Journal of Diabetes Research

Journal of Diabetes Research / 2012 / Article
Special Issue

Autonomic Nervous System, Inflammation, and Diabetes: Mechanisms and Possible Interventions

View this Special Issue

Research Article | Open Access

Volume 2012 |Article ID 820989 | 6 pages | https://doi.org/10.1155/2012/820989

Regulation of LYRM1 Gene Expression by Free Fatty Acids, Adipokines, and Rosiglitazone in 3T3-L1 Adipocytes

Academic Editor: Maria Irigoyen
Received18 May 2011
Revised13 Aug 2011
Accepted18 Aug 2011
Published26 Oct 2011

Abstract

LYR motif containing 1 (LYRM1) is a novel gene that is abundantly expressed in the adipose tissue of obese subjects and is involved in insulin resistance. In this study, free fatty acids (FFAs) and tumor necrosis factor-α (TNF-α) are shown to upregulate LYRM1 mRNA expression in 3T3-L1 adipocytes. Conversely, resistin and rosiglitazone exert an inhibitory effect on LYRM1 mRNA expression. These results suggest that the expression of LYRM1 mRNA is affected by a variety of factors that are related to insulin sensitivity. LYRM1 may be an important mediator in the development of obesity-related insulin resistance.

1. Introduction

Obesity has become a global public health problem in recent decades [1]. Type 2 diabetes is characterized by an inadequate beta-cell response to progressive insulin resistance, which is typically accompanied by weight gain [2]. The increasing global prevalence of type 2 diabetes is tied to rising rates of obesity [3]. Common obesity (complex polygenic obesity) results from interactions between genetic, environmental, and psychosocial factors [4]. However, the mechanisms underlying individual differences that lead to a predisposition to obesity remain obscure.

In our earlier studies, we isolated and characterized LYR motif containing 1 (LYRM1), a novel human gene that was expressed at a high level in the omental adipose tissue of obese patients. LYRM1 promotes preadipocyte proliferation and inhibits apoptosis of preadipocytes [5, 6]. Overexpression of LYRM1 in 3T3-L1 adipocytes resulted in a reduction of insulin-stimulated glucose uptake, an abnormal mitochondrial morphology, decreased intracellular ATP synthesis, and decreased mitochondrial membrane potentials. In addition, LYRM1 overexpression led to an excessive production of intracellular reactive oxygen species [7]. Our findings indicate that LYRM1 may be a new candidate gene related to obesity-associated insulin resistance.

Several studies have shown that adipose tissue in obese patients releases large amounts of free fatty acids (FFAs) and several adipokines, including tumor necrosis factor-α (TNF-α) and resistin [811]. All of these factors have been identified as major regulators of insulin activity. A synthetic activator of peroxisome proliferator-activated receptor-γ (PPAR-γ) called rosiglitazone (BRL49653) is part of the thiazolidinedione (TZD) class of drugs. Thiazolidinedione is one of a few classes of drugs that acts primarily as an insulin sensitizer by repressing, in mature adipocytes, the expression and secretion of adipokines [12]. However, the underlying molecular mechanisms of how these factors affect insulin sensitivity have not been clarified.

In this study, we show that LYRM1 is a novel gene related to obesity-associated insulin resistance. We hypothesize that these factors (FFAs, TNF-α, and resistin) and drug (rosiglitazone) may have a potential regulatory mechanism in obesity through the regulation of LYRM1 mRNA expression, thereby affecting insulin sensitivity. The purpose of this study was to investigate the effects of FFAs, TNF-α, resistin, and rosiglitazone on LYRM1 mRNA expression in 3T3-L1 adipocytes.

2. Materials and Methods

2.1. 3T3-L1 Cell Culture and Treatment

3T3-L1 cells were cultured, maintained, and differentiated as previously described [13]. Briefly, after confluence was achieved, the cells were grown for 2 days in DMEM/high-glucose medium (Gibco, Carlsbad, Calif, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, Calif, USA), in a 5% CO2 environment. Differentiation was subsequently induced by incubation in a similar medium that was supplemented with 0.5 mmol/L 3-isobuty-1-methylxanthine (MIX; Sigma, St. Louis, Mo, USA), 1 μmol/L dexamethasone (Sigma, St. Louis, Mo, USA), and 10 μg/mL insulin (Sigma, St. Louis, Mo, USA), for 2 days. The cells were then placed in a medium containing 10 μg/mL insulin for another 2 days. Afterwards, the medium was replaced with DMEM containing only 10% FBS, every 2 days.

On the eighth day after differentiation was induced, if more than 90% of the cells showed the morphological and biochemical properties of adipocytes, the cells were used for experiments. After overnight incubation in serum-free DMEM, the 3T3-L1 adipocytes were treated with either 10 ng/mL TNF-α (T7539), 60 ng/mL resistin (SRP4560), 0.5 μM rosiglitazone (375004), which were all dissolved in DMSO, or a 1 mM FFA cocktail composed of palmitic acid (p5585), oleic acid (O1008), and linoleic acid (L1376; Sigma, St. Louis, Mo, USA). The high FFA solution was prepared according to previously published methods [14, 15]. Briefly, the fatty acids were dissolved in 2% (w/v) fatty acid-free bovine serum albumin (BSA), with a stock concentration of 100 mM or an equivalent volume of vehicle. The stock solution was diluted 1 : 100 in DMEM to a final concentration of 1 mM. After 12 h or 24 h of incubation in the TNF-α, resistin rosiglitazone and high FFA solution, the adipocytes were collected for subsequent experiments.

2.2. Quantitative Real-Time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

Total RNA was extracted from 3T3-L1 adipocytes using Trizol reagent (Invitrogen, Carlsbad, Calif, USA). The extracted RNA was quantified by spectrophotometry at 260 nm. cDNA was synthesized from 1 μg of total RNA using an AMV Reverse Transcriptase Kit (Promega A3500; Promega, Madison, Wis, USA), according to the manufacturer’s instructions. Real-time RT-PCR was performed on an Applied Biosystems 7500 Sequence Detection System (ABI 7500 SDS; Foster City, Calif, USA) by following the manufacturer’s protocol.

Two primer sets were used for PCR analysis. A 259-bp DNA fragment within the LYRM1 gene was used for the quantification of LYRM1 mRNA. The PCR product had previously been cloned into the plasmid pMD-T 18 and verified by DNA sequencing. Plasmid standards of known copy numbers were used to generate a log-linear standard curve, from which the copy numbers of LYRM1 could be determined by real-time qPCR. A 110-bp region of the β-actin gene was used to normalize the results. A standard curve was generated from plasmids containing the β-actin fragment. This standard curve was used to determine the copy numbers of β-actin. Briefly, the samples were incubated at 95°C for 10 min for an initial denaturation, followed by 40 PCR cycles. Each cycle consisted of an incubation at 95°C for 15 s and annealing at 60°C for 1 min. The concentration ratio of LYRM1 to β-actin reflected the expression level of LYRM1 mRNA per cell. Primer and Taqman probe (Invitrogen, Shanghai, China) sequences are shown in Table 1.


GeneForward primer (5′–3′)ProbeReverse primer (5′–3′)

LYRM1CAGATGGATAGGGCGTGGATAAGGTGGTAATGCAGTCCAATCTCAATCCGGACAGCAGCAACCCGACAAGAAGT
β-actinCCTGAGGCTCTTTTCCAGCCTCCTTCTTGGGTATGGAATCCTGTGGCTAGAGGTCTTTACGGATGTCAACGT

2.3. Statistical Analysis

Each experiment was performed at least three times. All data was expressed as means ± SD. Statistical analysis was performed using one-way ANOVA using the SPSS 12.0 statistical software package (SPSS Inc., Chicago, Ill, USA). For all tests, -values less than 0.05 were considered statistically significant.

3. Results

3.1. The Expression of LYRM1 mRNA during the Conversion of 3T3-L1 Preadipocytes into Adipocytes

LYRM1 mRNAs were expressed at very low levels In the 3T3-L1 preadipocytes. During the conversion of 3T3-L1 cells to adipocytes, the expression of the LYRM1 gene was gradually increased to reach a stable level after the 10th day (Figure 1). More than 90% of the cells exhibited typical adipocyte morphology on the 10th day.

3.2. The Effect of FFAs on the Expression of LYRM1 mRNA in 3T3-L1 Adipocytes

To assess the effect of FFAs on LYRM1 mRNA levels, we examined the expression of LYRM1 mRNA in 3T3-L1 adipocytes treated with 1 mM FFAs. Treatment durations were for either 12 or 24 h, 10 days after differentiation was stimulated. We found that FFAs concentrations of 1 mM led to a time-dependent increase in LYRM1 mRNA expression. LYRM1 mRNA expression dramatically increased after 12 h of exposure (Figure 2) and continued to increase after a 24 h exposure. At this time point, the expression of LYRM1 mRNA was approximately 2-fold greater than the control mRNA ( ). This result shows that FFAs dramatically increased the mRNA expression level of the LYRM1 gene.

3.3. The Effects of TNF-α and Resistin on the Expression of LYRM1 mRNA in 3T3-L1 Adipocytes

We examined LYRM1 mRNA expression 10 days after differentiation was stimulated in 3T3-L1 adipocytes, which had been treated with 10 ng/mL TNF-α or 60 ng/mL resistin. TNF-α slightly increased LYRM1 mRNA expression in 3T3-L1 adipocytes after 12 h. mRNA expression continued to increase 24 h after treatment ( ; Figure 3). Resistin showed a moderate inhibitory effect on LYRM1 gene expression at 12 h; however, expression was significantly diminished 24 h after resistin treatment ( ; Figure 4).

3.4. The Effect of Rosiglitazone on the Expression of LYRM1 mRNA in 3T3-L1 Adipocytes

To study the relationship between LYRM1 expression and a PPAR-γ agonist, we examined the effect of rosiglitazone at 60 ng/mL on 3T3-L1 adipocytes. Twelve hours after treatment, LYRM1 mRNA expression in 3T3-L1 adipocytes decreased. After 24 h mRNA expression had significantly diminished to approximately half that of the control ( ; Figure 5).

4. Discussion

The World Health Organization reports that at least one billion adults are overweight and 300 million are obese. In the absence of intervention, these numbers are expected to rise [16]. Most obese individuals are insulin resistant, which is an important etiological factor for type 2 diabetes mellitus. Adipocytes are known to secrete a variety of mediators, including FFA, TNF-α, and resistin, all of which regulate insulin signaling and glucose uptake. LYRM1 is a recently discovered gene that is involved in obesity-associated insulin resistance [5, 7]. LYRM1 mRNA expression is upregulated during conversion of 3T3-L1 cells to adipocytes, indicating that the expression of the LYRM1 gene is involved in adipocyte differentiation. From the 10th day after induction of differentiation, the LYRM1 mRNA expression remained at a stable high level, indicating that this clonal cell line can be used to investigate the regulation of LYRM1 gene expression. To elucidate the mechanisms by which LYRM1 is involved in the pathogenesis of obesity-associated insulin resistance, we characterized how this gene is regulated by factors that modulate insulin sensitivity. Furthermore, we also investigated the effects of rosiglitazone, which is a PPAR-γ agonist, on LYRM1 mRNA expression in 3T3-L1 adipocytes.

Elevated concentrations of circulating free fatty acids are characteristic of type 2 diabetes and are implicated in the etiology of insulin resistance [17]. Insulin resistance is thought to arise from impaired insulin signaling in target tissues. Signaling is impaired due to augmentation of the serine/threonine phosphorylation sites of insulin receptor substrates (IRS-1 and IRS-2). In addition, insulin resistance is compounded by a reduction of activated PI3-kinase (PI3K) and an inhibition in the translocation of insulin-stimulated glucose transporter 4 (GLUT4) [18, 19]. An excess of FFAs causes the intracellular accumulation of metabolic products such as ceramides, diacylglycerol, or acyl-CoA. These FFA-derived products may lead to defects in insulin signaling and glucose transport through the PI3K-dependent pathway [20, 21]. However, the underlying mechanisms of these phenomena have not been clarified. In this study, we observed that FFAs added exogenously upregulated LYRM1 mRNA expression in 3T3-L1 adipocytes. We had previously shown that LYRM1 overexpression can inhibit insulin-stimulated glucose transport in adipocytes [7]. We observed that an excess of FFAs might induce insulin resistance. Resistance could partly be induced through the upregulation of LYRM1 expression, which would inhibit glucose uptake in adipocytes. These findings support and extend other results in the literature that investigate the effects of FFAs on insulin signaling.

As one of the most widely studied cytokines, TNF-α is reported to modulate insulin resistance [10]. A key role for TNF-α in obesity-related insulin resistance was identified when TNF-α or TNF-α receptors were deleted in both diet-induced obese mice and leptin-deficient ob/ob mice, which resulted in significantly improved insulin sensitivity [22]. However, the infusion of TNF-α-neutralizing antibodies into obese, insulin-resistant subjects, or type 2 diabetic patients, did not improve insulin sensitivity [23, 24]. In this study, we observed that TNF-α slightly upregulates LYRM1 mRNA expression in 3T3-L1 adipocytes. There is a need for further studies in human adipocytes. Currently, we suggest that TNF-α-induced insulin resistance is only indirectly involved in increased LYRM1 expression.

Resistin was identified as a gene that was downregulated by TZD in mouse adipocytes [11]. In rodents, the circulating levels of resistin increased in obesity [25]. Furthermore, an increase in serum resistin levels induced insulin resistance in several rat and mouse models, including after acute administration [26]. Recombinant resistin caused severe hepatic insulin resistance in rodents [26]. However, a study observed a decrease in fasting glucose, improved glucose tolerance and enhanced insulin sensitivity in resistin knockout mice [27]. In humans, there is considerable controversy surrounding the role of resistin. We showed that resistin exerts a moderate inhibitory effect on LYRM1 gene expression in 3T3-L1 adipocytes. This data suggests that LYRM1 and resistin interact during the development of obesity-associated insulin resistance.

In this study, we observed that rosiglitazone inhibits LYRM1 gene expression in 3T3-L1 adipocytes. Rosiglitazone is part of the TZD class of drugs, which act as insulin sensitizers and agonists for the transcription factor PPAR-γ. PPAR-γ is a member of three nuclear receptor isoforms (the other two are PPAR-α and PPAR-δ), which are encoded by different genes. PPAR-γ is the master regulator of adipogenesis, being both essential and sufficient for adipocyte differentiation [28]. It also upregulates the expression of fatty acid transporter proteins (FATP-1 and D036) [29]. Rosiglitazone suppresses TNF-α mediated inhibition of adipocyte differentiation, whilst TNF-α decreased the expression of PPAR-γ [30]. TZDs inhibit resistin gene expression in human macrophages [31, 32] and lower serum resistin levels in humans as well as rodents [3335]. We deduced that rosiglitazone inhibits LYRM1 gene expression most likely through PPAR-γ.

Our results demonstrate that LYRM1 mRNA expression is greatly affected by rosiglitazone, FFAs, and two adipokines, TNF-α and resistin. These two adipokines are involved in the regulation of insulin sensitivity. The upregulation or downregulation of LYRM1 expression may be strongly linked to FFA or rosiglitazone-related insulin resistance. Recently, LYRM1 in rat myoblasts has been shown to negatively regulate the function of IRS-1 and PI3K/Akt, whilst decreasing GLUT4 translocation and glucose uptake in response to insulin (L6) [36]. However, a more precise characterization of the physiological activities of LYRM1 is required to fully understand these processes.

Conflict of Interests

Relevant to this paper, no potential conflict of interests is declared by the authors.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (Grant no. 30801256 and 81000348), Program of Medical Leading Talent in Jiangsu Province (Grant no. LJ200624), the Natural Science Foundation of Jiangsu Province (Grant no. BK2011040), and the Nanjing Municipal Foundation for Medical Science Development (ZKX09012). Min Zhang, Hai-Ming Zhao and Zhen-Ying Qin contributed equally to this work.

References

  1. R. W. Jeffery and N. E. Sherwood, “Is the obesity epidemic exaggerated? No,” BMJ, vol. 336, no. 7638, p. 245, 2008. View at: Publisher Site | Google Scholar
  2. M. Stumvoll, B. J. Goldstein, and T. W. van Haeften, “Type 2 diabetes: pathogenesis and treatment,” The Lancet, vol. 371, no. 9631, pp. 2153–2156, 2008. View at: Publisher Site | Google Scholar
  3. P. Zimmet, K. G. M. Alberti, and J. Shaw, “Global and societal implications of the diabetes epidemic,” Nature, vol. 414, no. 6865, pp. 782–787, 2001. View at: Publisher Site | Google Scholar
  4. A. J. Walley, J. E. Asher, and P. Froguel, “The genetic contribution to non-syndromic human obesity,” Nature Reviews Genetics, vol. 10, no. 7, pp. 431–442, 2009. View at: Publisher Site | Google Scholar
  5. J. Qiu, C. L. Gao, M. Zhang et al., “LYRM1, a novel gene promotes proliferation and inhibits apoptosis of preadipocytes,” European Journal of Endocrinology, vol. 160, no. 2, pp. 177–184, 2009. View at: Publisher Site | Google Scholar
  6. J. Qiu, Y. H. Ni, H. X. Gong et al., “Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization,” Biochemical and Biophysical Research Communications, vol. 352, no. 2, pp. 469–478, 2007. View at: Publisher Site | Google Scholar
  7. X. G. Cao, C. Z. Kou, Y. P. Zhao et al., “Overexpression of LYRM1 induces mitochondrial impairment in 3T3-L1 adipocytes,” Molecular Genetics and Metabolism, vol. 101, no. 4, pp. 395–399, 2010. View at: Publisher Site | Google Scholar
  8. G. H. Goossens, “The role of adipose tissue dysfunction in the pathogenesis of obesity-related insulin resistance,” Physiology and Behavior, vol. 94, no. 2, pp. 206–218, 2008. View at: Publisher Site | Google Scholar
  9. K. Maeda, K. T. Uysal, L. Makowski et al., “Role of the fatty acid binding protein mal1 in obesity and insulin resistance,” Diabetes, vol. 52, no. 2, pp. 300–307, 2003. View at: Publisher Site | Google Scholar
  10. G. S. Hotamisligil, N. S. Shargill, and B. M. Spiegelman, “Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance,” Science, vol. 259, no. 5091, pp. 87–91, 1993. View at: Google Scholar
  11. C. M. Steppan, S. T. Bailey, S. Bhat et al., “The hormone resistin links obesity to diabetes,” Nature, vol. 409, no. 6818, pp. 307–312, 2001. View at: Publisher Site | Google Scholar
  12. P. Wang, J. Renes, F. Bouwman, A. Bunschoten, E. Mariman, and J. Keijer, “Absence of an adipogenic effect of rosiglitazone on mature 3T3-L1 adipocytes: increase of lipid catabolism and reduction of adipokine expression,” Diabetologia, vol. 50, no. 3, pp. 654–665, 2007. View at: Publisher Site | Google Scholar
  13. A. K. Student, R. Y. Hsu, and M. D. Lane, “Induction of fatty acid synthetase synthesis in differentiating 3T3-L1 preadipocytes,” Journal of Biological Chemistry, vol. 255, no. 10, pp. 4745–4750, 1980. View at: Google Scholar
  14. A. R. Subauste and C. F. Burant, “Role of FoxO1 in FFA-induced oxidative stress in adipocytes,” American Journal of Physiology, vol. 293, no. 1, pp. E159–E164, 2007. View at: Google Scholar
  15. A. Schaeffler, P. Gross, R. Buettner et al., “Fatty acid-induced induction of Toll-like receptor-4/nuclear factor-κB pathway in adipocytes links nutritional signalling with innate immunity,” Immunology, vol. 126, no. 2, pp. 233–245, 2009. View at: Publisher Site | Google Scholar
  16. M. F. Gregor and G. S. Hotamisligil, “Inflammatory Mechanisms in Obesity,” Annual Review of Immunology, vol. 29, pp. 415–445, 2011. View at: Publisher Site | Google Scholar
  17. R. N. Bergman and M. Ader, “Free fatty acids and pathogenesis of type 2 diabetes mellitus,” Trends in Endocrinology and Metabolism, vol. 11, no. 9, pp. 351–356, 2000. View at: Publisher Site | Google Scholar
  18. P. R. Shepherd, “Mechanisms regulating phosphoinositide 3-kinase signalling in insulin-sensitive tissues,” Acta Physiologica Scandinavica, vol. 183, no. 1, pp. 3–12, 2005. View at: Publisher Site | Google Scholar
  19. J. H. Lim, J. I. Lee, Y. H. Suh, W. Kim, J. H. Song, and M. H. Jung, “Mitochondrial dysfunction induces aberrant insulin signalling and glucose utilisation in murine C2C12 myotube cells,” Diabetologia, vol. 49, no. 8, pp. 1924–1936, 2006. View at: Publisher Site | Google Scholar
  20. C. Yu, Y. Chen, G. W. Cline et al., “Mechanism by which fatty acids inhibit insulin activation of insulin receptor substrate-1 (IRS-1)-associated phosphatidylinositol 3-kinase activity in muscle,” Journal of Biological Chemistry, vol. 277, no. 52, pp. 50230–50236, 2002. View at: Publisher Site | Google Scholar
  21. Z. Gao, X. Zhang, A. Zuberi et al., “Inhibition of insulin sensitivity by free fatty acids requires activation of multiple serine kinases in 3T3-L1 adipocytes,” Molecular Endocrinology, vol. 18, no. 8, pp. 2024–2034, 2004. View at: Publisher Site | Google Scholar
  22. K. T. Uysal, S. M. Wiesbrock, M. W. Marino, and G. S. Hotamisligil, “Protection from obesity-induced insulin resistance in mice lacking TNF- alpha function,” Nature, vol. 389, no. 6651, pp. 610–614, 1997. View at: Publisher Site | Google Scholar
  23. H. Dominguez, H. Storgaard, C. Rask-Madsen et al., “Metabolic and vascular effects of tumor necrosis factor-alpha blockade with etanercept in obese patients with type 2 diabetes,” Journal of Vascular Research, vol. 42, no. 6, pp. 517–525, 2005. View at: Publisher Site | Google Scholar
  24. L. E. Bernstein, J. Berry, S. Kim, B. Canavan, and S. K. Grinspoon, “Effects of etanercept in patients with the metabolic syndrome,” Archives of Internal Medicine, vol. 166, no. 8, pp. 902–908, 2006. View at: Publisher Site | Google Scholar
  25. M. W. Rajala, Y. Qi, H. R. Patel et al., “Regulation of resistin expression and circulating levels in obesity, diabetes, and fasting,” Diabetes, vol. 53, no. 7, pp. 1671–1679, 2004. View at: Publisher Site | Google Scholar
  26. M. W. Rajala, S. Obici, P. E. Scherer, and L. Rossetti, “Adipose-derived resistin and gut-derived resistin-like molecule-beta selectively impair insulin action on glucose production,” Journal of Clinical Investigation, vol. 111, no. 2, pp. 225–230, 2003. View at: Publisher Site | Google Scholar
  27. R. R. Banerjee, S. M. Rangwala, J. S. Shapiro et al., “Regulation of fasted blood glucose by resistin,” Science, vol. 303, no. 5661, pp. 1195–1198, 2004. View at: Publisher Site | Google Scholar
  28. E. D. Rosen, C. H. Hsu, X. Wang et al., “C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway,” Genes and Development, vol. 16, no. 1, pp. 22–26, 2002. View at: Publisher Site | Google Scholar
  29. H. Bays, L. Mandarino, and R. A. DeFronzo, “Role of the adipocyte, free fatty acids, and ectopic fat in pathogenesis of type 2 diabetes mellitus: peroxisomal proliferator-activated receptor agonists provide a rational therapeutic approach,” Journal of Clinical Endocrinology and Metabolism, vol. 89, no. 2, pp. 463–478, 2004. View at: Publisher Site | Google Scholar
  30. D. Szalkowski, S. White-Carrington, J. Berger, and B. Zhang, “Antidiabetic thiazolidinediones block the inhibitory effect of tumor necrosis factor-alpha on differentiation, insulin-stimulated glucose uptake, and gene expression in 3T3-L1 cells,” Endocrinology, vol. 136, no. 4, pp. 1474–1481, 1995. View at: Google Scholar
  31. L. Patel, A. C. Buckels, I. J. Kinghorn et al., “Resistin is expressed in human macrophages and directly regulated by PPAR gamma activators,” Biochemical and Biophysical Research Communications, vol. 300, no. 2, pp. 472–476, 2003. View at: Publisher Site | Google Scholar
  32. M. Lehrke, M. P. Reilly, S. C. Millington, N. Iqbal, D. J. Rader, and M. A. Lazar, “An inflammatory cascade leading to hyperresistinemia in humans,” PLoS Medicine, vol. 1, no. 2, p. e45, 2004. View at: Publisher Site | Google Scholar
  33. H. S. Jung, B. S. Youn, Y. M. Cho et al., “The effects of rosiglitazone and metformin on the plasma concentrations of resistin in patients with type 2 diabetes mellitus,” Metabolism, vol. 54, no. 3, pp. 314–320, 2005. View at: Publisher Site | Google Scholar
  34. D. Kamin, C. Hadigan, M. Lehrke, S. Mazza, M. A. Lazar, and S. Grinspoon, “Resistin levels in human immunodeficiency virus-infected patients with lipoatrophy decrease in response to rosiglitazone,” Journal of Clinical Endocrinology and Metabolism, vol. 90, no. 6, pp. 3423–3426, 2005. View at: Publisher Site | Google Scholar
  35. Y. Miyazaki, L. Glass, C. Triplitt et al., “Effect of rosiglitazone on glucose and non-esterified fatty acid metabolism in type II diabetic patients,” Diabetologia, vol. 44, no. 12, pp. 2210–2219, 2001. View at: Publisher Site | Google Scholar
  36. C. Kou, X. Cao, D. Qin et al., “Over-expression of LYRM1 inhibits glucose transport in rat skeletal muscles via attenuated phosphorylation of PI3K (p85) and Akt,” Molecular and Cellular Biochemistry, vol. 348, no. 1-2, pp. 149–154, 2010. View at: Publisher Site | Google Scholar

Copyright © 2012 Min Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

932 Views | 543 Downloads | 0 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.