Journal of Immunology Research

Journal of Immunology Research / 2018 / Article

Research Article | Open Access

Volume 2018 |Article ID 7948068 |

Yu Li, Ning Hao, Suping Zou, Tingting Meng, Huanqing Tao, Pengfei Ming, Manman Li, Hongyan Ding, Jinchun Li, Shibin Feng, Xichun Wang, Jinjie Wu, "Immune Regulation of RAW264.7 Cells In Vitro by Flavonoids from Astragalus complanatus via Activating the NF-κB Signalling Pathway", Journal of Immunology Research, vol. 2018, Article ID 7948068, 9 pages, 2018.

Immune Regulation of RAW264.7 Cells In Vitro by Flavonoids from Astragalus complanatus via Activating the NF-κB Signalling Pathway

Academic Editor: Jacek Tabarkiewicz
Received12 Oct 2017
Accepted06 Feb 2018
Published05 Apr 2018


The current study aimed at investigating the effects of flavonoids from Astragalus complanatus (FAC) on the proliferation, the contents, and gene expression levels of cytokines, secretion of surface stimulating factors, cell cycle, and the expression level of the NF-κB signalling pathway in RAW264.7 cells. Our results revealed that compared with control group, the contents of IL-6, IL-1β, TNF-α, and NO and the mRNA expression levels of IL-6, IL-1β, TNF-α, and iNOS in FAC-treated groups significantly increased (). Moreover, FAC induced macrophage activation to release the above-mentioned mediators partly involved in NF-κB/MAPK signalling pathways. Therefore, FAC regulates immune function in RAW264.7 cells via activating the NF-κB signalling pathway. FAC could be applicable for agriculture, drug research, and food industry as a potent immune-modulatory agent.

1. Introduction

As a traditional Chinese medicine, Astragalus regulates the immune response via regulating macrophage inflammatory response and activating heparanase [1, 2]. Astragalus contains flavonoids, saponins, polysaccharides, and trace elements and has a role to hepatoprotective, cardiac, antiaging, anticancer, and anti-inflammatory effect [3]. Astragalus and its effective components Astragalus flavonoids have immune enhancement effects and play an important role in promoting antibody production, regulation of immunity, antivirus, and antibacterial [4]. Xu et al. have confirmed that flavonoids from Astragalus complanatus (FAC) can improve the function of mouse mononuclear macrophages, inhibit delayed-type hypersensitivity in mice, and promote the proliferation of mouse spleen lymphocytes [5, 6]. However, the exact underlying mechanism of immune action for Astragalus is unknown, thereby hampering its development [7].

The production of nitric oxide (NO) and the secretion of cytokines such as interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor (TNF-α) in RAW264.7 cells are indicators of immune function [8]. Moreover, previous studies have shown that CD40, CD80, and CD86 contribute to the immunopotentiating action on dendritic cell (DC) surfaces, which is induced by polysaccharide [9].

In recent years, the pharmacological effects of Astragalus and its mechanism have been studied extensively. However, there is no report about the role of NF-κB signalling pathways in regulating the immune function of flavonoids in Astragalus membranaceus. Therefore, the signal transduction mechanism of Astragalus membranaceus can be elucidated by studying the effect of astragalus flavonoids in Radix Astragali on RAW264.7 cells from NF-κB signalling transduction pathway, which lays a theoretical foundation for the clinical application of Astragalus.

2. Materials and Methods

2.1. Reagents and Chemicals

Flavonoids (purity > 98%) from Astragalus complanatus was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). A Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technology Inc. (Gaithersburg, MD). A cell cycle kit and ELISA kits specific for mouse TNF-α, IL-6, IL-1β, and NO were obtained from Senbeijia Biological Inc. (Nanjing, China). TRIzol, First-strand cDNA Synthesis Kit, and a quantitative PCR kit were obtained from Takara (Dalian, China). The primary anti-β-actin, p50, p65, and p-p65 antibodies and horseradish peroxidase-conjugated rabbit anti-mouse secondary antibodies were purchased from Beyotime Institute of Biotechnology (Jiangsu, China). The pacific blue anti-mouse CD40, PE anti-mouse CD80, and FITC anti-mouse CD86 antibodies and the corresponding isotype controls were purchased from BioLegend (CA, USA). All other chemicals were of analytic grade (Sinopharm Chemical Reagent Co. Ltd., China).

2.2. RAW264.7 Culture and Treatment

RAW264.7 cells were cultured under condition of 37°C and 5% CO2 in high-glucose Dulbecco’s Modification of Eagle’s Medium (DMEM) (HyClone, Logan, UT) with 10% fetal bovine serum (FBS) (Clark Bioscience, Seabrook, MD, USA) [3]. The cells were passaged in 80% confluent culture flask, and the cells were observed every 48 h. The FAC-treated group are the following: 0 μg/mL FAC-treated group, 0.1 μg/mL FAC-treat group, 1 μg/mL FAC-treated group, 10 μg/mL FAC-treated group, 5 μmol/L PDTC (NF-κB inhibitor), and 10 μg/mL FAC+ 5 μmol/L PDTC. After cells were pretreated with PDTC for 1 h, FAC was added for 24 h.

2.3. Optimum Concentration of FAC Treatment

Cells in logarithmic growth phase were adjusted to a concentration of 1 × 105 cells/mL. Cells were seeded in 96-well plates at 100 μL per well. After 24 hours of culture, cells were incubated at final concentrations of 0, 0.1, 1, and 10 μg/mL of FAC, respectively, and set the blank control group. After incubation for 24 h, 10 μL of CCK-8 solution was added to the control wells and FAC-treated wells. After incubation for 3 h, the absorbance at 450 nm was measured using a microplate reader (Thermo Multiskan MK3, USA).

2.4. CCK-8 Cell Viability

Cells were seeded in 96-well plates at a density of 1 × 105 cells/mL in a logarithmic growth phase. The plates were incubated at 37°C and 5% CO2 for 24 h. Then, 10 μL of CCK-8 solution was added to each well, and cells were incubated for an additional 4 h. The optical density (OD) was measured at 450 nm by using a plate reader (Thermo Multiskan MK3, USA).

2.5. ELISA Assay

RAW264.7 cells were seeded in 6-well plates (1 × 105 cells/mL) and treated with various concentrations (0–10 μg/mL) of FAC with or without 10 μL PDTC. Cells were centrifuged at 4500 rpm for 10 min, and the concentrations of IL-1β, IL-6, TNF-α, and NO were measured in the cell supernatants with a mouse ELISA kit, according to the manufacturer’s instructions (Senbeijia Biological Inc., Nanjing, China).

2.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated from RAW264.7 cells using TRIzol reagent, and RNA was reverse-transcribed into cDNA with a Toyobo First Strand cDNA Synthesis Kit. Relative mRNA expression levels were detected by using a Biomiga SYBR qPCR mix kit and ABI 7500 qRT-PCR. Data are presented as 2−△△ct. The primer sequences of IL-1β, IL-6, TNF-α, iNOS, and GAPDH that were used for qRT-PCR were presented in Table 1.

GenesAccession numbersPrimer sequence (5→3)Product size (bp)

IL-1βNM_008361.3Forward primer GCCACCTTTTGACAGTGATGAG165
IL-6NM_031168.1Forward primer CAACGATGATGCACTTGCAGA201
TNF-αNM_001278601.1Forward primer ACCTGGCCTCTCTACCTTGT161
GAPDHNM_001289726.1Forward primer GGTGAAGGTCGGTGTGAACG232

2.7. Evaluation of CD40, CD80, and CD86 Expression

Cells were collected after they were treated with different concentrations (0–100 μg/mL) of FAC in the presence or absence of PDTC for the indicated times. The cell surfaces were blocked with 15% sheep serum at 4°C for 15 min and were then washed twice with phosphate buffer solution (PBS, pH 7.2). Then, cells were incubated with monoclonal antibodies against CD40, CD80, CD86, and the corresponding fluorescent markers for 30 min at 4°C. After cells were washed twice with PBS and resuspended in PBS, they were subjected to flow cytometry with a FAC Scan platform (Becton Dickinson).

2.8. Flow Cytometry Analysis of Cell Cycle Regulation

RAW264.7 cells (1 × 105 cells/mL) were seeded in 6-well plates and treated with various concentrations (0–10 μg/mL) of FAC in the presence or absence of PDTC for 24 h. Then, cells were collected, washed once with cold PBS, fixed in 75% cold alcohol overnight at 4°C, and washed twice with cold PBS. Fixed cells were resuspended in 100 μL RNase at 37°C and incubated with 400 μL propidium iodide (PI) at 4°C in a dark room for 30 min. Cell cycle progression was analyzed by using flow cytometry with a FAC Scan platform (Becton Dickinson).

2.9. Western Blotting Assay

After cells were cultured for the indicated times, they were collected and washed twice with cold PBS at 800 g for 10 min. Total protein was extracted by using RIPA buffer. Protein concentrations were determined by using the BCA method as previous report described [1012]. Proteins (50 μg) were separated through 10% SDS-PAGE and subsequently transferred to PVDF membranes. The membranes were blocked with 5% bovine serum albumin (BSA) containing 0.05% Tween-20 in TBST for 4 h at room temperature and were then incubated with the primary antibodies overnight at 4°C. The membranes were washed twice and incubated with the secondary antibodies for 1 h at room temperature. The protein bands were detected with a chemiluminescence Western blotting detection system.

2.10. Statistical Analysis

Data were analyzed with the SPSS software package 17.0 (SPSS Inc., Chicago, IL, USA) and are presented as the mean ± standard deviation (SD). The differences among experimental groups were analyzed by using one-way ANOVA. Compared with the control group, values below 0.05 were considered to be statistically significant (, ). Compared with the 10 μg/mL FAC-treated group, values below 0.05 were considered to be statistically significant (, ).

3. Results

3.1. Optimum Concentration of FAC Treatment

As showed in Figure 1, RAW264.7 cells were treated with different concentrations of FAC (0–20 μg/mL). At the concentration range of 0–10 μg/mL, cell viability increased with the increase of FAC concentrations and reached the maximum at 10 μg/mL. When the concentration of FAC was 10–20 μg/mL, the cell viability decreased with the increase of FAC concentrations. Therefore, 10 μg/mL FAC was selected as the optimum concentration for subsequent experiments.

3.2. Effect of FAC on the Cell Viability

As showed in Figure 2, compared with the control group, 0.1–10 μg/mL FAC could increase the activity of the cells to some extent. After adding PDTC alone or combination with 10 μg/mL FAC, cell viability was reduced, but the differences were not significant ().

3.3. FAC Dose Dependently Increased IL-1β, IL-6, TNF-α, and NO Expression in RAW264.7 Cells

As showed in Figure 3, compared with the control group, the content of IL-1β significantly increased () and the content of NO increased significantly () in 0.1 μg/mL FAC-treated groups. The content of IL-1β, IL-6, and NO markedly increased () in 1 and 10 μg/mL FAC-treated groups. The content of TNF-α significantly increased in 10 μg/mL FAC-treated groups (). The content of NO significantly decreased () in PDTC treatment groups. The levels of IL-1β, IL-6, and NO in 10 μg/mL FAC + PDTC group are significantly lower than those in 10 μg/mL FAC groups (). Compared with the control group, the expression of IL-1β and iNOS mRNA significantly increased in 0.1–10 μg/mL FAC-treated groups (). The expression of IL-6 and TNF-α mRNA expression markedly decreased () in 1 and 10 μg/mL FAC-treated groups (). The expression of TNF-α and iNOS mRNA in PDTC-treated group is significantly lower than that in control groups (). The expression of IL-1β, IL-6, TNF-α, and iNOS mRNA significantly decreased () in 10 μg/mL FAC + PDTC groups compared with that in 10 μg/mL FAC group.

3.4. Evaluation of CD40, CD80, and CD86 Expression

As showed in Figure 4, FAC exerts different effects on CD40, CD80, and CD86 secretion in RAW264.7 cells. Compared with the control group, the secretion of CD40 increased from 14.41% to 32.94% with the increase of FAC concentrations, and the secretion of CD40 decreased to 11.07% after addition of inhibitor PDTC. Compared with 10 μg/mL FAC group, the secretion of CD40 in 10 μg/mL FAC + PDTC treatment group was reduced to 14.02%. The expression of CD80 showed no significant changes after RAW264.7 cells were treated with various concentrations of FAC. Compared with the control group, the secretion of CD86 increased from 3.03% to 70.90% with the increase of FAC concentrations, and the secretion of CD86 decreased to 1.21% in the PDTC treatment group. The secretion of CD86 decreased to 2.26% in 10 μg/mL FAC + PDTC treatment group compared with 10 μg/mL FAC.

3.5. FAC Promoted Cell Proliferation by Inducing Cell Cycle in RAW264.7 Cells

As showed in Figure 5 and Table 2, compared with the control group, the ratio of G2/M phase increased with the increase of FAC concentrations. PDTC inhibits the ratio of G2/M phase. However, the changes are relatively small. Therefore, different concentrations of FAC and PDTC had no significant effect on cell proliferation.

Cell cycle
FAC (μg/mL)PDTC (5 μmol/L)PDT (5 μmol/L) + 10 μg/mLFAC

G1 mean194208199185210206
G2 mean367407.23377.97370412404
G1 cv7.857.87.158.778.98.36
G2 cv10.955.84.77.628.784.5

3.6. FAC Inhibited the NF-κB Signalling Pathway-Related Key Protein Expression in RAW264.7 Cells

As showed in Figures 6(a) and 6(b), the protein of p50 and the ratio of p50/β-actin in 0.1 and 10 μg/mL FAC treatment groups were significantly higher than those in the control group (). The protein of p50 and the ratio of p50/β-actin further significantly decreased in PDTC treatment group (). Compared with 10 μg/mL FAC treatment group, the protein of p50 and the ratio of p50/β-actin significantly reduced () in 10 μg/mL FAC + PDTC treatment group. Compared with the control group, the p-p65/p65 value was significantly increased () in the 10 μg/mL FAC-treated group compared with the control group. The protein of p65 and the ratio of p-p65/p65 was significantly higher in 10 μg/mL FAC-treated group than that in the control group. The protein of p65 and the ratio of p-p65/p65 significantly increased in the 10 μg/mL FAC + PDTC group ().

4. Discussion

Previous studies have showed that FAC has the function of free radical scavenging, resistance to body mutations, the protection of the liver function, anti-myocardial ischemia, reduction of the inflammatory response, and immunity enhancement [3, 13, 14]. The beneficial biological function of FAC makes it possible to apply to clinical disease prevention and treatment. Other reports have showed that flavonoids can reduce the LPS-induced RAW264.7 inflammatory cells by reducing NO secretion [15]. The results of this study show that FAC has a significant effect on IL-1β, IL-6, TNF-α, iNOS secretion, and gene expression in RAW264.7 cells, and the secretion of cytokines and expression of NF-κB pathway were decreased after treated with inhibitor PDTC which indicated that FAC and PDTC can affect the secretion of cytokines and gene expression.

CD40, CD80, and CD86 react with the antigen-presenting effect of immune cells and play a costimulatory role in heart transplantation. The surface costimulatory factors have a protective effect on the immunological activity of immune cells and induce the expression of cytokines and other functions [1618]. In our study, the secretion of CD40 and CD86 increased in RAW264.7 cells treated with FAC. The secretion of CD80 showed no significant change. These results suggested that CD40 and CD86, not CD80, are involved in the immune regulation of RAW264.7 cells by FAC.

The changes of cell from diploid to tetraploid stage are the performance of cell division and proliferation. Cells in the G1 period (period of preparation) are preparing for the presynthesis of RNA and ribosome. S period spanning cycle analysis of a peak in the lower peak and the larger spans is the synthesis of DNA. Studies have showed that flavonoids have the effect of inducing apoptosis, inhibiting the proliferation of human tumor cells, and stimulating the activation of mast cells [1921]. In the present study, the activity of the cells was gradually enhanced with the increase of FAC concentration, but the cell activity was significantly decreased after the addition of the inhibitor. It can be seen that FAC can increase cell activity and promote cell proliferation.

FAC enhances the cytotoxic activity of NK cells, improves the synergistic vaccine resistant to the infection of the virus, stimulates the intestinal tract, and enhances the function of the intestinal tract [2224]. It has also been reported that FAC significantly inhibits the expression of extracellular signal-regulated kinases (ERK), p38, and JNK phosphorylated proteins by signal transduction and inhibits NF-κB p65 transformation. LPS-induced RAW264.7 cells can inhibit inflammatory cytokines by blocking NF-κB and MAPK signalling pathway [25, 26]. In this study, low concentration of FAC can increase the NF-κB pathway-related protein, while p50 protein expression decreased in other groups. The ratio of p-p65/p65, as the FAC concentrations increased and reached the maximum in 10 μg/mL. The ratio of p-p65/p65 was significantly lower in the 10 μg/mL FAC + PDTC group than that in the high-concentration group, which indicated that FAC promoted phosphorylation of p65 protein, through the NF-κB signalling pathway, to promote immune function of RAW264.7 cells.

In summary, these results show that FAC promoted the expression of IL-6, IL-1β, TNF-α, and iNOS gene and phosphorylation of p65 protein and the secretion of CD40 and CD86 on the cell surface through NF-κB signalling transduction pathway, thereby increasing the activity of cells to enhance the immune function.


FAC:Flavonoids from Astragalus complanatus
NO:Nitric oxide
TNF-α:Tumor necrosis factor
DC:Dendritic cell
CCK-8:Cell Counting Kit-8
FBS:Fetal bovine serum
PDTC:Pyrrolidinedithiocarbamic acid
OD:Optical density
qRT-PCR:Quantitative real-time polymerase chain reaction
PBS:Phosphate buffer solution.

Conflicts of Interest

The authors declare that there is no conflict of interest regarding the publication of this paper.


This work was supported by the National Key Research and Development Program of China (2016YFD0501009) and the Project of Modern Agricultural Industry and Technology System of Anhui Province (AHCYJSTX-05/07). The authors wish to thank anonymous reviewers for their kind advice.


  1. S. Clement-Kruzel, S.-A. Hwang, M. C. Kruzel, A. Dasgupta, and J. K. Actor, “Immune modulation of macrophage pro-inflammatory response by goldenseal and Astragalus extracts,” Journal of Medicinal Food, vol. 11, no. 3, pp. 493–498, 2008. View at: Publisher Site | Google Scholar
  2. Q. Qin, J. Niu, Z. Wang, W. Xu, Z. Qiao, and Y. Gu, “Astragalus membranaceus extract activates immune response in macrophages via heparanase,” Molecules, vol. 17, no. 12, pp. 7232–7240, 2012. View at: Publisher Site | Google Scholar
  3. Y. Li, T. Meng, N. Hao et al., “Immune regulation mechanism of Astragaloside IV on RAW264.7 cells through activating the NF-κB/MAPK signaling pathway,” International Immunopharmacology, vol. 49, pp. 38–49, 2017. View at: Publisher Site | Google Scholar
  4. R. Han, W. Q. Wu, X. P. Wu, and C. Y. Liu, “Effect of total flavonoids from the seeds of Astragali complanati, on natural killer cell function,” Journal of Ethnopharmacology, vol. 173, pp. 157–165, 2015. View at: Publisher Site | Google Scholar
  5. L. Xu, Y. M. Li, J. T. Liu, C. Yao, X. Zhang, and X. M. Zhang, “Effects of total flavones of Astragalus on immune function in mice,” Progress in Veterinary Medicine, vol. 34, no. 11, pp. 36–39, 2013. View at: Google Scholar
  6. J. Zhu, H. Zhang, Z. Zhu et al., “Effects and mechanism of flavonoids from Astragalus complanatus, on breast cancer growth,” Naunyn-Schmiedeberg's Archives of Pharmacology, vol. 388, no. 9, pp. 965–972, 2015. View at: Publisher Site | Google Scholar
  7. X. Li, X. Wang, C. Han et al., “Astragaloside IV suppresses collagen production of activated hepatic stellate cells via oxidative stress-mediated p38 MAPK pathway,” Free Radical Biology & Medicine, vol. 60, no. 7, pp. 168–176, 2013. View at: Publisher Site | Google Scholar
  8. M. Tabarsa, S. Karnjanapratum, M. Cho, J. K. Kim, and S. G. You, “Molecular characteristics and biological activities of anionic macromolecules from Codium fragile,” International Journal of Biological Macromolecules, vol. 59, no. 4, pp. 1–12, 2013. View at: Publisher Site | Google Scholar
  9. D. Huang, S. Nie, L. Jiang, and M. Xie, “A novel polysaccharide from the seeds of Plantago asiatica L. induces dendritic cells maturation through toll-like receptor 4,” International Immunopharmacology, vol. 18, no. 2, pp. 236–243, 2014. View at: Publisher Site | Google Scholar
  10. X. Du, Z. Shi, Z. Peng et al., “Acetoacetate induces hepatocytes apoptosis by the ROS-mediated MAPKs pathway in ketotic cows,” Journal of Cellular Physiology, vol. 232, no. 12, pp. 3296–3308, 2017. View at: Publisher Site | Google Scholar
  11. X. Sun, X. Yuan, L. Chen et al., “Histamine induces bovine rumen epithelial cell inflammatory response via NF-κB pathway,” Cellular Physiology and Biochemistry, vol. 42, no. 3, pp. 1109–1119, 2017. View at: Publisher Site | Google Scholar
  12. Y. Song, N. Li, J. Gu et al., “β-hydroxybutyrate induces bovine hepatocyte apoptosis via an ROS-p38 signaling pathway,” Journal of Dairy Science, vol. 99, no. 11, pp. 9184–9198, 2016. View at: Publisher Site | Google Scholar
  13. Z. Guo, H. Y. Xu, L. Xu, S. S. Wang, and X. M. Zhang, “In vivo and in vitro immunomodulatory and anti-inflammatory effects of total flavonoids of Astragalus,” African Journal of Traditional Complementary and Alternative Medicines, vol. 13, no. 4, pp. 60–73, 2016. View at: Publisher Site | Google Scholar
  14. D. Zhang and D. Wang, “Progressive studies on biological activity of total flavonoids of Astragalus,” China Journal of Chinese Matera Medica, vol. 35, no. 2, pp. 253–256, 2010. View at: Publisher Site | Google Scholar
  15. S. Kilani-Jaziri, V. Frachet, W. Bhouri, K. Ghedira, L. Chekir-Ghedira, and X. Ronot, “Flavones inhibit the proliferation of human tumor cancer cell lines by inducing apoptosis,” Drug and Chemical Toxicology, vol. 35, no. 1, pp. 1–10, 2012. View at: Publisher Site | Google Scholar
  16. T. Saito, D. Abe, and Y. Nogata, “Polymethoxylated flavones potentiate the cytolytic activity of NK leukemia cell line KHYG-1 via enhanced expression of granzyme B,” Biochemical and Biophysical Research Communications, vol. 456, no. 3, pp. 799–803, 2015. View at: Publisher Site | Google Scholar
  17. Q. Zhang, X. H. Zhao, and Z. J. Wang, “Flavones and flavonols exert cytotoxic effects on a human oesophageal adenocarcinoma cell line (OE33) by causing G2/M arrest and inducing apoptosis,” Food and Chemical Toxicology, vol. 46, no. 6, pp. 2042–2053, 2008. View at: Publisher Site | Google Scholar
  18. Z. Yuqing, S. Zhan’ao, L. Jiaguo et al., “Flavone ingredients can synergistically inhibit NDV infecting cell and improve ND vaccine’s protective rate,” International Journal of Biological Macromolecules, vol. 51, no. 3, pp. 201–208, 2012. View at: Publisher Site | Google Scholar
  19. T. H. Lee, H. Jung, K. H. Park, M. H. Bang, N. I. Baek, and J. Kim, “Jaceosidin, a natural flavone, promotes angiogenesis via activation of VEGFR2/FAK/PI3K/AKT/NF-κB signaling pathways in endothelial cells,” Experimental Biology and Medicine, vol. 239, no. 10, pp. 1325–1334, 2014. View at: Publisher Site | Google Scholar
  20. B. Lies, S. Martens, S. Schmidt, M. Boll, and U. Wenzel, “Flavone potently stimulates an apical transporter for flavonoids in human intestinal Caco-2 cells,” Molecular Nutrition & Food Research, vol. 56, no. 11, pp. 1627–1635, 2012. View at: Publisher Site | Google Scholar
  21. Y. Li, S. He, J. Tang et al., “Andrographolide inhibits inflammatory cytokines secretion in LPS-stimulated RAW264.7 cells through suppression of NF-κB/MAPK signaling pathway,” Evidence-Based Complementray and Alternative Medicine, vol. 2017, article 8248142, 9 pages, 2017. View at: Publisher Site | Google Scholar
  22. A. V. Samodova and L. K. Dobrodeeva, “The role of shedding in the activity of immunocompetent cells with the reagin protective mechanism,” Human Physiology, vol. 38, no. 4, pp. 438–443, 2012. View at: Publisher Site | Google Scholar
  23. A. Slawek, T. Maj, and A. Chelmonska-Soyta, “CD40, CD80, and CD86 costimulatory molecules are differentially expressed on murine splenic antigen-presenting cells during the pre-implantation period of pregnancy, and they modulate regulatory T-cell abundance, peripheral cytokine response, and pregnanc,” American Journal of Reproductive Immunology, vol. 70, no. 2, pp. 116–126, 2013. View at: Publisher Site | Google Scholar
  24. J. Wu, J. Du, C. Xu et al., “In vivo and in vitro anti-inflammatory effects of a novel derivative of icariin,” Immunopharmacology and Immunotoxicology, vol. 33, no. 1, pp. 49–54, 2011. View at: Publisher Site | Google Scholar
  25. L. Moreno-Fierros, A. L. García-Hernández, D. Ilhuicatzi-Alvarado et al., “Cry1Ac protoxin from Bacillus thuringiensis promotes macrophage activation by upregulating CD80 and CD86 and by inducing IL-6, MCP-1 and TNF-α cytokines,” International Immunopharmacology, vol. 17, no. 4, pp. 1051–1066, 2013. View at: Publisher Site | Google Scholar
  26. X. Ci, X. Liang, G. Luo et al., “Regulation of inflammatory mediators in lipopolysaccharide-stimulated RAW 264.7 cells by 2-hydroxy-3-en-anhydroicaritin involves down-regulation of NF-κB and MAPK expression,” International Immunopharmacology, vol. 10, no. 9, pp. 995–1002, 2010. View at: Publisher Site | Google Scholar

Copyright © 2018 Yu Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2021, as selected by our Chief Editors. Read the winning articles.