The Scientific World Journal / 2015 / Article / Tab 1

Research Article

The Alpaca Melanocortin 1 Receptor: Gene Mutations, Transcripts, and Relative Levels of Expression in Ventral Skin Biopsies

Table 1

Primer sequences used in coding sequence amplification, and RACE experiments, and expression analysis of MC1R gene.

Primer namePrimer sequence (-)

MCRF3ATGCCTGTGCTCGGCCCCCAGAGGA
MCfwGGCTCCCTCAACTCCACC
MC1RFwAGACCCTTTCCTGCTCCCTG
MCR5R1TCACCAGGAGCACTGCAGCACTTC
MCR5R2GTTCTCCACGAGGCTCACCAG
MCR5R3GCAGCAGATGAAGTAATACATGGGAG
GAPFwATCACTGCCACCCAGAAGAC
GAPRvCTGCTTCACCACCTTCTTGA
O dTmodiGAGAGAGAGAGAGACAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT
NSTodtGAGAGAGAGAGAGACAGAGAACTAGTCTCGAG
SAAAGCAGTGGTATCAACGCAGAGTGNNNNN
ASAp-ACTCTGCGTTGATACCACTGCTT (-phosphorylated)