Mediators of Inflammation

Mediators of Inflammation / 2021 / Article

Corrigendum | Open Access

Volume 2021 |Article ID 9816785 | https://doi.org/10.1155/2021/9816785

Zhenyu Zhou, Yu Chen, Dongying Zhang, Shiyong Wu, Tao Liu, Guoqiang Cai, Shu Qin, "Corrigendum to “MicroRNA-30-5p Suppresses Inflammatory Factor-Induced Endothelial Cell Injury by Targeting TCF21”", Mediators of Inflammation, vol. 2021, Article ID 9816785, 4 pages, 2021. https://doi.org/10.1155/2021/9816785

Corrigendum to “MicroRNA-30-5p Suppresses Inflammatory Factor-Induced Endothelial Cell Injury by Targeting TCF21”

Received14 Aug 2021
Accepted14 Aug 2021
Published22 Oct 2021

In the article titled “MicroRNA-30-3p Suppresses Inflammatory Factor-Induced Endothelial Cell Injury by Targeting TCF21” [1], the authors identified an error introduced during the preparation of the manuscript in Figure 4, where the GAPDH bands were duplicated between Figures 4(d) and 4(h). In Figure 4(d), “ox-LDL + mimics” should also be corrected to “ox-LDL + siRNA.”

Additionally, the significance indicators were omitted from Figures 1, 2, 4, and 5 in error, and in Table 1, a primer was not included. The corrected figures and tables are as below.


GeneForward primersReversed primers

TCF 21CCTGGCTAACGACAAATACGTTTCAGGTCACTCTCGGGT
GAPDHTGTTCGTCATGGGTGTGAACATGGCATGGACTGTGGTCAT
miR-30-5p RTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGTGAGT
miR-30-5p FACACTCCAGCTGGGTGTAAACATCCTACACT
All RCTCAACTGGTGTCGTGGA
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT

Due to an error during manuscript preparation, the incorrect miRNA was stated in the title of the manuscript. The article has been updated from “MicroRNA-30-3p” to “MicroRNA-30-5p” as shown above.

The authors apologize for these errors and confirm that they do not impact the conclusions of the article.

References

  1. Z. Zhou, C. Yu, D. Zhang et al., “MicroRNA-30-5p Suppresses Inflammatory Factor-Induced Endothelial Cell Injury by Targeting TCF21,” Mediators of Inflammation, vol. 2019, Article ID 1342190, 2019. View at: Publisher Site | Google Scholar

Copyright © 2021 Zhenyu Zhou et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views50
Downloads99
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.