Table of Contents Author Guidelines Submit a Manuscript
Stem Cells International
Volume 2016, Article ID 3162363, 10 pages
http://dx.doi.org/10.1155/2016/3162363
Research Article

Dynamic Changes in Occupancy of Histone Variant H2A.Z during Induced Somatic Cell Reprogramming

1Department of Animal Breeding & Genetics, College of Animal Science & Technology, Nanjing Agricultural University, Nanjing 210095, China
2Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123, China
3Medical College, Hunan Normal University, Changsha 410006, China
4Jinling Hospital, Medical School of Nanjing University, Nanjing 210093, China
5State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275, China

Received 8 April 2015; Accepted 25 August 2015

Academic Editor: Aster H. Juan

Copyright © 2016 Fulu Dong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Supplementary Material

qPCR

H2A.Z deposited DNA by ChIP were used for qPCR by primers followed: hoxa11(F: 5’GCACAGCCTCTGGAGTTTTC3’, R: 5’CAAGCCTAGTTCAGCTTGGG3’), hoxb13 (F: 5’TTGCAGACTCCTGGTGTGAG3’, R: 5’TTGCGCCTCTTGTCCTTAGT3’), zfpm2 (F: 5’GGATGAAGTTCTCAGAGCTGGT3’, R: 5’GCGCGAACTTTTACACCTACTT3’), Irx2 (F: 5’TAACACGGCCTGAAATCTTCTC3’, R: 5’GCATCCCACTTCTACAGTCCTC3’), pax5 (F: 5’ATGGGAGTTTGTTTTCCTGTGT3’, R: 5 AGTGATGTTTGGCCTAATCCTG3’), neurog1 (F: 5’CTGAAGCCGAGGGACTACTG3’, R: 5’TCACCAAGATTGAGACGCTG3’), hoxb2 (F: 5’TTTCTTCGCTGCAGACTCCT3’, R: 5’ATCCACGAGTGGAGAAGGC3’).

The qPCR were carried out by FastStart Universal SYBR Green Master (Roche Diagnostics, Rotkreuz, Switzerland) and analyzed using an ABI7300 fluorescence quantitative PCR instrument (Applied Biosystems, Foster City, CA, USA). The expression level of each gene was normalized to the amount of IgG ChIP DNA.

Statistical analysis.

Independent experiments were performed at least three times, and data analyses were carried out using one-way ANOVA with the Tukey model procedure in GraphPad Prism (version 5.01, GraphPad Software) and SPSS (version 16.0).

For visual illustrations, –log10 (P-value) from the GO result was used in the histogram and line chart by SigmaPlot (Systat Software, Inc., San Jose, CA, USA).

  1. Supplementary Material