Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 1

Research Article

Autophagy Functions to Prevent Methylglyoxal-Induced Apoptosis in HK-2 Cells

Table 1

Primer sequences.

DNA targetSequence (5 to 3)

MAP1LC3BFGATGTCCGACTTATTCGAGAGC
RTTGAGCTGTAAGCGCCTTCTA

BECN11FCCATGCAGGTGAGCTTCGT
RGAATCTGCGAGAGACACCATC

FOXO3FCGGACAAACGGCTCACTCT
RGGACCCGCATGAATCGACTAT

TFE3FCCGTGTTCGTGCTGTTGGA
RGCTCGTAGAAGCTGTCAGGAT

TFEBFACCTGTCCGAGACCTATGGG
RCGTCCAGACGCATAATGTTGTC

FOXO1FTCGTCATAATCTGTCCCTACACA
RCGGCTTCGGCTCTTAGCAAA

CREBFTCAGCCGGGTACTACCATTC
RTCTCTTGCTGCTTCCCTGTT

GABARABFAGAAGAGCATCCGTTCGAGAA
RCCAGGTCTCCTATCCGAGCTT

ATG16LFAACGCTGTGCAGTTCAGTCC
RAGCTGCTAAGAGGTAAGATCCA

BNIP3FCAGGGCTCCTGGGTAGAACT
RCTACTCCGTCCAGACTCATGC

ACTINFCATGTACGTTGCTATCCAGGC
RCTCCTTAATGTCACGCACGAT

AMPKαFTTG AAA CCT GAA AAT GTC CTG CT
RGGT GAG CCA CAA CTT GTT CTT

ATG5FTGTGCTTCGAGATGTGTGGTT
RGTCAAATAGCTGACTCTTGGCAA

ATG12FTAGAGCAACACGAACCATCC
RCACTGCCAAAACACTCATAGAGA

p62/SQSTM-1FGACTACGACTTGTGTAGCCTC
RAGTGTCCGTGTTTCACCTTCC

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.