Prevalence of Multidrug-Resistant <i>Listeria monocytogenes</i> in Dairy Products with Reduction Trials Using Rosmarinic Acid, Ascorbic Acid, Clove, and Thyme Essential Oils

Elafify, Mahmoud; Elabbasy, Mohamed Tharwat; Mohamed, Rasha Samir; Mohamed, Esraa A.; Saad Eldin, Walaa Fathy; Darwish, Wageh Sobhy; Eldrehmy, Essam Hassan; Shata, Radwa Reda

doi:https://doi.org/10.1155/2022/9696927

Journal of Food Quality

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusions Data Availability Ethical Approval Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2022 | Article ID 9696927 | https://doi.org/10.1155/2022/9696927

Prevalence of Multidrug-Resistant Listeria monocytogenes in Dairy Products with Reduction Trials Using Rosmarinic Acid, Ascorbic Acid, Clove, and Thyme Essential Oils

Mahmoud Elafify,¹Mohamed Tharwat Elabbasy,^2,3Rasha Samir Mohamed,⁴Esraa A. Mohamed,⁵Walaa Fathy Saad Eldin,⁶Wageh Sobhy Darwish,³Essam Hassan Eldrehmy,^7,8and Radwa Reda Shata¹

Academic Editor: Ahmed A. Tayel

Received10 Dec 2021

Accepted16 Feb 2022

Published12 Mar 2022

Abstract

Continuous monitoring of Listeria spp., particularly Listeria monocytogenes, in foods is a mandatory task for food safety and microbiology sectors. This study aimed to determine the prevalence and antimicrobial resistance patterns of L. monocytogenes in milk and dairy products retailed in Egypt. Furthermore, an experimental trial was conducted to investigate the antilisterial effects of some phytochemicals. A total of 200 samples (market raw milk, Kareish cheese, Damietta cheese, and plain yoghurt, 50 each) were collected and examined for detection of Listeria spp. The results revealed that 8, 12, 1, and 0 samples of market raw milk, Damietta cheese, Kareish cheese, and plain yoghurt were contaminated with Listeria spp., respectively. Antimicrobial sensitivity testing revealed that all L. monocytogenes isolates (15) were resistant to streptomycin and erythromycin. Molecular analysis revealed that 86.67% of L. monocytogenes harbored hylA virulent gene. Use of rosmarinic acid, ascorbic acid, thyme, and clove essential oils significantly () reduced L. monocytogenes growth in soft cheese—artificially contaminated with L. monocytogenes throughout a 4-week incubation period. In conclusion, strict hygienic conditions should be adopted during the preparation and distribution of dairy products. In addition, rosmarinic acid, ascorbic acid, clove, and thyme essential oils are good candidates as food preservatives with antilisterial activities.

1. Introduction

Contamination of milk and dairy products during processing and storage by food poisoning organisms is still a significant concern in dairy plants [1, 2]. More than 250 various illnesses have been reported to be transmitted via the consumption of contaminated foods [3]. Among the causative agents of such food-borne illnesses, Listeria monocytogenes (L. monocytogenes) has been allocated. The pathogenicity of L. monocytogenes is attributed to its resistance to a wide range of environmental stressors. It can withstand chilling, thermal, and osmotic stressors [4].

Until now, L. monocytogenes is isolated from ready-to-eat (RTE) foods such as milk, cheese, seafood, and vegetables. For instance, L. monocytogenes was isolated from raw milk, cheese, and butter at 29.2%, 14.1%, and 4%, respectively, in Yazd, central Iran [5]. Also, in Faisalabad, L. monocytogenes was detected in unheated dairy products such as raw milk at 17.78% and cheese at 5.55% [6].

The common preservation methods as chilling and osmotic stressors are used to minimize and reduce the growth of L. monocytogenes. Still, these methods are not adequate enough for preventing the growth of the pathogen. Furthermore, L. monocytogenes had acquired genetic changes and virulence factors to withstand such preservation methods [4].

Although the proper pasteurization of milk and dairy products might be a protective method for inhibiting L. monocytogenes growth, postpasteurization contamination is still a possible way to transmit food-borne pathogens [7, 8]. As reported before, pasteurized milk distributed to various markets was shown to be contaminated with L. monocytogenes due to the postpasteurization contamination [9, 10]. Furthermore, overheat treatment has a negative effect on the quality of milk and dairy products because of protein denaturation, loss of vitamins, and undesirable changes in the flavor [11].

The food industry sector is seeking for safe and friendly candidates to act as food preservatives. In this direction, several natural substances had been established to suppress the growth of pathogens in milk and dairy products. D-tryptophan is a natural amino acid that revealed inhibitory activities against Salmonella spp. in contaminated cheese [12]. Also, olive oil extract showed an inhibitory effect against Bacillus cereus’ vegetative cells in contaminated milk [13]. Rosemary is one of the most popular phytochemicals cultivated worldwide and is used as a flavoring agent and possesses antioxidant and antimicrobial properties [14]. Ascorbic acid has also several beneficial functions in maintaining the level of collagen, wound healing, as an antioxidant, and with antimicrobial activities against several pathogens like Staphylococcus aureus, Campylobacter spp., and Mycobacterium tuberculosis [15]. Clove is one of the phytochemicals with several medical applications as an antiseptic, analgesic, and antimicrobial, and the Food and Drug Administration recognized it as a safe food additive [16]. Thyme is another phytochemical that has antispasmodic and antimicrobial activities and is also a safe food preservative [17]. However, the antilisterial activities of such phytochemicals have received less attention. Thus, this study first aimed at the investigation of the prevalence of Listeria spp., particularly L. monocytogenes, in various cow’s dairy products retailed in Egypt. Second, the antimicrobial resistance profiling of the recovered L. monocytogenes isolates was further screened using the disk diffusion method. In an experimental trial, the antilisterial activities of rosmarinic acid, ascorbic acid, clove, and thyme essential oils were examined using soft cheese as a food matrix.

2. Materials and Methods

2.1. Collection and Preparation of Samples

A total of 200 samples of dairy products (market raw milk, Kareish cheese, Damietta cheese, and plain yoghurt, 50 each) were collected from healthy animals at dairy farms, various shops, and supermarkets in Mansoura, Tanta, and Zagazig cities, Egypt. All collected samples were transferred and cooled in an insulated box and were microbiologically examined on the same day at either the Food Control Department, Faculty of Veterinary Medicine, Mansoura University, or the Department of Medical Microbiology and Immunology, Faulty of Medicine, Tanta University, Egypt.

About 25 g of all examined dairy product samples, except raw milk and yoghurt, was aseptically mixed well with 225 ml of 0.1% bacteriological peptone and homogenized well via a blender, and this homogenate was incubated at 37°C/24 h, while raw milk and yoghurt were mixed well via a sterile spatula, and 25 ml of them was added to 225 ml of 0.1% bacteriological peptone and also incubated in the same way.

2.2. Isolation and Identification of Listeria spp

Isolation of Listeria spp. was performed according to Roberts et al. [18]. In a brief, 10 ml of each incubated homogenate was separately added to 90 ml of Listeria enrichment broth base (CM862, Oxoid) with Listeria selective enrichment supplement (Nalidixic acid, cycloheximide, and acriflavine hydrochloride) (SR141, Oxoid) and incubated at 37°C/48 h. Subsequently, a loopful was taken from the enriched broth and streaked onto Oxford agar plates as a selective media (CM856, Oxoid) supplemented with Listeria selective supplement (SR140, Oxoid) and incubated at 37^oC/48h. At least five olive green colonies surrounded by black zones were picked up for further purification on the same media and stored in glycerol 15% at −80°C for further examination.

The representative stored colonies were refreshed onto tryptone soy agar (CM0131, Oxoid) supplemented with 0.6% yeast extract and incubated at 37°C/48 h. The refreshed isolates were microscopically examined (Listeria spp. appeared as coccobacilli and nonsporulating bacteria), and then, the isolates were exposed for biochemical examination (catalase test, oxidase, and sugar fermentation tests including D-glucose, L-rhamnose, xylose, and mannitol) and typical umbrella motility at 25°C (Table 1) [19]. The isolates exhibited that the positive results were exposed to hemolysin production via using blood agar media (CM854, Oxoid) supplemented with 5% sheep blood. Furthermore, the CAMP test was applied against Staphylococcus aureus [22]. Finally, the expected isolates were subjected to serological identification using a Listeria latex agglutination kit (Oxoid, Basingstoke, Hampshire, England) [23]. All procedures were carried out according to the manufacturer’s instructions.

2.3. Antimicrobial Susceptibility Testing

The positive fifteen isolates of L. monocytogenes that revealed typical characteristics for the used biochemical tests were exposed to antimicrobial susceptibility testing using agar disk diffusion methods on Mueller-Hinton agar [24]. The tested antimicrobials were amikacin (AM) (30 µg); cefotaxime (CF) (30 µg); cephalothin (CN) (30 μg); chloramphenicol (C) (30 μg); ciprofloxacin (CP) (5 μg); erythromycin (E) (15 μg); gentamicin (G) (10 μg); kanamycin (K) (30 μg); nalidixic acid (NA) (30 μg); neomycin (N) (30 μg); streptomycin (S) (10 μg); ampicillin (AM) (10 μg) oxytetracycline (T) (30 μg); and trimethoprim-sulfamethoxazole (SXT) (25 μg). The interpretation of the results was performed according to CLSI [25]. Multiple antibiotic resistance index was calculated according to the equation established by Singh et al. [26]:

MAR index = Number of resistance (isolates classified as intermediate were calculated as sensitive for MAR index) antibiotics/total number of antibiotics tested.

2.4. DNA Extraction

Bacterial DNA from three to five juvenile refreshed colonies of L. monocytogenes isolates was extracted using GeneJET Genomic DNA Purification Kit (Fermentas) according to the manufacturer’s instruction.

2.5. Detection of hlyA Gene as a Virulent Gene of L. monocytogenes

L. monocytogenes isolates were screened for detection of listeriolysin O (hlyA) gene as a virulent gene presents only in the pathogenic types using PCR. The amplification was performed on a thermal cycler (Mastercycler, Eppendorf, Hamburg, Germany). The primer sequences were hylA (F) 5′ GCAGTTGCAAGCGCTTGGAGTGAA ′3 and hylA (R) 5′ GCAACGTATCCTCCAGAGTGATCG ′3 that used to produce 456 pb PCR products under the following protocol: an initial denaturation at 95°C for 2 min followed by 35 cycles each of 15-sec denaturation at 95°C and 30-sec annealing at 60°C and 1 min extension at 72°C, followed by a final extension of 10 min at 72°C and held at 4°C [27]. Amplified DNA fragments were run on 1.5% agarose gel electrophoresis (AppliChem, GmbH, Germany) in 1x TBE buffer stained with ethidium bromide and captured and visualized on a UV transilluminator.

2.6. Antilisterial Effects of Some Phytochemicals

2.6.1. Bacterial Preparations

Four strains of L. monocytogenes (ATCC7644, 19118, 15313, and 13932) were obtained from the American Type Culture Collection (Manassas, VA, USA) and were used in our experiment. All these isolates were stored at −80°C in tryptic soy broth (TSB; Merck) containing 15% glycerol. For refreshment of these isolates, a loopful was individually taken from each strain and cultured onto sterile TSB and incubated at 37°C/24 h and subsequently streaked onto tryptic soy agar (TSA), and all plates were incubated at 37°C/48 h. A single pure colony from each strain was taken via a sterile platinum loop and inoculated into an independent sterile of 10 mL TSB. Cocktail pathogen protocol was used in this experiment. Thus, equal volumes (1 mL) from each strain in inoculated TSB were collected and combined in a sterile plastic tube (10 mL) and mixed well through a vortex [9].

2.6.2. Preparation of the Tested Phytochemicals and Media

Rosmarinic and L-ascorbic acids were purchased from Sigma-Aldrich, CO, USA. Clove and thyme essential oils (100%) were locally purchased from the Animal Health Research Institute, Giza, Egypt. All used media as TSA and TSB were prepared according to the manufacturer’s instructions.

2.6.3. Screening of the Antilisterial Activities of the Tested Phytochemicals Using Agar Well Diffusion Method

The antimicrobial activity of phytochemical extracts was performed according to Mayo [28]. Briefly, L. monocytogenes strains were refreshed on Müeller-Hinton agar (Oxoid) at 37°C/24 h. A single pure colony from each strain was picked up, cultured in TSB, and incubated at 37°C/24 h. Then, 1 mL of each strain was combined into a sterile plastic tube. The infective dose was adjusted at 10⁵–10⁶ CFU/mL. Wells with 9 mm diameters had been performed in Müeller-Hinton agar, and then, 50 μL of each tested phytochemical at a concentration range between 0.5% and 3.0% (0.5% interval) was placed in the wells of Müeller-Hinton that previously streaked with L. monocytogenes. The incubated plates were kept at 4°C to allow the diffusion of the extracts onto the medium, and then, the incubation was followed at 37°C/24 h. Subsequently, the inhibition zones at the lowest concentrations were recorded and used in the experimental trials.

2.6.4. Preparation and Inoculation of Soft Cheese

Fresh soft cheese was prepared according to Youssef et al. [29], and cow’s raw milk was collected from dairy farms in Dakahlia province, Egypt, and pasteurized at 63^oC/30 min in a water bath and kept warm at 40°C. Sodium chloride (2% and 3%), calcium chloride (0.02 g/L), and the cocktail pathogens of L. monocytogenes were added to milk. Subsequently, the warmed milk was distributed onto clean and sterile vats. Then, the rennet (0.2 g/L) and one of the tested phytochemicals either rosmarinic acid (1%), ascorbic acid (3%), clove essential oil (2%), or thyme essential oil (2%) were separately added to the inoculated milk and incubated at 37°C/45–60 min. These concentrations were chosen based on the results of the antimicrobial activity of the pre-experiment. In parallel, control cheese samples were also manufactured in the same manner without any inhibitory phytochemicals. Once the coagulation was performed, the curd was separated from whey via a clean, sterilized drainage cloth. Then, the obtained cheese was kept in a sterile container at 4°C and 10°C for four weeks. Samples were collected each week and compared with the control to determine L. monocytogenes counts. Three independent trials, with three samples for each time point, were carried out at 4^oC and 10°C.

2.6.5. L. monocytogenes Counts in Cheese Samples

Under a complete septic condition, a tenfold serial dilution was performed for each collected sample via 0.1% sterile peptone water. The surface spreading method was used by culturing 100 μl aliquots of a suitable inoculated diluent onto sterile TSA followed by incubation at 37°C/18–24 h. All colonies were counted using a colony counter and compared with the control samples. The obtained results were converted into log10 CFU/g. Each experiment in each condition was carried out in triplicate (three independent trials).

2.7. Statistical Analysis

To examine the significant differences between the treated and control samples, one-way ANOVA was conducted to compare results at various treatments and concentrations. Statistical analyses were carried out using R statistical software (v. 3.5.2, R Foundation for Statistical Computing, Vienna) with a p value of 0.05 that is considered to be significant.

3. Results

3.1. Prevalence of Listeria spp. including L. monocytogenes in Milk and Dairy Products

In this study, the achieved results illustrated that 16%, 24%, and 2% of market raw milk, Damietta cheese, and Kariesh cheese were positive for Listeria spp., respectively, while Listeria spp. could not be recovered from yoghurt. Various types of Listeria spp. were biochemically identified from examined milk and dairy products as L. monocytogenes, L. innocua, L. ivanovii, L. grayi, L. seeligeri, and L. welshimeri (Table 1). Fifteen out of twenty-five isolates were confirmed as L. monocytogenes as 6, and 9 isolates were recovered from raw milk and Damietta cheese, respectively.

3.2. Antimicrobial Resistance and Virulence Characterization of L. monocytogenes

According to the biochemical tests and serological identification using Listeria latex agglutination kit (Oxoid, Basingstoke, Hampshire, England), fifteen isolates exhibited positive results for L. monocytogenes and these isolates were screened for their antimicrobial resistance and for detection of one of the most virulent genes (hylA) that is necessary for L. monocytogenes virulence (Tables 2 and 3). The results revealed that 100% of L. monocytogenes isolates were resistant to streptomycin and erythromycin. Also, L. monocytogenes were phenotypically resistant to oxytetracycline (86.67%), (nalidixic acid, sulfamethoxazole, cephalothin, and amikacin, 73.33% each) and cefotaxim (60%). Lower than 50% of L. monocytogenes isolates were resistant to chloramphenicol (46.67%), kanamycin (33.33%), neomycin (33.33%), gentamicin (13.33%), ampicillin (13.33%), and ciprofloxacin (6.67%). The average of MAR indices for the isolates recovered from milk and cheese was 0.607 and 0.539, respectively, with no significant difference (p = 0.4).

All L. monocytogenes isolates were genotypically examined for detection of hylA gene, and the results revealed that 13 (86.67%) out of 15 isolates harbored hylA gene.

3.3. Antilisterial Activities of Some Phytochemicals in Soft Cheese with 2% NaCl

The inhibitory effects of rosmarinic and ascorbic acids, and the essential oils of clove and thyme against L. monocytogenes were investigated. The survival counts of L. monocytogenes in soft cheese with 2% NaCl are shown in Figure 1. The results showed that rosmarinic acid 1% had a bacteriostatic effect against L. monocytogenes at 4°C, and L. monocytogenes counts were reduced by 4.6 log CFU/g during a 4-week treatment with a reduction percentage of 58.95%. Furthermore, essential oils of clove at 2%, thyme at 2%, and ascorbic acid at 3% showed a significant () reduction in L. monocytogenes counts by 5.0, 6.2, and 6.4 log CFU/g, respectively, during a nearly one-month storage period. Such reduction counts were 3.7, 5.0, 4.6, and 5.4 log CFU/g, after treatment with rosmarinic acid 1%, ascorbic acid 3%, and essential oils of both clove 2% and thyme 2%, respectively, in soft cheese artificially contaminated with L. monocytogenes and kept at 10°C (Figure 1, Table 4). It is noteworthy to confirm that storage of cheese at 4°C revealed a significant reduction than storage at 10°C in a combination with all tested additives.

(a)

(b)

Figure 1

Inhibitory effect of some phytochemicals, solid line (0% control), dotted line (3% ascorbic acid), dot-dashed line (1% rosmarinic acid), long-dashed line (2% clove oil), and dashed line (2% thyme oil), on the survival and growth of L. monocytogenes in experimentally contaminated soft cheese with 2% NaCl at (a) 4°C and (b) 10°C. Results are the mean ± SD of three independent trials at each sampling point. Value with different letters at the same incubation time means a significant difference ().

3.4. Antilisterial Activities of Some Phytochemicals in Soft Cheese with 3% NaCl

L. monocytogenes counts in artificially contaminated soft cheese (3% NaCl) stored at 4^oC and treated with rosmarinic acid (1%), and essential oils of clove (2%) and thyme (2%) exhibited a significant () reduction in L. monocytogenes count by 4.4, 5.0, and 6.2 log CFU/g, respectively, through the 4-week storage period. L. monocytogenes could not be detected in soft cheese treated with ascorbic acid 3% at a 4-week storage period. Increasing the refrigeration temperature up to 10°C exhibited a significant () reduction in L. monocytogenes count. Cotreatment of cheese with rosmarinic acid (1%), essential oils of clove (2%) and thyme (2%), and ascorbic acid (3%) had 4.1, 4.8, 5.6, and 5.9 log CFU/g reduction, respectively, in L. monocytogenes during the end of storage period (4 weeks) achieving a significant () reduction in L. monocytogenes count by 51.54%, 60.51%, 71.15%, and 75.38%, respectively (Figure 2, Table 5). Comparison of the results of Tables 4 and 5 showed that cotreatment of contaminated cheese containing a high salt content (3% NaCl) with the used antilisterial additives exhibited slightly higher reduction percentages in L. monocytogenes growth than low salt content (2% NaCl).

(a)

(b)

Figure 2

Inhibitory effect of some phytochemicals, solid line (0% control), dotted line (3% ascorbic acid), dot-dashed line (1% rosmarinic acid), long-dashed line (2% clove oil), and dashed line (2% thyme oil), on the survival and growth of L. monocytogenes in experimentally contaminated soft cheese with 3% NaCl at (a) 4°C and (b) 10°C. Results are the mean ± SD of three independent trials at each sampling point. Value with different letters at the same incubation time means a significant difference (). ND: not detected.

4. Discussion

L. monocytogenes represents a great challenge to the food safety sector because of its apparent resistance to a wide range of environmental stressors [4]. The achieved results indicated that 16% of market raw milk, 24% of Damietta cheese, and 2% of Kariesh cheese were contaminated with Listeria spp. particularly L. monocytogenes. Thus, these contaminated samples did not meet the national and international standards [20, 21], which confirm that dairy products must be free from L. monocytogenes. The results of this study go in agreement with a study conducted in Ethiopia, which revealed that 13% of raw milk was contaminated with Listeria spp. [30]. Similarly, in the USA, 12.6% of milk filters were contaminated with L. monocytogenes [31]. Besides, in Iran, 21.7% of raw milk was contaminated with Listeria spp. [32]. Additionally, Listeria spp. was isolated from raw milk in Iran at 29.2%, L. monocytogenes at 7.8%, and L. innocua at 15% [33]. In Egypt, L. monocytogenes was the prevalent Listeria spp., isolated from milk and dairy products in Assiut, Egypt [34]. Besides, seven raw milk samples were contaminated with L. monocytogenes, and 3 samples were contaminated with L. innocua in a recent study in Egypt [35].

Damietta cheese had the highest prevalence of L. monocytogenes. In general, the survival and growth of L. monocytogenes depend on several factors such as comparing microflora, pasteurization process, and pH [36]. A study reported that the suitable pH for the growth of L. monocytogenes is < 5.6 as in the case of soft cheese [37]. Damietta cheese is a common type of soft cheese consumed in Egypt. Its manufacture mainly depends on milk coagulation via rennet. Once the crude has been performed, it is cut into small blocks, followed by salting. This type of soft cheese is either consumed fresh (a few weeks to one month postsalting process) or as a ripened cheese. Therefore, the manufacture processes of Damietta cheese serve as ideal conditions for the growth of L. monocytogenes [36]. High isolation of L. monocytogenes in soft cheese was also reported before as Al-Ashmawy et al. [36] stated that 24% of Damietta cheese was contaminated with L. monocytogenes. Kariesh cheese came second in the prevalence of Listeria contamination. Kariesh cheese is another type of soft cheese that is commonly manufactured from unpasteurized milk in Egyptian villages. In agreement with the prevalence of L. monocytogenes in Kariesh cheese, L. monocytogenes was recovered from 3 Kariesh cheese samples in Egypt [38]. Furthermore, 4% of Kariesh cheeses were contaminated with L. monocytogenes [34]. However, another study failed to isolate L. monocytogenes from Kariesh cheese [39].

Yoghurt is one of the main fermented dairy products in Egypt. In this study, none of the examined yoghurt samples were contaminated with L. monocytogenes. This result agrees with other studies that failed to isolate L. monocytogenes from yoghurt [39, 40]. The absence of L. monocytogenes in the examined yoghurt samples might be attributed to the antimicrobial activities of some compounds secreted by lactic acid bacteria present in yoghurt [34].

The abuse of antimicrobials during animal farming and livestock production might lead to the development of antimicrobial resistance [12, 41]. The achieved results in this study revealed that 100% of the recovered L. monocytogenes isolates showed resistance against streptomycin and erythromycin, while more than 70% of the isolates showed resistance against oxytetracycline, nalidixic acid, sulfamethoxazole, cephalothin, and amikacin. These results are in agreement with a previous study that recorded 100% of L. monocytogenes isolated from cheese had resistance to tetracycline, streptomycin, and sulfamethoxazole [36]. However, more than 70% of the recovered isolates were susceptible to gentamicin, ampicillin, and ciprofloxacin. This agrees with a previous study that reported the susceptibility of L. monocytogenes isolated from cheese to gentamicin [42].

There are many important virulence genes for Listeria spp. such as as prfA, inlA, inlB, and irpA, and others, but the most virulence factor associated with L. monocytogenes is listeriolysin O (LLO) that is produced by the microorganism and encoded by hlyA gene, and the LLO-encoding gene (hlyA) presents only in the virulent strains of Listeria spp. and is urgently required for their virulence [35]. Molecular analysis of L. monocytogenes revealed the detection of hlyA gene as one of the most coding genes for its pathogenicity. Similarly, several previous studies detected hlyA in L. monocytogenes isolated from food samples [34, 36].

Several outbreaks of listeriosis have been linked with the consumption of improper heated dairy products such as soft and semisoft cheese. Proper pasteurization of milk should eliminate L. monocytogenes from milk. Still, the presence of L. monocytogenes in pasteurized milk or dairy products indicates postpasteurization contamination [43]. Therefore, this study was extended to investigate the antilisterial activities of some phytochemicals.

The tested chemicals at the used concentrations did not show deviations in the sensory characteristics of the soft cheese (data are not shown). Interestingly, rosmarinic acid showed significant antilisterial effects in soft cheese contaminated with L. monocytogenes. Rosmarinic acid is rich in phenols that have a vital role in disrupting the bacterial cell wall [43]. The rosemary’s antimicrobial effect was in agreement with Han et al. [43], who recorded a 2.5 log CFU/g reduction in Listeria counts within nine days of treatment at contaminated cheese. Besides, rosemary used for the preservation of flavored cheese made from cream cheese showed a significant () reduction in the total bacterial counts of the cheese [44].

Ascorbic acid is one of the tested chemicals in this study and exhibited significant antilisterial activities. Several studies investigated the antimicrobial properties of ascorbic acid. For instance, ascorbic acid at a concentration of 0.31 mg/mL had an in vitro bactericidal effect against Pseudomonas aeruginosa [45]. Furthermore, ascorbic acid had a significant role in the inhibition of biofilm formation of methicillin-resistant Staphylococcus aureus at 8–16 mg/mL [46]. Ascorbic acid also showed antisalmonella activity in the digestive tract of chickens [47]. In addition, Verghese et al. [15] stated that ascorbic acid at a concentration of 20 mg/mL had clear inhibitory effects against E. coli and Klebsiella pneumoniae in broth culture. Regarding the use of ascorbic acid in dairy products, Shivaprasad et al. [48] recorded a significant reduction in E. coli EMC17 counts (1.5 log CFU/g) in treated cottage cheese with ascorbic acid. The same authors added that the antimicrobial effects of ascorbic acid are attributed to two main factors: the first is its pro-oxidant action on ROS generation (hydroxyl radicals, hydrogen peroxide, and superoxide). The high dose of ascorbic acid leads to the reduction of Fe+3 to Fe+2, leading to an intracellular pressure of ferrous ions. A load of ferrous ions leads to ROS generation, which has a vital role in bacterial cell death. The second factor is the leakage of protein and sugar due to ROS generation, which leads to bacterial cell death.

Clove oil is another natural product rich in phytochemicals that has several uses as an antiseptic, analgesic, and antimicrobial. In this study, clove oil had significant antilisterial activities in soft cheese contaminated with L. monocytogenes. Likely, Menon and Garg [49] reported the antilisterial effect of clove (1%) on contaminated cheese, and the results showed a 3 log CFU/g reduction in the viability counts of Listeria spp., compared to the control sample. However, Leuschner and Ielsch [50] recorded the bactericidal effect of clove oil against L. monocytogenes on the broth culture only without a significant effect of clove powder on the contaminated cheese. The antimicrobial effect of clove is due to its content of eugenol that might denature bacterial proteins and alter bacterial cell membrane [51].

Thyme oil also exhibited significant antilisterial activities in soft cheese contaminated with L. monocytogenes. Similarly, Bagamboula et al. [52] recorded bactericidal effects of thyme oil against Enterobacteriaceae at low concentration (0.1%) in naturally contaminated lettuce. Besides, Oliveira et al. [53] used thyme and rosemary oils to control L. monocytogenes in raw beef. The results showed a significant suppression in the pathogen growth by 1.25 log CFU/g within 48 h of using the inhibitory oils. Furthermore, Abdollahzadeh et al. [54] examined the inhibitory effect of thyme oils against L. monocytogenes in minced beef. The results stated that using thyme oil at a concentration of 0.8 to 1.2% reduced the viable count of L. monocytogenes in minced beef to less than 2 log CFU/g within six days of storage. They explained the antimicrobial activity of thyme due to its high contents of thymol and carvacrol that have vital roles in the disturbance of bacterial cell membrane permeability.

The combined effects of the used additives together with osmotic stress (NaCl 2%, and NaCl 3%) on L. monocytogenes viability were investigated. The obtained results indicated that the used antimicrobial additives exerted the greatest overall suppression of L. monocytogenes when combined with NaCl 3%. Similarly, Chen et al. [55] found that using D-tryptophan as an antimicrobial amino acid for suppression of the growth of V. vulnificus and V. parahaemolyticus at a high salt content (5% NaCl) exerted more bacteriostatic effect than low salt content (3.5% NaCl). Also, the same authors found that the total bacterial population in freshly shucked oysters in artificial seawater treated with 40 mM D-tryptophan with a high salt content revealed a significant decrease in the bacterial counts than that recorded at low salt content. The high NaCl content led to an increase in the withdrawal of water from the bacterial cells, followed by a more gradual reduction in bacterial populations [55].

Treatment of L. monocytogenes with natural additives at 4°C led to a significant reduction in the pathogen growth than at 10^oC. This result agrees with other studies that used lactic acid and hot water for decontamination of L. monocytogenes on the surface of fresh beef stored at 4°C and 10°C as L. monocytogenes was not detected at 4°C, while it was still grown at 10°C [56]. Besides, Han et al. [43] examined the inhibitory effects of thyme and rosemary oils onto artificially contaminated cheese with L. monocytogenes at 4°C and 10°C, and the results revealed that thyme oil or rosemary oils (1%, each) had more potent inhibitory effects on L. monocytogenes at 4^oC than 10^oC. In general, the growth inhibition of pathogens at 4°C than 10°C might be via the extension of the lag phase produced by the inhibitory agents [43].

5. Conclusions

The obtained results of this study revealed isolation of multidrug-resistant L. monocytogenes from dairies retailed in Egypt. Rosmarinic acid, ascorbic acid, clove, and thyme essential oils showed significant antilisterial activities in soft cheese contaminated with L. monocytogenes compared with the control samples. Furthermore, cotreatment of contaminated cheese containing a high salt content (3% NaCl) with the used food additives exhibited slightly higher reduction percentages in L. monocytogenes growth than low salt content (2% NaCl). These results strongly recommend the use of rosmarinic acid, ascorbic acid, clove, and thyme essential oils as food preservatives with significant antilisterial activities besides the traditional food preservation conditions such as low chilling temperature and osmotic stressors. In addition, the adoption of strict hygienic measures during the manufacture and processing of dairy products is mandatory in food processing plants.

Data Availability

The data are available from the corresponding author upon request.

Ethical Approval

This study was approved by the research ethics committee (R/103) of the Faculty of Veterinary Medicine, Mansoura University, Egypt.

Conflicts of Interest

All authors declare that they have no conflicts of interest.

Acknowledgments

This research has been funded by the Scientific Research Deanship at the University of Ha’il, Saudi Arabia, through project number RG-20-211.

References

D. Field, R. O’ Connor, P. D. Cotter, R. P. Ross, and C. Hill, “In vitro activities of Nisin and Nisin derivatives alone and in combination with antibiotics against Staphylococcus biofilms,” Frontiers in Microbiology, vol. 7, p. 508, 2016.
View at: Publisher Site | Google Scholar
E. Fox, T. O’Mahony, M. Clancy, R. Dempsey, M. O’Brien, and K. Jordan, “Listeria monocytogenes in the Irish dairy farm environment,” Journal of Food Protection, vol. 72, no. 7, pp. 1450–1456, 2009.
View at: Publisher Site | Google Scholar
A. Abrar, T. Beyene, and W. Furgasa, “Isolation, identification and antimicrobial resistance profiles of Salmonella from dairy farms in adama and modjo towns, Central Ethiopia,” European Journal of Medical and Health Sciences, vol. 2, no. 1, pp. 1–11, 2020.
View at: Google Scholar
S. Guenther, D. Huwyler, S. Richard, and M. J. Loessner, “Virulent bacteriophage for efficient biocontrol of Listeria monocytogenes in ready-to-eat foods,” Applied and Environmental Microbiology, vol. 75, no. 1, pp. 93–100, 2009.
View at: Publisher Site | Google Scholar
F. A. Mohajeria, Z. Derakhshanc, M. Ferrantef et al., “The prevalence and antimicrobial resistance of Listeria spp in raw milk and traditional dairy products delivered in Yazd, central Iran,” Food and Chemical Toxicology, vol. 114, pp. 141–144, 2018.
View at: Google Scholar
N. Zafar, Z. Nawaz, A. Qadeer et al., “Prevalence, “molecular characterization and antibiogram study of Listeria monocytogenes isolated from raw milk and milk products,” Pure and Applied Biology, vol. 9, no. 3, 2020.
View at: Google Scholar
C. Frye and C. W. Donnelly, “Comprehensive survey of pasteurized fluid milk produced in the United States reveals a low prevalence of Listeria monocytogenes,” Journal of Food Protection, vol. 68, no. 5, 2005.
View at: Publisher Site | Google Scholar
A. Lianou and J. N. Sofos, “A review of the incidence and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments,” Journal of Food Protection, vol. 70, no. 9, pp. 2172–2198, 2007.
View at: Publisher Site | Google Scholar
M. Elafify, J. Chen, A. Abdelkhalek, M. Elsherbini, M. AL-Ashmawy, and S. Koseki, “Combined d-tryptophan treatment and temperature stress exert antimicrobial activity against Listeria monocytogenes in milk,” Journal of Food Protection, vol. 83, no. 4, pp. 644–650, 2020.
View at: Publisher Site | Google Scholar
K. Koutsoumanis, A. Pavlis, G. J. Nychas, and K. Xanthiakos, “Probabilistic model for Listeria monocytogenes growth during distribution, retail storage, and domestic storage of pasteurized milk,” Applied and Environmental Microbiology, vol. 76, no. 7, pp. 2181–2191, 2010.
View at: Publisher Site | Google Scholar
N. M. Coutinho, M. R. Silveira, R. S. Rocha et al., “Cold plasma processing of milk and dairy products,” TrendsTrends in Food Science & TechnologyFoodScience & Technology, vol. 74, pp. 56–68, 2018.
View at: Publisher Site | Google Scholar
M. Elafify, W. Darwish, M. El-Toukhy, B. Badawy, R. Mohamed, and R. Shata, “Prevalence of multidrug resistant Salmonella spp. in dairy products with the evaluation of the inhibitory effects of ascorbic acid, pomegranate peel extract, and D-tryptophan against Salmonella growth in cheese,” International Journal of Food Microbiology, vol. 364, 2022.
View at: Publisher Site | Google Scholar
P. Fei, Y. Xu, S. Zhao, S. Gong, and L. Guo, “Olive oil polyphenol extract inhibits vegetative cells of Bacillus cereus isolated from raw milk,” Journal of Dairy Science, vol. 102, no. 5, pp. 3894–3902, 2019.
View at: Publisher Site | Google Scholar
K. A. Hussein, Y. D. Lee, and J. H. Joo, “Effect of rosemary essential oil and trichoderma koningiopsis VOCs on pathogenic fungi responsible for Ginseng root-rot disease,” Journal of Microbiology and Biotechnology, vol. 30, no. 7, pp. 1018–1026, 2020.
View at: Publisher Site | Google Scholar
R. J. Verghese, S. Mathew, and A. David, “Antimicrobial activity of Vitamin C demonstrated on uropathogenic Escherichia coli and Klebsiella pneumonia,” Journal of Research in Medical Sciences, vol. 3, no. 2, pp. 88–93, 2020.
View at: Publisher Site | Google Scholar
FDA, “Code of federal regulations, title 21, food and drug,” 2011, http://www.accessdatafdagov/scripts/cdrh/cfdocs/cfCFR/CFRSearchcfm?2011.
View at: Google Scholar
S. Cosentino, C. I. G. Tuberoso, B. Pisano et al., “In-vitro antimicrobial activity and chemical composition of Sardinian Thymus essential oils,” Letters in Applied Microbiology, vol. 29, no. 2, pp. 130–135, 1999.
View at: Publisher Site | Google Scholar
D. Roberts, W. Hooper, and M. Greenwood, Practical Food Microbiology, Public Health Laboratory Service, London, UK, pp. 146–149, 1995.
J. F. MacFaddin, Biochemical Tests for Identification Medical Bacteri, Warery Press Inc, Baltimore, MD, USA, 2000.
ES (Egyptian Standards), “Milk and Dairy Prducts part 1: Raw milk,” Egyptian Organization For Standardization And Quality Control, vol. 154, 2005.
View at: Google Scholar
E. C. (European economic Communities standards), “Laying down the health rules for the production and placing on the market of raw milk, heat treated milk and milk based products,” Official Journal of European Union, pp. 1–32, 1992.
View at: Google Scholar
CFSAN (Center of Food safety and Applied Nutrition), Bacteriological Analytical Manual Online, Listeria Monocytogenes, Food & drug Administration, Silver Spring, MA, USA, pp. 198–212, 2001.
F. Pagotto, E. Daley, J. Farber, and D. Warburton, Isolation of Listeria Monocytogenes from All Food and Environmental Samples, MFHPB-30, Health Products and Food Branch, Ottawa, Canada, 2001.
R. Srivani, “Studies on antimicrobial susceptibility pattern of Salmonella isolates from Chennai, India,” The International Journal of Pharma and Bio Sciences, vol. 2, pp. 435–442, 2011.
View at: Google Scholar
Clinical and Laboratory Standards Institute (CLSI), Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard, Clinical and Laboratory Standards Institute, Wayne, PA, USA, 12th edition, 2015.
A. Singh, S. Yadav, S. Singh, and P. Bharti, “Prevalence of Salmonella in chicken eggs collected from poultry farms and marketing channels and their antimicrobial resistance,” Foods, vol. 43, no. 8, pp. 2027–2030, 2010.
View at: Publisher Site | Google Scholar
C. Swetha, T. Madhava, N. Krishnaiah, and V. Kumar, “Detection of Listeria monocytogenes in fish samples by PCR,” Biological Research, vol. 3, pp. 1880–1884, 2013.
View at: Google Scholar
M. J. Mayo, “Chemical methods of control,” Laboratory Experiments in Microbiology, The Benjamin/ Cummings Publishing Company, San Francisco.
View at: Google Scholar
A. M. Youssef, S. M. el-Sayed, H. S. el-Sayed, H. H. Salama, and A. Dufresne, “Enhancement of Egyptian soft white cheese shelf life using a novel chitosan/carboxymethyl cellulose/zinc oxide bionanocomposite film,” Carbohydrate Polymers, vol. 151, pp. 9–19, 2016.
View at: Publisher Site | Google Scholar
S. Gebretsadik, T. Kassa, H. Alemayehu, K. Huruy, and N. Kebede, “Isolation and Characterization of Listeria monocytogenes and other Listeria species in foods of animal origin in Addis Ababa, Ethiopia,” Journal of Infection and Public Health, vol. 4, no. 1, pp. 22–29, 2011.
View at: Publisher Site | Google Scholar
L. Hassan, H. O. Mohammed, P. L. McDonough, and R. N. Gonzalez, “A cross-sectional study on the prevalence of Listeria monocytogenes and Salmonella in New York dairy herds,” Journal of Dairy Science, vol. 83, no. 11, pp. 2441–2447, 2000.
View at: Publisher Site | Google Scholar
H. Jamali, B. Radmehr, and K. L. Thong, “Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks,” Food Control, vol. 34, no. 1, pp. 121–125, 2013.
View at: Publisher Site | Google Scholar
F. Akrami-Mohajeri, Z. Derakhshan, M. Ferrante, N. Hamidiyan, M. Soleymani, and G. O. Conti, “The prevalence and antimicrobial resistance of Listeria spp in raw milk and traditional dairy products delivered in Yazd, central Iran,” Food and Chemical Toxicology, vol. 114, pp. 141–144, 2016.
View at: Google Scholar
S. Elshinaway, A. Meshref, A. Zeinhom, and D. Hafez, “Incidence Of Listeria species in some dairy products in beni-suef governorate,” Assiut Veterinary Medicine, vol. 36, no. 152, pp. 5–13, 2017.
View at: Publisher Site | Google Scholar
M. Yousef, H. Ramadan, and M. Al-Ashmawy, “Prevalence of Listeria species in raw milk, ice cream and yogurt and effect of selected natural herbal extract on its survival,” Mansoura Veterinary Medicine, vol. 21, no. 3, pp. 2199–3106, 2020.
View at: Publisher Site | Google Scholar
M. AL-Ashmawy, M. Gwida, and K. Abdelgalil, “Prevalence, detection methods and antimicrobial susceptibility of Listeria monocytogens isolated from milk and soft cheeses and its zoonotic importance,” World Applied science, vol. 29, no. 7, pp. 869–878, 2014, https://doi.org/10.5829/idosi.wasj.2014.29.07.8273.
View at: Google Scholar
C. Donnely, “Growth and survival of microbial pathogens in cheese,” cheese:chemistry, Physics and Microbiology, Elsevier Academic Press, 2004.
View at: Google Scholar
A. Abd El Tawab, A. Maarouf, and Z. Mahdy, “Bacteriological and Molecular studies of Listeria species in milk and milk products at El-Kaliobia Governorate,” Benha Veterinary Medical Journal, vol. 29, no. 2, pp. 170–181, 2015.
View at: Publisher Site | Google Scholar
A. A.-R. Ismaiel, A. E.-S. Ali, and G. Enan, “Incidence of Listeria in Egyptian meat and dairy samples,” Food Science and Biotechnology, vol. 23, no. 1, pp. 179–185, 2014.
View at: Publisher Site | Google Scholar
A. M. M. Metwally and H. M. Ali, “Listeria spp. in ready-to-eat dairy products from retailers and small shops,” Journal of Food and Dairy Sciences, vol. 5, no. 10, pp. 725–730, 2014.
View at: Publisher Site | Google Scholar
A. F. Alsayeqh, A. H. A. Baz, and W. S. Darwish, “Antimicrobial-resistant foodborne pathogens in the middle east: a systematic review,” Environmental Science and Pollution Research, pp. 1–23, 2021.
View at: Publisher Site | Google Scholar
T. M. Osaili, A. A. Al-Nabulsi, M. H. Taha et al., “Occurrence and antimicrobial susceptibility of Listeria monocytogenes isolated from brined white cheese in Jordan,” Journal of Food Science, vol. 77, no. 9, pp. M528–M532, 2012.
View at: Publisher Site | Google Scholar
J. H. Han, D. Patel, J. E. Kim, and S. C. Min, “Microbial inhibition in mozzarella cheese using rosemary and thyme oils in combination with sodium diacetate,” Food Science and Biotechnology, vol. 24, no. 1, pp. 75–84, 2015.
View at: Publisher Site | Google Scholar
R. H. Olmedo, V. Nepote, and N. R. Grosso, “Preservation of sensory and chemical properties in flavoured cheese prepared with cream cheese base using oregano and rosemary essential oils,” Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology, vol. 53, no. 2, pp. 409–417, 2013.
View at: Publisher Site | Google Scholar
I. Golonka, M. Oleksy, A. Junka, A. Matera-Witkiewicz, M. Bartoszewicz, and W. Musiał, “Selected physicochemical and biological properties of ethyl ascorbic acid compared to ascorbic acid,” Biological and Pharmaceutical Bulletin, vol. 40, no. 8, pp. 1199–1206, 2017.
View at: Publisher Site | Google Scholar
J. Kallio, M. Jaakkola, M. Mäki, P. Kilpeläinen, and V. Virtanen, “Vitamin C inhibits staphylococcus aureus growth and enhances the inhibitory effect of quercetin on growth of Escherichia coli in vitro,” Planta Medica, vol. 78, no. 17, pp. 1824–1830, 2012.
View at: Publisher Site | Google Scholar
D. Hernandez-Patlan, B. Solis-Cruz, A. Méndez-Albores et al., “Comparison of PrestoBlue and plating method to evaluate antimicrobial activity of ascorbic acid, boric acid and curcumin in an in vitro gastrointestinal model,” Journal of Applied Microbiology, vol. 124, no. 2, pp. 423–430, 2018.
View at: Publisher Site | Google Scholar
D. P. Shivaprasad, N. K. Tanejab, A. Lakrab, and D. Sachdev, “In vitro and in situ abrogation of biofilm formation in E. coli by vitamin C through ROS generation, disruption of quorum sensing and exopolysaccharide production,” Food Chemistry, vol. 341, pp. 128–171, 2021.
View at: Publisher Site | Google Scholar
K. Vrinda Menon and S. R. Garg, “Inhibitory effect of clove oil on Listeria monocytogenes in meat and cheese,” Food Microbiology, vol. 18, no. 6, pp. 647–650, 2001.
View at: Publisher Site | Google Scholar
R. G. K. Leuschner and V. Ielsch, “Antimicrobial effects of garlic, clove and red hot chilli onListeria monocytogenesin broth model systems and soft cheese,” International Journal of Food Sciences & Nutrition, vol. 54, no. 2, pp. 127–133, 2003.
View at: Publisher Site | Google Scholar
S. Javed, S. Mushtaq, I. Khokhar, R. Ahmad, and M. Haider, “Comparative antimicrobial activity of clove and fennel essential oils against food borne pathogenic fungi and food spoilage bacteria,” African Journal of Biotechnology, vol. 11, pp. 16065–16070, 2012.
View at: Publisher Site | Google Scholar
C. F. Bagamboula, M. Uyttendaele, and J. Debevere, “Inhibitory effect of thyme and basil essential oils, carvacrol, thymol, estragol, linalool and p-cymene towards Shigella sonnei and S. flexneri,” Food Microbiology, vol. 21, pp. 33–42, 2004.
View at: Publisher Site | Google Scholar
M. M. M. d. Oliveira, D. F. Brugnera, and R. H. Piccoli, “Essential oils of thyme and rosemary in the control of Listeria monocytogenes in raw beef,” Brazilian Journal of Microbiology, vol. 44, no. 4, pp. 1181–1188, 2013.
View at: Publisher Site | Google Scholar
E. Abdollahzadeh, M. Rezaei, and H. Hosseini, “Antibacterial activity of plant essential oils and extracts: the role of thyme essential oil, nisin, and their combination to control Listeria monocytogenes inoculated in minced fish meat,” Food Control, vol. 35, no. 1, pp. 177–183, 2014.
View at: Publisher Site | Google Scholar
J. Chen, H. Kudo, K. Kan, S. Kawamura, and S. Koseki, “Growthinhibitory effect of D-Tryptophan on Vibrio spp. in shucked and live Oysters,” Applied and Enviromental Microbiology, vol. 19, Article ID e1543, 2018.
View at: Publisher Site | Google Scholar
K. P. Koutsoumanis, L. V. Ashton, I. Geornaras et al., “Effect of single or sequential hot water and lactic acid decontamination treatments on the survival and growth of Listeria monocytogenes and spoilage microflora during aerobic storage of fresh beef at 4, 10, and 25°C,” Journal of Food Protection, vol. 67, no. 12, pp. 2703–2711, 2004.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2022 Mahmoud Elafify et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

992

Downloads

752

Citations