The Scientific World Journal / 2014 / Article / Tab 2

Research Article

Sequence Variants of ADIPOQ and Association with Type 2 Diabetes Mellitus in Taiwan Chinese Han Population

Table 2

Primers utilized in allele-specific PCR analysis.

Gene/SNPPrimers, 5′-3′Product size

ADIPOQ/rs2241766F: GCAGCTCCTAGCCGTAGACTCTGCTG 
R: GGAGGTCTGTGATGAAAGAGGCC 
FG: TGCTATTAGCTCTGCCCGAG
FT: TGCTATTAGCTCTGCCCGAT
372 bp

226 bp

ADIPOQ/rs1501299F: CCTGGTGAGAAGGGTGAGAA 
R: AGATGCAGCAAAGCCAAAGT 
FG: TGATATAAACTATATGAATG
FT: TGATATAAACTATATGAATT
241 bp

168 bp

TCF7L2/rs7903146F: GCCTCAAAACCTAGCACAGC 
R: GTGAAGTGCCCAAGCTTCTC 
FC: GCTAAGCACTTTTTAGATGC
FT: GCTAAGCACTTTTTAGATGT
220 bp

176 bp

TCF7L2/rs12255372F: CTTGAGGTGTACTGGAAACTAAGGC 
R: CTGTCTATTTGGCATTCAAATGGA 
FG: GGAATATCCAGGCAAGAACG
FT: GGAATATCCAGGCAAGAACT
251 bp

130 bp

SNP: single nucleotide polymorphism; F: forward; R: reverse.