Research Article
Overexpression of luxS Cannot Increase Autoinducer-2 Production, Only Affect the Growth and Biofilm Formation in Streptococcus suis
Table 1
Characteristics of bacterial strains, plasmids, and primers used in this study.
| Strain, plasmid, and primer | Relevant characteristicsa or sequence (5′-3′)b | Source of references |
| Strains | | | HA9801 | Virulent strain of SS2 isolated from dead pig | Collected in our laboratory | ΔluxS | Mutation in luxS gene of HA9801; Cmr | [8] | CΔluxS | Complemented strain of ΔluxS; Spcr; Cmr | [8] | luxS+ | Overexpressing strain of luxS; Spcr | In this study | E. coli DH5a | Cloning host for maintaining the recombinant plasmids | Invitrogen | V. harveyi BB170 | BB120 luxN::Tn5 (sensor 1−, sensor 2+) V. harveyi | [11] | V. harveyi BB120 | Wild type V. harveyi | [11] | Plasmid | | | pMD18-T vector | Clone vector | Takara | pSET2 vector | E. coli-S. suis shuttle vector; Spcr | [8] | Primers | | | Cup | CCGG AATTCACCTCGGTTCCTTGTCTG | In this study | Cdown | GCGGGATCCGCTTCTTGTTCTGCGTTT; amplifies the structural gene of the luxS gene, including its own promoter (922bp) | In this study | LuxS-F | CAAGTCATCAAGTCGAGTTTGGAAG | In this study | LuxS-R | TCTTTAGCTGAATGAAGGCTGTGG; real-time for luxS | In this study | Pfs-F | CGTTCTTGTTCAGTCAGGTATCGG | In this study | Pfs-R | GATGGCAATACCTTCAGCAACAG; real-time for pfs | In this study | 16S rRNA-F | GTTGCGAACGGGTGAGTAA | In this study | 16S rRNA-R | TCTCAGGTCGGCTATGTATCG; real-time for 16S rRNA | In this study |
|
|
Apr, ampicillin resistant; Spcr, spectinomycin resistant; Cmr, chloramphenicol resistant; bUnderlined nucleotides are restriction sites of the enzymes.
|