New Genus and Two New Species of Notocotylidae Lühe, 1909 (Digenea), from Russia: Morphomolecular Data

Table 1

List of primers for amplification and sequencing.

DNA region	Primer	Sequence ⟶	Direction	Reference
28S	digl2	AAGCATATCACTAAGCGG	Forward, external	[13]
	1500R	GCTATCCTGAGGGAAACTTCG	Reverse, external	[13]
	900F	CCGTCTTGAAACACGGACCAAG	Forward, internal	[13]
	1200R	CTTGGTCCGTGTTTCAAGACGGG	Reverse, internal	[13]
cox1	JB3	TTTTTTGGGCATCCTGAGGTTTA	Forward, external	[14]
	JB4.5	TAAAGAAAGAACATAATGAAAATG	Reverse, external	[15]
nad1	NDJ11	AGATTCGTAAGGGGCCTAATA	Forward, external	[14]
	NDJ2A	CTTCAGCCTCAGCATAAT	Reverse, external	[16]