BioMed Research International

BioMed Research International / 2014 / Article
Special Issue

Coastal Biotechnology: Facing the Global and Regional Changes

View this Special Issue

Research Article | Open Access

Volume 2014 |Article ID 487050 |

Zhengyi Liu, Lei Zhang, Yang Pu, Zhaopu Liu, Zhiling Li, Yushan Zhao, Song Qin, "Cloning and Expression of a Cytosolic HSP90 Gene in Chlorella vulgaris", BioMed Research International, vol. 2014, Article ID 487050, 11 pages, 2014.

Cloning and Expression of a Cytosolic HSP90 Gene in Chlorella vulgaris

Academic Editor: Hanzhi Lin
Received04 Dec 2013
Accepted16 Jan 2014
Published13 Mar 2014


Heat shock protein 90 (HSP90), a highly conserved molecular chaperone, plays essential roles in folding, keeping structural integrity, and regulating the subset of cytosolic proteins. We cloned the cDNA of Chlorella vulgaris HSP90 (named CvHSP90) by combining homology cloning with rapid amplification of cDNA ends (RACE). Sequence analysis indicated that CvHSP90 is a cytosolic member of the HSP90 family. Quantitative RT-PCR was applied to determine the expression level of messenger RNA (mRNA) in CvHSP90 under different stress conditions. C. vulgaris was kept in different temperatures (5–45°C) for 1 h. The mRNA expression level of CvHSP90 increased with temperature from 5 to 10°C, went further from 35 to 40°C, and reached the maximum at 40°C. On the other hand, for C. vulgaris kept at 35°C for different durations, the mRNA expression level of CvHSP90 increased gradually and reached the peak at 7 h and then declined progressively. In addition, the expression level of CvHSP90 at 40 or 45 in salinity () was almost fourfold of that at 25 in salinity () for 2 h. Therefore, CvHSP90 may be a potential biomarker to monitor environment changes.

1. Introduction

Heat shock proteins (HSPs) that first described in Drosophila melanogaster [1], are evolutionarily conserved protein families which are ubiquitous in all eukaryotic organisms. HSPs are essential for cells under both normal and stressed conditions as they participate in diverse processes ranging from cellular homeostasis and signal transduction to development [2]. In addition, HSPs also play key roles in defense responses against various environmental stresses that could potentially damage the cellular and molecular structures in the cells [3]. Therefore, HSPs are highly expressed in all organisms and are one of the most abundant proteins, contributing to 1-2% of total cellular proteins under normal conditions [4]. According to molecular weight, HSPs are mainly classified into six families including HSP40, HSP60, HSP70, HSP90, HSP100, and the small HSPs [5].

Among HSP families, heat shock protein 90 (HSP90) is highly conserved member. It is confirmed to locate in different cellular compartments including the chloroplasts, mitochondria, cytosol, nucleoplasm, and endoplasmic reticulum [6]. Under normal conditions, HSP90’s diverse roles in biological processes include regulating cellular physiology, signal transduction, and protein folding, degradation, and transportation [2, 79]. And it also can be regulated by various environmental stresses such as heat, salinity, desiccation, light, heavy metal, and arsenite stresses [1013].

Influenced by cyclic tide, algae mainly living in intertidal zone are periodically exposed to a variety of potentially stressful factors including heat or cold shock, high light, and desiccation [14]. To understand the resistant mechanism, the expression of HSPs genes have been investigated in some macroalgae such as Chondrus, Porphyra, Undaria, Laminaria, Saccharina, Fucus, and Ulva [1522] and a few microalgae such as Chlamydomonas and Haematococcus [2327]. These studies indicate that the algal HSPs centrally function in resisting a wide variety of environmental stressors.

Chlorella vulgaris is a unicellular green alga growing in fresh water [28]. It can be used as live feed in fish aquaculture for its high content of proteins and fatty acids. In addition, because of its fast growth and low cost, C. vulgaris becomes a promising candidate bioreactor for large-scale production of value-added proteins [29]. C. vulgaris has important economical and ecological values but often confronts environmental adversities, including high temperature and high salinity. Therefore, it is often used as a eukaryotic model in studies on stress responses [30]. However, the role of HSPs in adverse stress resistance mechanism of C. vulgaris is yet to be performed.

To better understand the mechanism of response by C. vulgaris to different types of environmental stimulation, we obtained a HSP90 complementary DNA (cDNA) of C. vulgaris by combining homology cloning with rapid amplification of cDNA ends (RACE) approaches, analyzed in bioinformatics the structural features, homologous relationship, and phylogenetic position of CvHSP90, and investigated the messenger RNA (mRNA) expression levels of CvHSP90 under different stress conditions, using real-time quantitative RT-PCR (qRT-PCR).

2. Materials and Methods

2.1. Sample Collection and Treatment

Chlorella vulgaris was presented from Institute of Oceanology, Chinese Academy of Sciences, and then the Chlorella was grown in Erlenmeyer flasks in F/2 medium that was filter-sterilized through 0.22 μm filters (Millipore, USA). Cultures in liquid medium or on plate were grown at 20°C in an artificial climate incubator. Cool-white fluorescent tubes were used to provide irradiance at 200 μmol photons m−2 s−1 in a long-daylight scheme (12 : 12 h light : dark).

In addition, C. vulgaris was kept in 40°C for 1 h for extracting total RNA and cloning full-length cDNA of CvHSP90 gene. In our heat shock temperature treatment, C. vulgaris was kept in different temperatures (5, 10, 15, 20, 25, 30, 35, 40, and 45°C) for 1 h to investigate the thermal effect on the expression level of CvHSP90 mRNA. In heat shock time treatment, C. vulgaris was kept at 35°C for different times (0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, and 12 h, resp.) to investigate the effects of heat shock times on expression level of CvHSP90 mRNA. In salt concentration challenge treatments, C. vulgaris was kept at 20°C in different salt concentrations (0, 5, 10, 15, 20, 25, 30, 35, 40, and 45 in ) for 2 h to investigate the effects of salt challenges on expression level of CvHSP90.

2.2. RNA Extraction

Total RNA extraction from C. vulgaris was performed using the TRIzol reagent (Invitrogen). The cDNA first-strand was synthesized based on M-MLV RT usage information (Promega) using RQI DNase (Promega)-treated total RNA as template. cDNA mix was diluted to 1 : 50 and stored at −80°C for subsequent fluorescent real-time PCR.

2.3. CvHSP90 cDNA Cloning

To amplify the partial fragment of CvHSP90 gene from Chlorella vulgaris, two homologous cloning primers P1 and P2 were designed based on the conserved sequence of known HSP90s (Table 1). PCR was performed in a 25 μL reaction volume containing 2.5 μL 10X PCR buffer, 2 μL dNTP (2.5 mmol L−1), 1 μL of each primer (10 μmol L−1), 0.2 μL (1 U) of Taq polymerase (Promega), 1 μL of cDNA template, and 17.3 μL of PCR-grade water. The PCR temperature profile was 94°C for 5 min followed by 33 cycles of 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, and a final extension step at 72°C for 10 min. The interesting fragment (745 bp) was excised and purified as per agarose gel DNA fragment recovery kit (TaKaRa), cloned into pMD-18T vector (TaKaRa), and sequenced (Sangon, Shanghai, China).

PrimersSequence (5′-3′)Sequence information

Oligo(dG)-adaptorGGCACGCGTCGACTAGTACG105′-RACE primer
P9AACTACGAGCTGCCAGACGGReal time actin primer
P10GAAGACAAGACGATGCTGAGGG Real time actin primer

To clone the full-length cDNA of CvHSP90, four specific primers, sense primers P3 and P4, and reverse primers P5 and P6 (Table 1) were designed based on the partial sequence amplified. Nested PCR strategy was applied to clone the 3′ end of CvHSP90 using sense primer P3, P4, and reverse primer adapter, while sense primer oligo(dG)-adaptor and reverse primer P5, P6 were used to obtain the 5′ end of CvHSP90. PCR amplification was performed using the same reaction system as described before. The PCR products were cloned into the pMD18-T simple vector (TaKaRa) and sequenced bidirectionally with primers M13-47 and RV-M (Table 1). The sequencing results were verified for cluster analysis.

2.4. Sequence Analysis of CvHSP90

CvHSP90 cDNA sequence was analyzed in the BLAST algorithm at National Centre for Biotechnology Information ( and the deduced amino acid sequence was analyzed with the Expert Protein Analysis System ( Characteristic domains or motifs were identified using the PROSITE profile database. Identity, similarity, and gap percentages were calculated using FASTA program. The Clustal W program ( was used for multiple alignment of CvHSP90. An unrooted phylogenetic tree was constructed according to amino acid sequences of the selected HSP90 by using the neighbor-joining (NJ) algorithm embedded in MEGA 3.1 program ( [31] and the programs of Clustal X 1.83 [32]. The bootstrap trials were replicated 1000 times to derive the confidence value for the phylogeny analysis.

2.5. Quantitative Analysis of CvHSP90 mRNA Expression

mRNA expression level of CvHSP90 was investigated by real-time PCR amplification on a fast real-time PCR system (Applied Biosystem 7500). A product of 150 bp from cDNA was amplified by two CvHSP90 gene-specific primers P7 and P8 (Table 1), and the PCR product was sequenced to verify the specificity of RT-PCR. An internal control, a 109 bp fragment, was amplified by two β-actin primers. The real-time PCR amplifications were carried out in a total volume of 20 μL mixture containing 10 μL SYBR Premix Ex Taq (TaKaRa, Tokyo, Japan), 2 μL cDNA, 0.4 μL each forward and reverse primer (10 μmol/L), 0.4 μL ROX Reference Dye (50X), and 6.8 μL PCR-grade water. The reactions conditions were 94°C for 5 min, followed by 40 cycles of 5 s at 94°C, and 30 s at 60°C. Five independent biological replicates were carried out. At the end of each PCR reaction, dissociation curve of amplicon was analyzed to confirm if only one PCR product was amplified and detected. After the PCR program, SDS software V2.01 (Applied Biosystems) was used to analyze the data, during which a baseline was set automatically for consistency. The expression level of CvHSP90 was analyzed by the method [33]. All data were expressed as mean ± SE () in terms of relative mRNA. Furthermore, the data were analyzed by ANOVA (one-way analysis of variance) followed by an unpaired two-tailed t-test. Difference was considered significant at .

3. Results

3.1. cDNA Cloning and Sequencing of CvHSP90 Gene

A CvHSP90 fragment (745 bp) was amplified by homologous cloning primers P1 and P2 and confirmed highly similar to other known HSP90s. Two pairs of CvHSP90-specific primers (P3-P4 and P5-P6) that designed in the above sequence were used to clone the full-length cDNA. RACE and nested PCR were performed to amplify the two fragments corresponding to the 3′ and 5′ end of the CvHSP90 cDNA. The full-length cDNA sequence of CvHSP90 was determined 3678 bp by cluster analysis of the above fragments.

3.2. Characterization of CvHSP90

The cDNA sequence of CvHSP90 was submitted in GenBank under accession number JQ655149. The full-length cDNA of CvHSP90 was 3678 bp, with a 107 bp 5′ untranslated region (5′UTR), a 1459-bp 3′ untranslated region (3′UTR) with a poly (A) tail, and a 2112 bp open reading frame (ORF) encoding a polypeptide that contained 703 amino acids with estimated molecular mass of 80.71 kDa and an estimated isoelectric point of 4.48. The five typical amino acid blocks of HSP90 protein family, (NKEIFLRE[L/I]ISN[A/S]SDALDKIR, LGTIARSGT, IGQFGVGFYSAYLVA[E/D], IKLYVRRVFI, G[V/I]VDSEDLPLNISRE) and the consensus MEEVD at the C-terminus were highly conserved as indicated in the CvHSP90 sequence (Figure 1) [34]. Meanwhile, SMART program revealed a typical histidine kinase-like ATPases domain in the position 27-182, which is ubiquitous in all HSP90 family members.

3.3. Homology Analysis of CvHSP90

Shown by Clustal W program, the deduced amino acid sequence of CvHSP90 shared high homology with those of other known HSP90s (Figure 2). For example, CvHSP90 shared 85% similarity to Micromonas sp. RCC299 HSP90 (XP_002499727) and Micromonas sp. RCC299 HSP90 (XP_002499727), 79% similarity to Haematococcus pluvialis HSP90 (JN627245), Chlamydomonas reinhardtii HSP90 (XP_001695264), and Volvox carteri f. nagariensis HSP90 (XP_002947115), and 78% similarity to Pennisetum glaucum HSP90 (ADP89125), Hordeum vulgare HSP90 (BAJ86355), Triticum aestivum HSP90 (ADF31758), Triticum urartu HSP90 (ADF31773), Vitis vinifera HSP90 (CAN62488), and Thellungiella halophila HSP90 (BAJ33984), and so forth (Table 2). Multiple sequence alignment exhibited high conservation between CvHSP90 and other known HSP90 proteins, especially in the regions of HSP90 family signatures (Figure 2).


Arabidopsis thaliana Streptophyta; Magnoliophyta; Eudicotyledons AAN3185977%
Chlamydomonas reinhardtii Chlorophyta; ChlorophyceaeXP_00169526479%
Chlorella vulgaris Chlorophyta; TrebouxiophyceaeJQ655149100%
Glycine max Streptophyta; Magnoliophyta; EudicotyledonsADC4539577%
Haematococcus pluvialis Chlorophyta; ChlorophyceaeJN62724579%
Hordeum vulgare subsp.  vulgare Streptophyta; Magnoliophyta; Liliopsida BAJ8635578%
Micromonas pusilla CCMP1545 Chlorophyta; MamiellophyceaeXP_00305810485%
Micromonas sp. RCC299Chlorophyta; MamiellophyceaeXP_00249972785%
Nicotiana benthamiana Streptophyta; Magnoliophyta; EudicotyledonsAAR1219477%
Pennisetum glaucum Streptophyta; Magnoliophyta; Liliopsida ADP8912578%
Physcomitrella patens subsp.  patens Streptophyta; Bryophyta; XP_00177741477%
Sorghum bicolor Streptophyta; Magnoliophyta; Liliopsida XP_00244480477%
Thellungiella halophila Streptophyta; Magnoliophyta; Eudicotyledons BAJ3398478%
Triticum aestivum Streptophyta; Magnoliophyta; LiliopsidaADF3175878%
Triticum urartu Streptophyta; Magnoliophyta; Liliopsida ADF3177378%
Vitis pseudoreticulata Streptophyta; Magnoliophyta; Eudicotyledons ABW9630877%
Vitis vinifera Streptophyta; Magnoliophyta; Eudicotyledons CAN6248878%
Volvox carteri f. nagariensis Chlorophyta; ChlorophyceaeXP_00294711579%
Zea mays Streptophyta; Magnoliophyta; LiliopsidaNP_00117047576%

To evaluate the molecular evolutionary relationships of CvHSP90 against other HSP90s, a phylogenetic tree based on the protein sequences (Figure 3) was constructed by neighbor-joining method. In the phylogenetic tree, the HSP90s are clustered into two major groups in the Streptophyta and Chlorophyta origin. CvHSP90 is clustered first with HSP90 from Mamiellophyceae (Micromonas sp. RCC299 and Micromonas pusilla CCMP1545) and then formed a sister group with those of Chlorophyta and further with those of Streptophyta. Relationships displayed in the phylogenic tree agree in overall with traditional taxonomy.

3.4. Expression Levels of CvHSP90 under Different Heat Shock Temperatures

The expression level of CvHSP90 was investigated by real-time quantitative PCR under different stressful conditions. As the optimal growth temperature for C. vulgaris is 20–25°C, different heat shock temperatures (5–45°C) was scheduled to study the mRNA expression levels of CvHSP90 (Figure 4). In 20°C and 25°C treatment groups, the expression levels of CvHSP90 were relatively low, while in 5°C and 35°C treatment groups were almost 2.5-fold of that in 20°C group (). The highest expression level (3-fold of that in 20°C group) was determined at 40°C for 1 h ().

3.5. Expression Levels of CvHSP90 at Different Heat Shock Times

In this study, we found that a long time (over 8 h) exposure at over 40°C would be fatal to C. vulgaris. Therefore, the organism was kept at 35°C for different hours to find the impact of different heat shock times on the expression level of CvHSP90. As shown in Figure 5, in 35°C, CvHSP90 mRNA expression level increased gradually and reached the maximum (4.2-fold of that of blank group) at 7 h () and then declined progressively to the original level at 12 h. Under a heat shock, the expression level of CvHSP90 was observed significantly different at 1, 2, 3, 4, 5, 8, and 9 h from that of the blank group ().

3.6. Expression Levels of CvHSP90 under Different Salt Concentrations

The expression levels of CvHSP90 at different salt concentrations for 2 h were detected (Figure 6). The expression level of CvHSP90 at 10, 15, 20, and 30 in salinity () for 2 h showed no significant difference from that at 25 in salinity. However, the expression level at salinity over 25 increased significantly (). The expression levels at 40 or 45 salinity were almost 4-fold of that at 25 salinity for 2 h (). The results show that C. vulgaris responded strongly to high salinity stress.

4. Discussion

HSP90, as an important member of HSPs, centrally functions in various biological processes in the presence and absence of stresses, including biogenesis, folding, transport, degradation, and prevention of misfolding and aggregation of cellular proteins and signal transduction [2, 9, 35]. In macroalgae, the expression of the HSP genes has been investigated in several genus as they usually live in intertidal zone which characterized by regular and extreme changes in abiotic conditions, based on tidal influence [14]. However, the studies of HSP90 in algae are relatively limited [21, 27]. Chlorella vulgaris, as an important economical species, is also an important model species in studies on stress responses [30]. Therefore, the role of Chlorella vulgaris HSP90 (designated CvHSP90) in response to adverse environment was investigated in this work.

In photosynthetic eukaryotes, Hsp90 family proteins are divided into five types with localization in different cellular compartments including nucleoplasm, chloroplasts, mitochondria, ER, and cytoplasm [6]. Sequence analysis of the deduced AA sequence showed that CvHSP90 contains the five typical signature motifs of the HSPs [10, 11, 36]. Moreover, the MEEVD motif which is cytoplasmic Hsp90-specific is identified at the C-terminus. The MEEVD motif participates in the formation of a Hsp90/Hop/Hsp70 protein complex concerning the assembly of steroid hormone receptors by associating with cytoplasmic Hsp70 through a Hsp-organizing protein (Hop). In addition, multiple alignment and phylogenetic analysis showed high similarities among the deduced amino acid sequence of CvHSP90 and other known HSP90s (more than 75% similarity in all the matches), especially with those from Mamiellophyceae Micromonas sp. RCC299 and Micromonas pusilla CCMP1545 (85% similarity in each match). In terms of sequence alignment, structure comparison, and phylogenetic analysis, CvHSP90 was confirmed to be a cytoplasmic Hsp90.

It is a main character for almost all organisms studied that the maximum expression of HSPs is 10–15°C above optimum growth temperature [18]. Moreover, it has been proved that the temperature treatment in the range 10–15°C below optimum growth temperature may also lead to the maximum expression of HSP90 [27]. Given that the normal growing temperature range of C. vulgaris is 20–25°C, in which the expression level of HSP90s is always low, it can be expected that the maximum CvHSP90 expression would be in the ranges of 35–40°C and 5–10°C, which was consistent with our results. In macroalgae, short time treatment in temperature higher than normal growth temperature can induce the expression of HSPs, which is upregulated by increased thermal stresses and then decreased progressively after the expression profile reached the maximum [37]. In this work, we observed that 45°C treatment which is 15°C over the optimum temperature led to the decrease of CvHSP90 expression, which may be caused by immediate deactivation or strong inhibition of enzyme-related mRNA synthesis and expression in C. vulgaris [19]. Furthermore, the time-dependent pattern of CvHSP90 expression in a heat shock was observed. In heat shock at 35°C, the expression increased progressively in 1 h and reached the maximum in 7 h and then declined gradually. Variance analysis indicated that the CvHSP90 gene expression in 6 or 7 hours after challenge was significantly higher () than those in other time points. These results suggested that the CvHSP90 expression is related to the response to thermal stress and heat shock time and may play an important role in the mechanism against the adverse environmental stresses. In natural environment, C. vulgaris usually grows in salinity 20–30. Its utilization in wastewater treatment suggests that it is highly resistant to a range of salinity. In this work, the result showed that the mRNA expression levels of CvHSP90 varied with salinity and suggested its function in resistance to salinity stress. In addition, the CvHSP90 expression at different times under a fixed level of salinity stress needs to be further studied.

5. Conclusions

The CvHSP90 gene can be expressed in response to challenges in thermal stress, heat shock time, and salinity. In a stressful environment, changes in HSP90s expression level are more sensitive than those of growth rate, death rate, and reproductive rate for monitoring environmental stresses. Therefore, CvHSP90 can be used as a potential biomarker in practice to monitor environment changes.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.


This work was supported by the National Key Technology R&D Program of China (Grant no. 2013BAB01B01).


  1. F. Ritossa, “A new puffing pattern induced by temperature shock and DNP in drosophila,” Experientia, vol. 18, no. 12, pp. 571–573, 1962. View at: Publisher Site | Google Scholar
  2. C. Prassinos, K. Haralampidis, D. Milioni, D. Samakovli, K. Krambis, and P. Hatzopoulos, “Complexity of Hsp90 in organelle targeting,” Plant Molecular Biology, vol. 67, no. 4, pp. 323–334, 2008. View at: Publisher Site | Google Scholar
  3. J. G. Sørensen, T. N. Kristensen, and V. Loeschcke, “The evolutionary and ecological role of heat shock proteins,” Ecology Letters, vol. 6, no. 11, pp. 1025–1037, 2003. View at: Publisher Site | Google Scholar
  4. P. Csermely, T. Schnaider, C. Soti, Z. Prohászka, and G. Nardai, “The 90-kDa molecular chaperone family: structure, function, and clinical applications. A comprehensive review,” Pharmacology and Therapeutics, vol. 79, no. 2, pp. 129–168, 1998. View at: Publisher Site | Google Scholar
  5. F. U. Hartl, A. Bracher, and M. Hayer, “Molecular chaperones in protein folding and proteostasis,” Nature, vol. 475, no. 7356, pp. 324–332, 2011. View at: Publisher Site | Google Scholar
  6. H. Hao, Y. Naomoto, X. Bao et al., “HSP90 and its inhibitors,” Oncology Reports, vol. 23, no. 6, pp. 1483–1492, 2010. View at: Publisher Site | Google Scholar
  7. G. Schatz and B. Dobberstein, “Common principles of protein translocation across membranes,” Science, vol. 271, no. 5255, pp. 1519–1526, 1996. View at: Google Scholar
  8. S. L. Rutherford and S. Lindquist, “Hsp90 as a capacitor for morphological evolution,” Nature, vol. 396, no. 6709, pp. 336–342, 1998. View at: Publisher Site | Google Scholar
  9. J. C. Young, I. Moarefi, and F. Ulrich Hartl, “Hsp90: a specialized but essential protein-folding tool,” Journal of Cell Biology, vol. 154, no. 2, pp. 267–273, 2001. View at: Publisher Site | Google Scholar
  10. D. Milioni and P. Hatzopoulos, “Genomic organization of hsp90 gene family in Arabidopsis,” Plant Molecular Biology, vol. 35, no. 6, pp. 955–961, 1997. View at: Publisher Site | Google Scholar
  11. D. Cao, J. E. Froehlich, H. Zhang, and C. L. Cheng, “The chlorate-resistant and photomorphogenesis-defective mutant cr88 encodes a chloroplast-targeted HSP90,” Plant Journal, vol. 33, no. 1, pp. 107–118, 2003. View at: Publisher Site | Google Scholar
  12. D. Liu, X. Zhang, Y. Cheng, T. Takano, and S. Liu, “rHsp90 gene is in response to several environmental stresses in rice (Oryza sativa L.),” Plant Physiology and Biochemistry, vol. 44, no. 5-6, pp. 380–386, 2006. View at: Publisher Site | Google Scholar
  13. X. Xu, H. Song, Z. Zhou, N. Shi, Q. Ying, and H. Wang, “Functional characterization of AtHsp90.3 in Saccharomyces cerevisiae and Arabidopsis thaliana under heat stress,” Biotechnology Letters, vol. 32, no. 7, pp. 979–987, 2010. View at: Publisher Site | Google Scholar
  14. I. R. Davison and G. A. Pearson, “Stress tolerance in intertidal seaweeds,” Journal of Phycology, vol. 32, no. 2, pp. 197–211, 1996. View at: Google Scholar
  15. J. Collén, I. G. Marsollier, J. J. Léger, and C. Boyen, “Response of the transcriptome of the intertidal red seaweed Chondrus crispus to controlled and natural stresses,” New Phytologist, vol. 176, no. 1, pp. 45–55, 2007. View at: Publisher Site | Google Scholar
  16. G. A. Pearson, G. Hoarau, A. Lago-Leston et al., “An expressed sequence tag analysis of the intertidal brown seaweeds Fucus serratus (L.) and F. vesiculosus (L.) (Heterokontophyta, Phaeophyceae) in response to abiotic stressors,” Marine Biotechnology, vol. 12, no. 2, pp. 195–213, 2010. View at: Publisher Site | Google Scholar
  17. W. Fu, J. Yao, X. Wang, F. Liu, G. Fu, and D. Duan, “Molecular cloning and expression analysis of a cytosolic Hsp70 gene from Laminaria japonica (Laminariaceae, Phaeophyta),” Marine Biotechnology, vol. 11, no. 6, pp. 738–747, 2009. View at: Publisher Site | Google Scholar
  18. W. D. Fu, Molecular cloning and expression analysis of cytosolic HSP70 genes from four kinds of seaweeds [Ph.D. thesis], 2009.
  19. W. D. Fu, L. Shuai, J. Yao, B. Zheng, M. Zhong, and D. Duan, “Molecular cloning and expression analysis of a cytosolic Hsp70 gene from Ulva pertusa (Ulvophyceae, Chlorophyta),” Journal of Applied Phycology, vol. 23, no. 4, pp. 681–690, 2011. View at: Publisher Site | Google Scholar
  20. H. S. Park, W. J. Jeong, E. Kim et al., “Heat shock protein gene family of the Porphyra seriata and enhancement of heat stress tolerance by PsHSP70 in Chlamydomonas,” Marine Biotechnology, vol. 14, no. 3, pp. 332–342, 2012. View at: Publisher Site | Google Scholar
  21. H. Tominaga, D. A. Coury, H. Amano, W. Miki, and M. Kakinuma, “CDNA cloning and expression analysis of two heat shock protein genes, Hsp90 and Hsp60, from a sterile Ulva pertusa (Ulvales, Chlorophyta),” Fisheries Science, vol. 78, no. 2, pp. 415–429, 2012. View at: Publisher Site | Google Scholar
  22. S. Heinrich, K. Valentin, S. Frickenhaus et al., “Transcriptomic analysis of acclimation to temperature and light stress in Saccharina latissima (Phaeophyceae),” PLOS ONE, vol. 7, no. 8, pp. 1–13, 2012. View at: Google Scholar
  23. M. Schroda, “The Chlamydomonas genome reveals its secrets: chaperone genes and the potential roles of their gene products in the chloroplast,” Photosynthesis Research, vol. 82, no. 3, pp. 221–240, 2004. View at: Publisher Site | Google Scholar
  24. F. Willmund, K. V. Dorn, M. Schulz-Raffelt, and M. Schroda, “The chloroplast DnaJ homolog CDJ1 of Chlamydomonas reinhardtii is part of a multichaperone complex containing HSP70B, CGE1, and HSP90C,” Plant Physiology, vol. 148, no. 4, pp. 2070–2082, 2008. View at: Publisher Site | Google Scholar
  25. E. Spijkerman, D. Barua, A. Gerloff-Elias, J. Kern, U. Gaedke, and S. A. Heckathorn, “Stress responses and metal tolerance of Chlamydomonas acidophila in metal-enriched lake water and artificial medium,” Extremophiles, vol. 11, no. 4, pp. 551–562, 2007. View at: Publisher Site | Google Scholar
  26. F. Willmund and M. Schroda, “Heat shock protein 90C is a bona fide Hsp90 that interacts with plastidic HSP70B in Chlamydomonas reinhardtii,” Plant Physiology, vol. 138, no. 4, pp. 2310–2322, 2005. View at: Publisher Site | Google Scholar
  27. L. Zhang, Y. Fan, F. Shi, S. Qin, and B. Liu, “Molecular cloning, characterization, and expression analysis of a cytosolic HSP90 gene from Haematococcus pluvialis,” Journal of Applied Phycology, pp. 1–12, 2012. View at: Publisher Site | Google Scholar
  28. V. Blas-Valdivia, R. Ortiz-Butrón, M. Pineda-Reynoso, A. Hernández-Garcia, and E. Cano-Europa, “Chlorella vulgaris administration prevents HgCl2-caused oxidative stress and cellular damage in the kidney,” Journal of Applied Phycology, vol. 23, no. 1, pp. 53–58, 2011. View at: Publisher Site | Google Scholar
  29. Y. F. Niu, M. H. Zhang, W. H. Xie et al., “A new inducible expression system in a transformed green alga, Chlorella vulgaris,” Genetics and Molecular Research, vol. 10, no. 4, pp. 3427–3434, 2011. View at: Google Scholar
  30. Y. L. Wang and X. D. Xu, “Construction of cosmid libraries of the Antarctic and temperate strains of Chlorella vulgaris,” Acta Hydrobiologica Sinica, vol. 35, no. 6, pp. 1063–1066, 2011. View at: Google Scholar
  31. S. Kumar, K. Tamura, and M. Nei, “MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment,” Briefings in Bioinformatics, vol. 5, no. 2, pp. 150–163, 2004. View at: Google Scholar
  32. J. D. Thompson, T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins, “The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools,” Nucleic Acids Research, vol. 25, no. 24, pp. 4876–4882, 1997. View at: Publisher Site | Google Scholar
  33. K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. View at: Google Scholar
  34. Q. Gao, J. Zhao, L. Song et al., “Molecular cloning, characterization and expression of heat shock protein 90 gene in the haemocytes of bay scallop Argopecten irradians,” Fish and Shellfish Immunology, vol. 24, no. 4, pp. 379–385, 2008. View at: Publisher Site | Google Scholar
  35. K. Richter and J. Buchner, “Hsp90: chaperoning signal transduction,” Journal of Cellular Physiology, vol. 188, no. 3, pp. 281–290, 2001. View at: Publisher Site | Google Scholar
  36. P. Krishna and G. Gloor, “The Hsp90 family of proteins in Arabidopsis thaliana,” Cell Stress and Chaperones, vol. 6, no. 3, pp. 238–246, 2001. View at: Google Scholar
  37. H. E. Ireland, S. J. Harding, G. A. Bonwick, M. Jones, C. J. Smith, and J. H. H. Williams, “Evaluation of heat shock protein 70 as a biomarker of environmental stress in Fucus serratus and Lemna minor,” Biomarkers, vol. 9, no. 2, pp. 139–155, 2004. View at: Publisher Site | Google Scholar

Copyright © 2014 Zhengyi Liu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2021, as selected by our Chief Editors. Read the winning articles.