The Scientific World Journal

The Scientific World Journal / 2013 / Article

Research Article | Open Access

Volume 2013 |Article ID 924276 | https://doi.org/10.1155/2013/924276

Yang Wang, Li Yi, Zhicheng Zhang, Hongjie Fan, Xiangchao Cheng, Chengping Lu, "Overexpression of luxS Cannot Increase Autoinducer-2 Production, Only Affect the Growth and Biofilm Formation in Streptococcus suis", The Scientific World Journal, vol. 2013, Article ID 924276, 6 pages, 2013. https://doi.org/10.1155/2013/924276

Overexpression of luxS Cannot Increase Autoinducer-2 Production, Only Affect the Growth and Biofilm Formation in Streptococcus suis

Academic Editor: D. Ustek
Received28 Aug 2013
Accepted24 Sep 2013
Published07 Nov 2013

Abstract

LuxS/AI-2 quorum sensing (QS) system involves the production of cell signaling molecules via luxS-based autoinducer-2 (AI-2). LuxS has been reported to plays critical roles in regulating various behaviors of bacteria. AI-2 is a byproduct of the catabolism of S-adenosylhomocysteine (SAH) performed by the LuxS and Pfs enzymes. In our previous study, the function of LuxS in AI-2 production was verified in Streptococcus suis (SS). Decreased levels of SS biofilm formation and host-cell adherence as well as an inability to produce AI-2 were observed in bacteria having a luxS mutant gene. In this study, the level of AI-2 activity exhibits a growth-phase dependence with a maximum in late exponential culture in SS. An SS strain that overexpressed luxS was constructed to comprehensively understand the function of AI-2. Overexpressed luxS was not able to increase the level of pfs expression and produce additional AI-2, and the bacteria were slower growing and produced only slightly more biofilm than the wild type. Thus, AI-2 production is not correlated with luxS transcription. luxS expression is constitutive, but the transcription of pfs is perhaps correlated with AI-2 production in SS.

1. Introduction

Quorum sensing is a chemical communication system among bacteria [1], which has been confirmed to be involved in a wide variety of biological processes, such as bioluminescence, biofilm formation, adherence, and virulence [2]. Several types of QS systems have been described in various species of bacteria. This LuxS/AI-2 QS system involves the production of cell signaling molecules via luxS-based autoinducer-2 (AI-2). AI-2 synthesis is linked to the metabolism of S-adenosylmethionine. Methylation reactions frequently use S-adenosylmethionine as the methyl donor to generate S-adenosylhomocysteine (SAH) [3]. SAH is hydrolyzed to adenine and 4,5-dihydroxy-2,3-pentanedione (DPD) by the nucleosidase Pfs and the LuxS enzyme [4]. Upon formation, DPD spontaneously cyclizes to form at least two different interspecies communication molecules described as AI-2 [5]. A broad range of gram-positive and gram-negative bacteria have been suggested to harbor luxS orthologs, most of which can produce AI-2 [3, 6]. AI-2 has been shown to be involved in biofilm formation and gene expression in many bacterial species.

Streptococcus suis (SS) is a zoonotic pathogen associated with a wide range of diseases in pigs, including meningitis, septicaemia, pneumonia, endocarditis, and arthritis. It is also a problematic zoonotic agent for humans exposed to diseased pigs or their products because it causes life threatening diseases [7]. In a previous study, we found that the luxS gene of SS functions in AI-2 production, and mutant SS having a luxS deletion showed decreased biofilm formation, less adherence, and reduced virulence [8, 9].

The purpose of this study was to determine the regulation of AI-2 production and whether AI-2 production was regulated at the expression level of luxS gene whose product is directly involved in AI-2 generation, especially in the overexpression luxS SS strain. The results demonstrated that the level of AI-2 activity exhibits a growth-phase dependence, with a maximum in the late exponential culture in SS. Overexpressed luxS was not able to increase the level of pfs expression and produce additional AI-2, and therefore there was slower growth and a slight increase in biofilm formation compared to wild type.

2. Materials and Methods

2.1. Bacterial Strains, Culture Conditions, and Plasmids

Bacterial strains, plasmids, and growth conditions used are listed in Table 1. The HA9801 strain was isolated from SS2 infected pigs in the Jiangsu Province in 1998 and was confirmed as a virulent strain [10]. The luxS mutant of HA9801 (ΔluxS) and the complementation strain (CΔluxS) were constructed in a previous study [8]. SS2 strains were grown in Todd-Hewitt broth (THB) (Difco Laboratories, Detroit, MI) medium or plated on THB agar with 5% (vol/vol) sheep blood. THB medium supplemented with 1% fibrinogen was used in the biofilm assay. When necessary, 100 μg/mL of spectinomycin (Spc) (Sigma) or 4 μg/mL of chloromycetin (Cm) (Sigma) were used for SS transformants, and 50 μg/mL of ampicillin (Amp) (Sigma) was applied to screen the E. coli transformants. For overexpression plasmid construction, the structural gene of the luxS gene, including its own promoter, was amplified from chromosomal DNA of HA9801 by PCR using the primers Cup and Cdown (Table 1). The PCR product was cut with EcoR I/BamH I and ligated into the EcoR I/BamH I digested E. coli/Streptococcus shuttle vector pSET2 to generate the recombinant plasmid pSET2-C. Then, the recombinant plasmid and original pSET2 were separately electrotransformed into the parent strain competent cells. Transformed cells were selected with spectinomycin in THB medium. The transformants of SS containing the recombinant plasmid were designated as the overexpression strain of HA9801 (luxS+).


Strain, plasmid, and primer Relevant characteristicsa or sequence (5′-3′)bSource of references

Strains
 HA9801Virulent strain of SS2 isolated from dead pigCollected in our laboratory
 ΔluxS Mutation in luxS gene of HA9801; Cmr[8]
 CΔluxS Complemented strain of ΔluxS; Spcr; Cmr[8]
luxS+Overexpressing strain of luxS; SpcrIn this study
E. coli DH5aCloning host for maintaining the recombinant plasmidsInvitrogen
V. harveyi BB170BB120 luxN::Tn5 (sensor 1, sensor 2+) V. harveyi [11]
V. harveyi BB120Wild type V. harveyi [11]
Plasmid
 pMD18-T vectorClone vectorTakara
 pSET2 vectorE. coli-S. suis shuttle vector; Spcr[8]
Primers
 CupCCGG AATTCACCTCGGTTCCTTGTCTGIn this study
 CdownGCGGGATCCGCTTCTTGTTCTGCGTTT; amplifies the structural gene of the luxS gene, including its own promoter (922bp)In this study
 LuxS-FCAAGTCATCAAGTCGAGTTTGGAAGIn this study
 LuxS-RTCTTTAGCTGAATGAAGGCTGTGG; real-time for luxS In this study
 Pfs-FCGTTCTTGTTCAGTCAGGTATCGGIn this study
 Pfs-RGATGGCAATACCTTCAGCAACAG; real-time for pfs In this study
 16S rRNA-FGTTGCGAACGGGTGAGTAAIn this study
 16S rRNA-RTCTCAGGTCGGCTATGTATCG; real-time for 16S rRNAIn this study

Apr, ampicillin resistant; Spcr, spectinomycin resistant; Cmr, chloramphenicol resistant; bUnderlined nucleotides are restriction sites of the enzymes.

2.2. Real-Time PCR to Detect the Expression Level of luxS and pfs in the HA9801 and luxS+ Strains

Total RNA from growing in THB media at 1, 5, 10, and 14 h were extracted using Trizol reagent (Invitrogen), according to the manufacturer’s protocol. SYBR Premix Ex Taq (TAKARA) was used for real-time PCR experiments in an ABI PRISM 7300 fast real-time PCR. The 16S rRNA gene was a housekeeping internal control [12]. The specific primers used for the various RT-PCR assays are listed in Table 1. At the end of each cycle, the fluorescence emitted by SYBR Green was measured. The comparative cycle threshold method ( method) was used to analyze the mRNA levels [8].

2.3. AI-2 Bioassay

The AI-2 bioassay was performed according to the method previously described [8, 11]. The Vibrio harveyi BB170 was grown at 30°C in AB medium. After 4 h growth, V. harveyi BB170 cultures were diluted 1 : 5000 in fresh AB medium. 10 μL of cell-free supernatant was added to 90 μL of thawed diluted BB170 culture in a white, flat-bottomed, 96-well plate. Bioluminescence relative to uninoculated medium was calculated as fold induction [8]. For a single experiment, the V. harveyi bioassay was performed at least in duplicate for each sample. Experiments were repeated at least three times.

2.4. Growth Characteristics and AI-2 Activity in Different Growth Phases

The wild-type strain HA9801 and overexpression strain luxS+ were inoculated in THB media at the same concentration and cultured at 37°C. The optical density at 600 nm (OD600) of the culture was determined every hour to generate the growth curve.

The presence of AI-2 activity in the culture supernatant was tested every two hours as described above. The experiments were done in triplicate.

2.5. Biofilm Plate Assay

SS was tested for production of biofilm using the protocol described in our previous report [8]. Briefly, an overnight culture of SS was diluted to obtain an OD600 of 0.2 into fresh medium and incubated at 37°C for 24 h or 48 h before being stained with crystal violet. After fixing with methanol, staining was measured at 595 nm. All assays were performed in triplicate and repeated 3 times.

2.6. Statistical Analyses

Statistical analyses were carried out using the Graphpad Software package (GraphPad Software, La Jolla, CA). One way ANOVA was used in analysis of the biofilm formation. The mean values are shown in the figures. Where appropriate, the data were analyzed using the Student’s test, and a value of was considered significant.

3. Results and Discussion

3.1. Transcriptional Analysis of the Level of luxS and pfs mRNA at the luxS+ and HA9801 Strains

Using overexpression techniques and knockout genes is the best way to study the luxS gene in S. suis HA9801. The expression level of luxS is displayed in Figure 1(a). The luxS+ and HA9801 strains have similar curves describing their respective luxS mRNA levels. The luxS+ strain had a higher luxS expression level than the HA9801 strain in all growth periods ( , except at 14 h). In both luxS+ and HA9801, the level of luxS mRNA increased slowly from the 1 h to the 5 h, and then increased from the 5 h to the 10 h. After this, the level of luxS mRNA decreased slowly. The level of luxS was higher in the late exponential phase (10 h) than in the early exponential phase (5 h) and decline phase (14 h).

Figure 1(b) shows that the level of pfs mRNA quickly increased from 1 h to 10 h, reached a maximum level at the late exponential phase (10 h) in both the luxS+ and HA9801 strains, and then quickly decreased when SS was grown to the stationary phase (14 h). The pfs expression level of the luxS+ strain had similar curves with the HA9801 strain in all growth periods ( ). Overexpressing luxS in the HA9801 strain had no effect on the pfs expression level.

3.2. Growth-Dependent AI-2 Production by the luxS+ and HA9801 Strains

In order to determine whether SS synthesis of AI-2 was growth-phase dependent, cell-free supernatants were collected at 4, 6, 8, 10, 12, and 14 h from a culture of SS HA9801 or luxS+ (Figure 2). Prepared supernatants were stored at 4°C until the end of all experimental time courses, and all samples from each culture were assayed together in separate 96-well microtiter plates. The AI-2 activity increased over the first 10 h following inoculation. AI-2 activity peaked in the late exponential growth phase and then declined gradually in the stationary phase (Figure 2). The level of AI-2 activity exhibited a growth-phase dependence with a maximum in late exponential culture, as previously observed in Bacillus anthracis and Streptococcus gordonii [13, 14], suggesting that the activity of the molecule is density dependent in SS. Interestingly, the luxS+ strain exhibited lagged growth relative to the WT strain. Furthermore, when AI-2 activity of the luxS+ strain was compared with that of the WT strain, no significant difference was detected ( ). Our result that the strain with the plasmid-born luxS showed slower growth is in agreement with the observations of Van et al. for Serratia plymuthica RVH1 [15] and Zhang et al. for Edwardsiella tarda [16]. However, they all reported that overexpression of the luxS gene, which was accompanied by an increased production of AI-2, resulted in a slower growth [15, 16]. In contrast, these groups had not detected the level of pfs transcription in the overexpression strain. Perhaps the reason for this was that the overexpression strain with luxS on high-copy plasmid increased the level of pfs transcription and was a result of overproduction of AI-2. In our study, the overexpression of luxS did not seem to increase the level of AI-2 production, instead only affecting bacterial growth in SS.

3.3. AI-2 Activity in Different SS Strains

To analyze the effect of AI-2 signaling in SS, we created a ΔluxS mutant strain, a complementation strain, and an overexpression strain (luxS+) in SS HA9801. In the late exponential to the stationary exponential phase, the SS culture supernatant had the largest AI-2 luminescence response (Figure 2). The culture supernatant from the ΔluxS mutant strain induced a luminescence signal that was comparable to the signal from the negative control, which was much lower than that of the WT strain. However, the complementation strain restored AI-2 to the level of the WT strain. The overexpression strain (luxS+) generated similar levels of bioluminescence as the WT strain HA9801 (Figure 3).

These results suggest that in SS, luxS is necessary for AI-2 synthesis and encodes a functional AI-2 or AI-2-like molecule. However, the luxS+ overexpression strain did not produce a higher level of AI-2 than was produced by the WT strain, possibly because luxS transcription does not correlate with AI-2 production; however, transcription of pfs is highly correlated with AI-2 production in SS. Similar results have been reported by Beeston that luxS expression is constitutive but that the transcription of pfs is tightly correlated to AI-2 production in Salmonella serovar Typhimurium [17]. Consequently, it follows that the level of pfs transcription was not altered in the luxS+ strain (Figure 1(b)).

3.4. The Ability of Different SS Strains to Form Biofilm

The abilities of the wild type, mutant, complementation, and overexpression strains to develop biofilms in 96-well microtiter plates were determined using the Crystal Violet (CV) assay (Figure 4). When these plates were incubated under the same culture conditions at 37°C for 24 h without agitation, the WT strain HA9801 formed considerably more biomass (OD595, 0.69 ± 0.11) than the luxS mutant strain (OD595, 0.50 ± 0.08) ( ). Furthermore, the biofilm formed by the luxS+ overexpression strain (OD595, 0.76 ± 0.12) was slightly increased to those of the WT strain HA9801 and the complementation strain (Figure 4).

Because the luxS gene plays a vital role in biofilm formation, adherence, and gene expression in SS [8], it can be hypothesized that the overexpression level of luxS mRNA can increase SS biofilm formationviaregulation of the major adhesion-associated genes such as gapdh and fbps, which mediated the adhesion, invasion, and colonization capacity of SS to host cells [18]. The results are consistent with those from qRT-PCR, in which expression of gapdh and fbps was slightly increased in the luxS+ (date not shown). After 48 h of plate incubation, all tested strains showed a significant increase in biofilm formation compared to plates incubated for 24 h ( ). Similar results have been reported for Bacillus cereus [19]. In one study, Rickard reported that the biovolume of a monospecies biofilm increased over time following inoculation [20]. Time-resolved inspection of biofilm development revealed that each strain exhibited an increase in total biovolume over time.

4. Conclusions

This study has demonstrated that the level of AI-2 activity exhibits a growth-phase dependence with a maximum in late exponential culture in SS, and overexpressed luxS is not able to increase the level of pfs expression and produce additional AI-2, and therefore has slower growth and slightly increases biofilm formation. Thus, AI-2 production is not correlated with luxS transcription. luxS expression is constitutive but, the transcription of pfs is perhaps correlated to AI-2 production in SS.

Conflict of Interests

The authors have not declared any conflict of interests.

Authors’ Contributions

Yang Wang and Chengping Lu designed the study. Yang Wang and Li Yi performed most of the experiments, analysed the data, provided figures and tables, and writing the paper. Zhicheng Zhang and Xiangchao Cheng did some experiments and analysed data. Hongjie Fan and Chengping Lu supervised the study and contributed to writing the paper. Both authors read and approved the final paper. Yang Wang and Li Yi contributed equally to this work.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (31201910), the Science and Technology Research Foundation of Henan Province Educational Committee (13A230261), Foundation for University Key Teacher by the Ministry of Education of Henan Province, State Key Laboratory of Veterinary Etiological Biology, Henan provincial science and technology department (122102310335), Major project of Nanjing Science and Technology Committee (201201026), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

References

  1. J. E. González and N. D. Keshavan, “Messing with bacterial quorum sensing,” Microbiology and Molecular Biology Reviews, vol. 70, no. 4, pp. 859–875, 2006. View at: Publisher Site | Google Scholar
  2. A. Vendeville, K. Winzer, K. Heurlier, C. M. Tang, and K. R. Hardie, “Making “sense” of metabolism: autoinducer-2, LuxS and pathogenic bacteria,” Nature Reviews Microbiology, vol. 3, no. 5, pp. 383–396, 2005. View at: Publisher Site | Google Scholar
  3. K. R. Hardie and K. Heurlier, “Establishing bacterial communities by “word of mouth”: LuxS and autoinducer 2 in biofilm development,” Nature Reviews Microbiology, vol. 6, no. 8, pp. 635–643, 2008. View at: Publisher Site | Google Scholar
  4. B. Gopishetty, J. Zhu, R. Rajan et al., “Probing the catalytic mechanism of s-ribosylhomocysteinase (LuxS) with catalytic intermediates and substrate analogues,” Journal of the American Chemical Society, vol. 131, no. 3, pp. 1243–1250, 2009. View at: Publisher Site | Google Scholar
  5. W. R. J. D. Galloway, J. T. Hodgkinson, S. D. Bowden, M. Welch, and D. R. Spring, “Quorum sensing in gram-negative bacteria: small-molecule modulation of AHL and AI-2 quorum sensing pathways,” Chemical Reviews, vol. 111, no. 1, pp. 28–67, 2011. View at: Publisher Site | Google Scholar
  6. A. W. Decho, R. S. Norman, and P. T. Visscher, “Quorum sensing in natural environments: emerging views from microbial mats,” Trends in Microbiology, vol. 18, no. 2, pp. 73–80, 2010. View at: Publisher Site | Google Scholar
  7. M. Gottschalk, J. Xu, C. Calzas, and M. Segura, “Streptococcus suis: a new emerging or an old neglected zoonotic pathogen?” Future Microbiology, vol. 5, no. 3, pp. 371–391, 2010. View at: Publisher Site | Google Scholar
  8. Y. Wang, W. Zhang, Z. Wu, X. Zhu, and C. Lu, “Functional analysis of luxS in Streptococcus suis reveals a key role in biofilm formation and virulence,” Veterinary Microbiology, vol. 152, no. 1-2, pp. 151–160, 2011. View at: Publisher Site | Google Scholar
  9. M. Cao, Y. Feng, C. Wang et al., “Functional definition of LuxS, an autoinducer-2 (AI-2) synthase and its role in full virulence of Streptococcus suis serotype 2,” Journal of Microbiology, vol. 49, no. 6, pp. 1000–1011, 2011. View at: Publisher Site | Google Scholar
  10. H. C. Yao, G. Chen, and C. Lu, “The identification of swine streptococcus isolates of Jiangsu province in 1998,” Journal of Nanjing Agricultural University, vol. 22, pp. 67–70, 1999. View at: Google Scholar
  11. X. G. Han and C. P. Lu, “Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2,” Current Microbiology, vol. 58, no. 2, pp. 146–152, 2009. View at: Publisher Site | Google Scholar
  12. Y. Wang, W. Zhang, Z. Wu, and C. Lu, “Reduced virulence is an important characteristic of biofilm infection of Streptococcus suis,” FEMS Microbiology Letters, vol. 316, no. 1, pp. 36–43, 2011. View at: Publisher Site | Google Scholar
  13. M. B. Jones and M. J. Blaser, “Detection of a luxS-signaling molecule in Bacillus anthracis,” Infection and Immunity, vol. 71, no. 7, pp. 3914–3919, 2003. View at: Publisher Site | Google Scholar
  14. R. McNab, S. K. Ford, A. El-Sabaeny, B. Barbieri, G. S. Cook, and R. J. Lamont, “LuxS-based signaling in Streptococcus gordonii: autoinducer 2 controls carbohydrate metabolism and biofilm formation with Porphyromonas gingivalis,” Journal of Bacteriology, vol. 185, no. 1, pp. 274–284, 2003. View at: Publisher Site | Google Scholar
  15. R. van Houdt, P. Moons, A. Jansen, K. Vanoirbeek, and C. W. Michiels, “Isolation and functional analysis of luxS in Serratia plymuthica RVH1,” FEMS Microbiology Letters, vol. 262, no. 2, pp. 201–209, 2006. View at: Publisher Site | Google Scholar
  16. M. Zhang, K. Sun, and L. Sun, “Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain,” Microbiology, vol. 154, no. 7, pp. 2060–2069, 2008. View at: Publisher Site | Google Scholar
  17. A. L. Beeston and M. G. Surette, “pfs-dependent regulation of autoinducer 2 production in Salmonella enterica serovar typhimurium,” Journal of Bacteriology, vol. 184, no. 13, pp. 3450–3456, 2002. View at: Publisher Site | Google Scholar
  18. Z. P. Chen, M. M. Qu, H. X. Chen et al., “The studies of anti-inflammatory and analgesic activities and pharmacokinetics of Oxytropis falcate Bunge extraction after transdermal administration in rats,” Fitoterapia, vol. 82, no. 3, pp. 426–433, 2011. View at: Publisher Site | Google Scholar
  19. S. Auger, E. Krin, S. Aymerich, and M. Gohar, “Autoinducer 2 affects biofilm formation by Bacillus cereus,” Applied and Environmental Microbiology, vol. 72, no. 1, pp. 937–941, 2006. View at: Publisher Site | Google Scholar
  20. A. H. Rickard, R. J. Palmer Jr., D. S. Blehert et al., “Autoinducer 2: a concentration-dependent signal for mutualistic bacterial biofilm growth,” Molecular Microbiology, vol. 60, no. 6, pp. 1446–1456, 2006. View at: Publisher Site | Google Scholar

Copyright © 2013 Yang Wang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

1155 Views | 569 Downloads | 11 Citations
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.