “Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis,” Plant Cell, vol. 10, pp. 1391–1406, 1998. View at: Google Scholar
  26. K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method,” Methods, vol. 25, pp. 402–408, 2001. View at: Google Scholar
  27. R. B. Horsch, J. E. Fry, N. L. Hoffmann, D. Eichholtz, S. G. Rogers, and R. T. Fraley, “A simple and general method for transferring genes into plants,” Science, vol. 227, no. 4691, pp. 1229–1230, 1985. View at: Publisher Site | Google Scholar
  28. M.-L. Zhou, J.-T. Ma, Y.-M. Zhao, Y.-H. Wei, Y.-X. Tang, and Y.-M. Wu, “Improvement of drought and salt tolerance in Arabidopsis and Lotus corniculatus by overexpression of a novel DREB transcription factor from Populus euphratica,” Gene, vol. 506, no. 1, pp. 10–17, 2012. View at: Publisher Site | Google Scholar
  29. K. R. Jaglo, S. Kleff, K. L. Amundsen et al., “Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor cold-response pathway are conserved in Brassica napus and other plant species,” Plant Physiology, vol. 127, no. 3, pp. 910–917, 2001. View at: Publisher Site | Google Scholar
  30. J. G. Dubouzet, Y. Sakuma, Y. Ito et al., “OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt- and cold-responsive gene expression,” Plant Journal, vol. 33, no. 4, pp. 751–763, 2003. View at: Publisher Site | Google Scholar
  31. X. Wang, J. Dong, Y. Liu, and H. Gao, “A novel dehydration-responsive element-binding protein from Caragana korshinskii is involved in the response to multiple abiotic stresses and enhances stress tolerance in transgenic tobacco,” Plant Molecular Biology Reporter, vol. 28, no. 4, pp. 664–675, 2010. View at: Publisher Site | Google Scholar
  32. J. Sun, X. Peng, W. Fan, M. Tang, J. Liu, and S. Shen, “Functional analysis of BpDREB2 gene involved in salt and drought response from a woody plant Broussonetia papyrifera,” Gene, vol. 535, no. 2, pp. 140–149, 2014. View at: Publisher Site | Google Scholar
  33. Z. F. Cao, J. Li, F. Chen, Y. Q. Li, H.-M. Zhou, and Q. Liu, “Effect of two conserved amino acid residues on DREB1A function,” Biochemistry (Moscow), vol. 66, no. 6, pp. 623–627, 2001. View at: Publisher Site | Google Scholar
  34. L. Mondini, M. Nachit, E. Porceddu, and M. A. Pagnotta, “Identification of SNP mutations in DREB1, HKT1, and WRKY1 genes involved in drought and salt stress tolerance in durum wheat (Triticum turgidum L. var durum),” OMICS, vol. 16, no. 4, pp. 178–187, 2012. View at: Publisher Site | Google Scholar
  35. P. E. Verslues and J.-K. Zhu, “Before and beyond ABA: upstream sensing and internal signals that determine ABA accumulation and response under abiotic stress,” Biochemical Society Transactions, vol. 33, no. 2, pp. 375–379, 2005. View at: Google Scholar
  36. T. Hirayama and K. Shinozaki, “Perception and transduction of abscisic acid signals: keys to the function of the versatile plant hormone ABA,” Trends in Plant Science, vol. 12, no. 8, pp. 343–351, 2007. View at: Publisher Site | Google Scholar
  37. J. Mizoi, T. Ohori, T. Moriwaki et al., “GmDREB2A, a canonical dehydration-responsive element binding protein2-type transcription factor in soybean, is post translationally regulated and mediates dehydration-responsive element-dependent gene expression,” Plant Physiology, vol. 161, pp. 346–361, 2013. View at: Google Scholar
  38. L. Mondini, M. M. Nachit, E. Porceddu, and M. A. Pagnotta, “HRM technology for the identification and characterization of INDEL and SNPs mutations in genes involved in drought and salt tolerance of durum wheat,” Plant Genetic Resources: Characterisation and Utilisation, vol. 9, no. 2, pp. 166–169, 2011. View at: Publisher Site | Google Scholar
  39. C.-T. Wang, Q. Yang, and Y.-M. Yang, “Characterization of the ZmDBP4 gene encoding a CRT/DRE-binding protein responsive to drought and cold stress in maize,” Acta Physiologiae Plantarum, vol. 33, no. 2, pp. 575–583, 2011. View at: Publisher Site | Google Scholar
  40. X.-P. Li, A.-G. Tian, G.-Z. Luo, Z.-Z. Gong, J.-S. Zhang, and S.-Y. Chen, “Soybean DRE-binding transcription factors that are responsive to abiotic stresses,” Theoretical and Applied Genetics, vol. 110, no. 8, pp. 1355–1362, 2005. View at: Publisher Site | Google Scholar
  41. K. Yamaguchi-Shinozaki and K. Shinozaki, “Characterization of the expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and analysis of its promoter in transgenic plants,” MGG Molecular & General Genetics, vol. 236, no. 2-3, pp. 331–340, 1993. View at: Publisher Site | Google Scholar
  42. M. Ashraf and M. R. Foolad, “Roles of glycine betaine and proline in improving plant abiotic stress resistance,” Environmental and Experimental Botany, vol. 59, no. 2, pp. 206–216, 2007. View at: Publisher Site | Google Scholar
  43. Y. Ito, K. Katsura, K. Maruyama et al., “Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice,” Plant and Cell Physiology, vol. 47, no. 1, pp. 141–153, 2006. View at: Publisher Site | Google Scholar
  44. M. Cui, W. Zhang, Q. Zhang et al., “Induced over-expression of the transcription factor OsDREB2A improves drought tolerance in rice,” Plant Physiology and Biochemistry, vol. 49, no. 12, pp. 1384–1391, 2011. View at: Publisher Site | Google Scholar
  45. A. Tunnacliffe and M. J. Wise, “The continuing conundrum of the LEA proteins,” Naturwissenschaften, vol. 94, no. 10, pp. 791–812, 2007. View at: Publisher Site | Google Scholar

Copyright © 2015 Xu Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles