BioMed Research International

BioMed Research International / 2014 / Article
Special Issue

Research on Bacterial Virulence in the Developing Countries

View this Special Issue

Research Article | Open Access

Volume 2014 |Article ID 729618 | 9 pages | https://doi.org/10.1155/2014/729618

Description of a Novel Adhesin of Mycobacterium avium Subsp. paratuberculosis

Academic Editor: Armando Acosta
Received07 Mar 2014
Accepted29 Jun 2014
Published22 Jul 2014

Abstract

The binding and ingestion of Mycobacterium avium subsp. paratuberculosis (MAP) by host cells are fibronectin (FN) dependent. In several species of mycobacteria, a specific family of proteins allows the attachment and internalization of these bacteria by epithelial cells through interaction with FN. Thus, the identification of adhesion molecules is essential to understand the pathogenesis of MAP. The aim of this study was to identify and characterize FN binding cell wall proteins of MAP. We searched for conserved adhesins within a large panel of surface immunogenic proteins of MAP and investigated a possible interaction with FN. For this purpose, a cell wall protein fraction was obtained and resolved by 2D electrophoresis. The immunoreactive spots were identified by MALDI-TOF MS and a homology search was performed. We selected elongation factor Tu (EF-Tu) as candidate for further studies. We demonstrated the FN-binding capability of EF-Tu using a ligand blot assay and also confirmed the interaction with FN in a dose-dependent manner by ELISA. The dissociation constant of EF-Tu was determined by surface plasmon resonance and displayed values within the μM range. These data support the hypothesis that this protein could be involved in the interaction of MAP with epithelial cells through FN binding.

1. Introduction

Paratuberculosis (PTB) is a chronic granulomatous enteritis of domestic and wild ruminants. This disease involves extensive mycobacterial shedding, which accounts for the high contagiousness, and ends with fatal enteritis. Decreases in weight, milk production, and fertility produce severe economic loss [1]. The etiological agent of PTB is Mycobacterium avium subsp. paratuberculosis (MAP). MAP enters the intestinal tissue through M cells present in the dome epithelium covering the continuous Peyer’s patches in the distal ileum [2, 3]. Initially, the pathogen interacts with proteins of the extracellular matrix (ECM), which function as ligands for bacterial adhesion. Fibronectin (FN) binding is required for attachment and internalization of MAP by the epithelial cells and β1 integrins have been identified as the host cell receptors for FN-opsonized mycobacteria in vitro and in vivo [4]. M cells have the distinctive characteristic of displaying β1 integrins on their luminal face at high density; therefore, the presence of these integrins on M cells may explain why these cells are the entry of the bacteria. The interaction between MAP and FN is explained by the presence of the FN-binding proteins called adhesins. Different adhesins from several pathogens were identified as virulence factors [59]. Adhesins may also induce strong protective immunity in the host and, thus, remain attractive vaccine targets. For instance a 27-kDa outer membrane protein from Salmonella typhi binds to laminin and induces a strong protective antibody response in animal models and humans [10]. In addition, the antigen 85 complex (Ag85) was the first family of mycobacterial proteins to be identified as having FN-binding capability. Members of the Ag85 complex were described as a mycobacterial adhesins firstly in M. tuberculosis [11] and then in several mycobacterial species [1215]. The members of this complex are found within the outer envelope and culture supernatants of mycobacteria and are immunodominant antigens [16, 17]. Furthermore, these proteins possess mycolyltransferase activity and catalyze the synthesis of the most abundant glycolipid of the mycobacterial cell wall, trehalose 6,6-dimycolate (TDM) [18]. Another important adhesin described in mycobacteria is the fibronectin attachment protein (FAP). FAP is a member of a family of FN-binding proteins present in several species of mycobacteria that mediate the attachment and internalization of these bacteria by epithelial cells in vitro [1923]. This protein is also called APA (for alanine-proline-rich antigen) and is encoded by a gene annotated as MAP1569 in the MAP K-10 strain. Although the MAP-APA is not an immunodominant antigen, it activates dendritic cells and induces a Th1 polarization [24]. Furthermore, MAP-infected cattle showed a strong humoral response to recombinant APA assayed by Western blot and ELISA [7]. In a previous study conducted by our group, APA was detected mainly in the culture supernatant filtrates, demonstrating that this protein is predominantly secreted [7]. Other cell wall proteins thus could interact with FN to facilitate complex formation and, in this way, allow adherence to epithelial cells.

With all this in mind, we hypothesized that molecules with similar structure, even those from nonrelated microorganisms, could have conserved adhesin functions. In the present study, we searched for conserved adhesins within a large panel of surface immunogenic proteins of MAP and investigated a possible interaction with FN. By using the ligand blot assay (LBA), we confirmed the binding properties of a protein previously described in other bacteria and identified a novel surface component with FN-binding activity in MAP. The protein-protein interactions revealed by LBA were confirmed by ELISA binding assays and surface plasmon resonance (SPR) in order to determine the dissociation constant (KD).

2. Materials and Methods

2.1. Bacterial Strains and Culture Media

All cloning steps were performed in Escherichia coli DH5α. E. coli BL21(kDE3) was used for recombinant protein production. E. coli was grown in Luria Bertani (LB) broth or on LB agar. When necessary, ampicillin was added to the medium at a concentration of 100 μg/mL. MAP was grown in Middlebrook 7H9 medium (Difco Laboratories, USA), 0.05% Tween 80, 0.5% glycerol, AD (0.5% bovine serum albumin, 0.2% glucose), and mycobactin (2 μg/mL).

2.2. Preparation of Cell Wall Protein Fraction of MAP

MAP cultures were harvested at midlog phase, centrifuged at 14,000 ×g for 20 min at room temperature and washed twice with phosphate buffered saline (PBS). Cell pellets were resuspended in lysis buffer (PBS, 1 mM EDTA) with 1 mM phenylmethanesulfonyl fluoride (PMSF), an inhibitor of serine proteases, and then this suspension was probe sonicated in an ice bath for 15 min with pulses of 1 min on, 1 min off in a Branson Sonifier S250. Cell wall proteins were obtained as previously described by Hirschfield and collaborators [25]. Briefly, the sonic extract was centrifuged at 27,000 ×g for 20 min, and the resulting cell wall containing pellet was subjected to 2% sodium dodecyl sulfate (SDS) extraction for 2 h at 50°C. The SDS extraction was repeated twice. The protein concentration in the cell wall (CW) fraction was evaluated with Kit 2D Quant (GE Healthcare).

2.3. Two-Dimensional-SDS Polyacrylamide Gel Electrophoresis (2D-SDS-PAGE)

For 2D analysis, CW fractions were first desalted performing a gel filtration step (Sephadex G25 column). Proteins were precipitated with cold acetone and resuspended in a reswelling buffer (8 M urea, 2% CHAPS, 0.5% IPG buffer pH 4–7, 20 mM DTT, and 0.004% bromophenol blue). 2D-SDS-PAGE was performed as described by Xolalpa and collaborators [26]. The gels were transferred onto a nitrocellulose membrane (Hybond-ECL GE Healthcare) and the membranes were subjected to Western blot. The sera from 5 positive animals were pooled and diluted to 1 : 100 to detect immunogenic proteins from the CW fraction. The immunoreactive spots were manually excised from a replicate Coomassie blue stained gel and sent to the Mass Spectrometry Center for Biological and Chemical Analysis (CEQUIBIEM) at the School of Exact and Natural Sciences, University of Buenos Aires. The mass spectrometry platform used is made up of UV-MALDI-TOF/TOF Ultraflex II (Bruker Daltonics) and the software Mascot was used to identify proteins from peptide sequence databases. The protein score was calculated as , where is the probability in which the observed match was a random event. Protein scores greater than 69 are significant .

The proteins identified by MALDI-TOF MS were subjected to bioinformatic analysis including similarity searches with proteins with FN-binding domains. Sequence similarity searches were performed by BlastP (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.4. Recombinant MAP-EF-Tu: Cloning and Expression Assays

DNA from MAP was purified by the CTAB method as described previously by van Embden and collaborators [27]. PCR amplification was performed to amplify the complete open reading frame of EF-Tu using the forward primer eftu-fw ggatccgcgaaggcgaagttcgag (BamHI site) and the reverse primer eftu-rev aagcttctacttgatgatcttgac (HindIII site). The amplified 1,190 bp fragment was cloned into pGEM-T vector (Promega) and directionally subcloned into pRSET-A (Invitrogen). Protein expression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). The protein was expressed as insoluble inclusion bodies and therefore purified using a ProBond Ni-NTA Resin column (Invitrogen) under denaturing conditions with 8 M urea. After purification, EF-Tu was refolded by gradually removing the urea using a refolding buffer (Tris 50 mM pH 8, Arg-HCl, EDTA, GSH 3 mM, GSSG 0.3 mM, and PMSF 1 mM). Protein quantification was performed using BCA protein assay (Pierce) following the manufacturer’s recommendations.

2.5. Western Blot

Proteins were fractionated on 12% SDS-PAGE, according to Laemmli procedure [28], and then stained with 0.25% Coomassie Brilliant Blue R250 (Sigma) or transferred onto nitrocellulose membranes (Hybond-ECL GE Healthcare). EF-Tu was assayed by Western blotting using 1 : 3,000 dilution anti-His (GE Healthcare) as primary antibody and an alkaline phosphatase-conjugated anti-mouse IgG (Sigma) as secondary antibody (1 : 3,000 dilution). A colorimetric detection was performed using BCIP/NBT (5-bromo-4-chloro-3-indolylphosphate/nitroblue tetrazolium) Color Development (Promega), according to the manufacturer’s instructions.

2.6. Ligand Blot Assay (LBA)

Five μg of the purified recombinant proteins was electrophoresed in 12% SDS-PAGE gels and transferred onto nitrocellulose membranes (Hybond-ECL, GE Healthcare). Ag85 [15] and AhpC were used as positive and negative controls, respectively. The membranes were blocked with 5% BSA in PBS buffer for 1 h at room temperature and incubated with 20 μg/mL of FN for 24 hs at 4°C. The membranes were then washed three times with PBS and incubated with anti-FN in PBS-BSA 5% (1 : 100) for 2 h at room temperature, followed by a final incubation with anti-Mouse IgG alkaline phosphatase antibody (1 : 30,000) for 1 h at room temperature. The membranes were washed and the colorimetric detection of the bound bait protein was performed.

2.7. Dose-Response Curves

The 96-well plates (Polysorp Nunc) were coated with 1 μg of EF-Tu in 200 μL carbonate buffer pH 9.5 at 4°C and incubated overnight. AhpC was included as a negative control. Plates were then blocked and increasing concentrations of FN (0, 1, 10, 20, 50, and 100 μg/mL) were added in a final volume of 200 μL. Protein binding was assessed with hyperimmune anti-FN serum at the dilution of 1 : 100 followed by incubation with HRP-conjugated anti-mouse IgG (Sigma) (1 : 500). Both incubations were performed at 37°C for 1 h. The wells were washed three times, and the colorimetric detection was performed using 280 μL of developing solution 2,2′-azino-bis3-ethylbenzothiazoline-6-sulphonic acid (ABTS) at a concentration of 10 μg/mL (Sigma) and 12 μL of H2O2 30% in 10 mL of 0.1 M citrate phosphate buffer at pH 5. The absorbance at 405 nm was determined in a microplate reader Multiskan Spectrum (Thermo Scientific).

2.8. Surface Plasmon Resonance (SPR)

Protein-protein interactions were assessed by SPR [29], using a BIAcoreT100 system (GE Healthcare). Briefly, FN was covalently immobilized on the BIAcore carboxymethylated dextran matrix −5 sensor chip (GE Healthcare) according to the manufacturer’s instructions. Protein solution of EF-Tu (0, 0.312, 0.625, 1.25, 2.5, 5.0, and 10.0 μM) in 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.005% surfactant P20, pH 7.4 was injected over immobilized FN at a flow rate of 30 μL/min for 1 min at 25°C. The dissociation was carried out with PBS-Tween 0.05% or HBS-P20. Surfaces were regenerated by applying pulses of 10 mM HCl. The KD was determined under equilibrium conditions using a nonlinear BIA evaluation program. The nonspecific binding control consisted of passing the analytes on a free surface that had been previously activated and blocked.

2.9. Humoral Response Evaluation by Line Print Immunoassay

The protein EF-Tu and a set of antigens, purified protein derivative of M. avium (PPDa), purified protein derivative of M. bovis (PPDb), and paratuberculosis protoplasmic antigen (PPA3), were evaluated with different sera. Sera were obtained from 10 healthy animals, from 8 animals with bovine tuberculosis (TBB experimentally infected animals, positive for delayed-type hypersensitivity—DTH—with PPDb and with lesions at the end of the experience), and from 25 PTB naturally infected animals, positive for DTH with PPDa and fecal culture positive. A total of 20 μL of each of the antigens was applied onto a nitrocellulose membrane (Amersham Hybond TM-ECL) using a semiautomatic aerosolizer (Camag Scientific Inc., Wilmington, Delaware) at a concentration of 100 μg/mL. The membranes were blocked and placed in a “mini blotter” (Isogen BioSolutions). This procedure allowed simultaneous analysis of the 45 sera, which were evaluated at dilutions of 1 : 100. After 1 h incubation, sera were aspirated and the membranes were washed. The membranes were then incubated with protein G conjugated to peroxidase (1 : 1,500), washed, and finally developed with chemiluminescence substrate (Pierce ECL Western blotting substrate, Thermo Scientific) according to the manufacturer’s directions.

3. Results

3.1. Analysis of MAP-Cell Wall Proteins

As a first screening for surface-exposed immunogenic proteins, the MAP-cell wall (CW) protein fraction was obtained and resolved by 2D-SDS-PAGE and transferred onto a nitrocellulose membrane. Then, the membranes were analyzed by Western blot using a pool of sera from MAP-infected animals. The images were digitalized and visually analyzed (Figure 1). A total of 41 spots corresponding to proteins that were recognized by positive sera were excised from a replicate Coomassie blue stained gel and subsequently identified by MALDI-TOF MS. A total of 18 proteins were identified by this method (Table 1). We focused our interest in proteins that were previously characterized as adhesins in pathogenic microorganisms. Among these proteins, we selected elongation factor Tu (EF-Tu) because the homologous of Mycoplasma pneumoniae (identity 65%) and Acinetobacter baumannii (identity 72%) functions as a FN-binding protein that facilitates the interactions between bacteria and extracellular matrix [3032].


Spot numberMAP Locus Mtb Locus GeneProtein function/familyORF size (bp)Previously described as envelope protein

1MAP1164 Rv1436 gapdh Glyceraldehyde-3-phosphate dehydrogenase1,020He and de Buck, 2010 (MAP) [34]
2MAP1205 Rv1479 moxR ATPase1,143Mawuenyega et al., 2005 (Mtb) [35]
3MAP1325 Rv1630 rpsA S1 30S ribosomal protein S11,443Gu et al., 2003 (Mtb) [36]
4MAP1367 Rv1658 argG Argininosuccinate synthase1,197ND
5MAP1889c Rv2145c wag31 DivIVA family protein783He and de Buck, 2010 (MAP) [34]
6MAP1962 Rv2220 glnA1 Glutamine synthetase A11,437Gu et al., 2003 (MAP) [36]
7MAP1998 Rv2245 kasA 3-Oxoacyl synthetase1,251He and de Buck, 2010 (MAP) [34]
8MAP1999 Rv2246 kasB_1 3-Oxoacyl sintase 2 B1,323Mawuenyega et al., 2005 (Mtb) [35]
9MAP2453c Rv1308 atpA ATP synthase subunit alpha1,665He and de Buck, 2010 (MAP) [34]
10MAP2855c Rv2744c 35kd_ag Phage shock protein A828ND
5MAP3152c Rv3075c hpcH/hpaI Aldolase/citrate lyase921Gu et al., 2003 (MAP) [36]
11MAP3404 Rv3285 accA3 Carbamoyl-phosphate synthase subunit A1,824Mawuenyega et al., 2005 (Mtb) [35]
12MAP3567 Rv0148 Hypothetical proteinShort-chain dehydrogenases/reductases864He and de Buck, 2010 (MAP) [34]
13MAP3651c Rv0215c fadE3_2 Acyl-CoA dehydrogenase FadE31,218He and de Buck, 2010 (MAP) [34]
7MAP3692c Rv0242c fabG4 3-Ketoacyl reductase1,365He and de Buck, 2010 (MAP) [34]
14MAP3853 Rv0384c clpB ATP dependent protease ClpB2,547He and de Buck, 2010 (MAP) [34]
3MAP3936 Rv0440 groEL2 GroEL chaperonin1,626He and de Buck, 2010 (MAP) [34]
15MAP4143 Rv0685 eftu Elongation factor Tu1,191He and de Buck, 2010 (MAP) [34]

The eftu gene from MAP was evaluated for orthologous in M. avium strain 104 (GenBank accession number NC_008595) and M. tuberculosis (Mtb) H37Rv (GenBank accession number NC_000962). In the MAP genome (MAP strain K-10 GenBank accession number NC_002944), this gene was annotated as MAP 4143 and shares 93% of nucleotide identity with that of Mtb and 100% with that of M. avium. The identity at the protein level is 100% between MAP and M. avium and 97% with its orthologous in Mtb.

We searched for two FN-binding regions (FBR) in the MAP-EF-Tu protein sequence, which has been previously identified in the carboxyl terminus of Mycoplasma pneumoniae EF-Tu [32, 33]. The BlastP analysis is shown in Table 2. The comparison of both regions yielded an identity of 73% for FBR1 and 69% for FBR2.


MP amino acid regionMAP amino acid regionIdentity between MP and MAP (%)

FBR1192–219193–22073
FBR2340–358342–36069

3.2. Recombinant Expression and Ligand Blot Assay (LBA)

The MAP-EF-Tu protein was heterologously expressed in E. coli as a recombinant His-tagged protein and its product was purified under denaturing conditions. Purified EF-Tu protein is showed in Figure 2. The purified protein was used to perform LBA using FN as “bait.” Interactions were detected with anti-FN polyclonal antiserum and an alkaline phosphatase-conjugated antibody with further colorimetric detection of the bound bait. A strong positive signal was observed for EF-Tu and for Ag85 recombinant protein, which was assayed as a positive control. No signal was observed for the negative control, AhpC (Figure 3).

3.3. Dose-Response Curves

We further confirmed FN-EF-Tu interactions using an ELISA assay with some modifications. Plates were coated with 1 μg of EF-Tu or AhpC used as a negative control and then incubated with increasing concentrations of FN. After incubation with the hyperimmune anti-FN serum followed by HRP-conjugated anti-mouse IgG and the corresponding substrate, the absorbance was determined in a microplate reader at 492 nm. We observed a dose-dependent interaction confirming the binding of EF-Tu with FN (Figure 4).

3.4. Surface Plasmon Resonance (SPR)

To finally determine the EF-Tu dissociation constant (KD), protein-protein interactions were also assessed through SPR with a BIAcoreT100 system (GE Healthcare). FN was covalently immobilized on the BIAcore CM-5 sensor chip. Solutions of EF-Tu at different concentrations were injected over immobilized FN. The obtained KD was within the μM order, () 10−6 M (Figure 5). This value is similar to the values of other adhesins previously described [38]. The control using denaturized EF-Tu was not able to bind FN. Therefore, all these experiments confirmed the FN/EF-Tu binding with a moderate affinity through conformational sites.

3.5. Humoral Response Evaluation by Line Print Immunoassay

FN-binding proteins could play a role in adhesion to the host and immunomodulation. With this in mind, we analyzed whether EF-Tu is able to stimulate antibody production. Using a line print assay, we evaluated a broader set of sera including TBB-infected animals and negative controls. The sera were obtained from 25 MAP-naturally infected cattle, 8 M. bovis-experimentally infected cattle, and 10 healthy bovines (negative controls). EF-Tu was recognized by 64% of the MAP positive sera. However, this protein was also recognized by sera of healthy and TBB animals, suggesting the presence of antigenic epitopes conserved among mycobacteria species, including environmental mycobacteria that sensitizes healthy cattle (Table 3).


Number of sera with positive recognition
AntigenHealthy ( )PTB infected ( )TBB infected ( )

PPDA4163
PPA-31182
PPDB 614
EF-Tu8167

4. Discussion

MAP invades the intestinal tissue primarily through M cells. This could occur through FN-dependent mechanisms that involve the binding of FN to proteins of the MAP CW and to integrin receptors present on the luminal surface of M cells. β1 integrins have been identified as the host cell receptors. In addition, the attachment and internalization of MAP by epithelial cells in vitro and in vivo depend on APA-FN interactions [4]. However, other MAP proteins could be involved in FN binding and they could be important for host-pathogen interactions.

In this study, we have identified immunogenic CW proteins of MAP by 2D and MALDI-TOF MS analysis. From the identified proteins, we selected one candidate based on the similarity with other proteins having the ability to bind ECM molecules in other pathogenic bacteria: elongation factor Tu (EF-Tu).

We first screened its FN-binding capability through a ligand blot assay using FN and anti-FN antibodies. This screening confirmed that, in these conditions, EF-Tu binds FN (Figure 3). Through ELISA assays, using increasing concentrations of FN, we confirmed the interaction in a dose-dependent manner (Figure 4). We finally determine the dissociation constant KD by SPR analysis, which yielded a KD within the order of μM (Figure 5) consistent with previous reports [38].

Several Mycobacterium adhesins capable to bind ECM proteins have been identified in mycobacteria, such as antigen 85 complex [1115], APA [1923], and GlnA1 [26]. Several reports have demonstrated that these proteins are involved in bacterial dissemination. EF-Tu is a protein responsible for critical steps in protein synthesis [39]. Moreover, this protein is a cytoplasmic protein with unusual CW location among microorganisms. For instance, when E. coli is starved for carbohydrates, nitrogen, and phosphate, this protein becomes methylated and associates to the membrane [40]. In addition, this protein was detected as a major CW protein of Mycobacterium leprae [41]. On the other hand, EF-Tu has been identified with periplasmic location in Neisseria gonorrhoeae [42] and in E. coli [43]. In Lactobacillus johnsonii and Listeria monocytogenes, EF-Tu is also associated to the membrane; in these bacteria this protein mediates binding to mucin [44] and fibrinogen [37], respectively. Recently, it has been reported that EF-Tu binds factor H and plasminogen in Pseudomonas aeruginosa [45]. Thus, EF-Tu joins the group of housekeeping enzymes, which includes enolase [46], glyceraldehyde-3-phosphate dehydrogenase [47], and pyruvate dehydrogenase [30], that exhibit unexpected biological functions in addition to their well-defined enzymatic activities. Despite the classification of EF-Tu as a cytosolic protein, Balasubramanian and collaborators [32] have shown that EF-Tu can relocate to the mycoplasma membrane surface with an exposed carboxyl terminus that facilitates FN binding. On the other hand, other reports document the presence of cytosolic proteins, including EF-Tu, on surfaces of different bacteria. Important questions regarding how these proteins translocate to the surface remain unanswered, especially since conventional secretion or anchoring signals are absent. The cytoplasmic enzymefructose-1, 6-bisphosphate aldolase (FBA) has also been found on the surface of several pathogenic bacteria. FBA is a glycolytic enzymethat, despite lacking secretion signals, translocates across the different compartments of the bacterial cell to access the surface, where it binds host molecules and exhibits nonglycolytic functions [40, 41].

The interaction of EF-Tu with the ECM could be a key mechanism during host-pathogen interactions, However, the overall contribution of this adhesin to the host cell binding remains unclear. Although there is a dose-dependent specific binding of EF-Tu to immobilized FN, the affinity of EF-Tu to FN is intermediate. In the present study, EF-Tu displayed a KD in the μM range, similar to other proteins proposed as adhesins. For instance, a surface-exposed protein of leptospira, Lsa20, binds to plasminogen and laminin with a KD in the μM range, postulated as a protein with adherence function and proteolytic activity [38]. Moreover, these adhesins can also bind other proteins of the ECM, such as elastin, laminin, and plasminogen, which contributes to adhesion, to invasion, and to the virulence of the bacteria modulating the immune response [15, 24, 45].

In our study, recombinant EF-Tu was recognized by 64% of sera from MAP-infected cattle, suggesting a putative role in the host immune response. However, sera from noninfected animals also recognize EF-Tu. This result could be due to the presence of EF-Tu in environmental mycobacteria, such as M. avium, which shares 100% identity with the MAP protein. Moreover, the suggested role of EF-Tu in the virulence of pathogenic bacteria could be related to the host-pathogen interactions.

Kuo and collaborators [15] demonstrated that reducing the expression of FN on Caco-2 cells that were transfected with FN-siRNA impaired the ability of Ag85 or Ag85-expressing MAP K-10 to bind to the Caco-2 cells. However, MAP K-10 strain binding to FN siRNA-transfected Caco-2 cells showed only a 9.7% reduction (compared with the negative siRNA transfection). This finding suggests that FN is not the only bacterial adhesion ligand contributing to the MAP ability to bind to host cells. Additionally, the MAP Ag85 interaction to FN only partially accounted for MAP’s ability to bind host cells. Other surface antigens of MAP K-10 probably participate in additional ECM interactions.

In conclusion, we have identified a novel FN-binding MAP protein, EF-Tu, that could be implicated in the entrance of MAP into the epithelial cells, which is the first step of mycobacteria infection necessary for the progression of PTB.

Conflict of Interests

The authors declare that they have no conflict of interests regarding the publication of this paper.

Authors’ Contribution

Andrea Karina Gioffré and María de la Paz Santangelo are contributed equally to this work.

Acknowledgments

The authors are grateful to Dr. Julia Sabio y García for critical reading of this paper. This work was funded by ANCyPT Grant PICT1170 and ANCyPT Grant FONARSEC FS Agrobiotecnología 2010. M. N. Viale and M. P. Santangelo are CONICET fellows.

References

  1. C. Cocito, P. Gilot, M. Coene, M. de Kesel, P. Poupart, and P. Vannuffel, “Paratuberculosis,” Clinical Microbiology Reviews, vol. 7, no. 3, pp. 328–345, 1994. View at: Google Scholar
  2. E. Momotani, D. L. Whipple, A. B. Thiermann, and N. F. Cheville, “Role of M cells and macrophages in the entrance of Mycobacterium paratuberculosis into domes of ileal Peyer's patches in calves.,” Veterinary Pathology, vol. 25, no. 2, pp. 131–137, 1988. View at: Publisher Site | Google Scholar
  3. Ó. G. Sigurđardóttir, C. M. Press, and Ø. Evensen, “Uptake of Mycobacterium avium subsp. paratuberculosis through the distal small intestinal mucosa in goats: an ultrastructural study,” Veterinary Pathology, vol. 38, pp. 184–189, 2001. View at: Google Scholar
  4. T. E. Secott, T. L. Lin, and C. C. Wu, “Mycobacterium avium subsp. paratuberculosis fibronectin attachment protein facilitates M-cell targeting and invasion through a fibronectin bridge with host integrins,” Infection and Immunity, vol. 72, no. 7, pp. 3724–3732, 2004. View at: Publisher Site | Google Scholar
  5. D. Joh, E. R. Wann, B. Kreikemeyer, P. Speziale, and M. Höök, “Role of fibronectin-binding MSCRAMMs in bacterial adherence and entry into mammalian cells,” Matrix Biology, vol. 18, no. 3, pp. 211–223, 1999. View at: Publisher Site | Google Scholar
  6. C. Abou-Zeid, T. Garbe, R. Lathigra et al., “Genetic and immunological analysis of Mycobacterium tuberculosis fibronectin-binding proteins,” Infection and Immunity, vol. 59, no. 8, pp. 2712–2718, 1991. View at: Google Scholar
  7. A. Gioffré, G. Echeverría-Valencia, A. Arese et al., “Characterization of the Apa antigen from M. avium subsp. paratuberculosis: a conserved Mycobacterium antigen that elicits a strong humoral response in cattle,” Veterinary Immunology and Immunopathology, vol. 132, no. 2–4, pp. 199–208, 2009. View at: Publisher Site | Google Scholar
  8. S. J. Shin, C. F. Chang, S. P. McDonough, B. Thompson, H. S. Yoo, and Y. Chang, “In vitro cellular immune responses to recombinant antigens of Mycobacterium avium subsp. paratuberculosis,” Infection and Immunity, vol. 73, no. 8, pp. 5074–5085, 2005. View at: Publisher Site | Google Scholar
  9. J. Mullerad, I. Michal, Y. Fishman, A. Hovav, R. G. Barletta, and H. Bercovier, “The immunogenicity of Mycobacterium paratuberculosis 85B antigen,” Medical Microbiology and Immunology, vol. 190, no. 4, pp. 179–187, 2002. View at: Publisher Site | Google Scholar
  10. S. Ghosh, K. Chakraborty, T. Nagaraja et al., “An adhesion protein of Salmonella enterica serovar Typhi is required for pathogenesis and potential target for vaccine development,” Proceedings of the National Academy of Sciences of the United States of America, vol. 108, no. 8, pp. 3348–3353, 2011. View at: Google Scholar
  11. C. Abou-Zeid, T. L. Ratliff, H. G. Wiker, M. Harboe, J. Bennedsen, and G. A. W. Rook, “Characterization of fibronectin-binding antigens released by Mycobacterium tuberculosis and Mycobacterium bovis BCG,” Infection and Immunity, vol. 56, no. 12, pp. 3046–3051, 1988. View at: Google Scholar
  12. J. E. R. Thole, R. Schöningh, A. A. M. Janson et al., “Molecular and immunological analysis of a fibronectin-binding protein antigen secreted by Mycobacterium leprae,” Molecular Microbiology, vol. 6, no. 2, pp. 153–163, 1992. View at: Publisher Site | Google Scholar
  13. H. Kitaura, N. Ohara, M. Naito, K. Kobayashi, and T. Yamada, “Fibronectin-binding proteins secreted by Mycobacterium avium,” APMIS, vol. 108, no. 9, pp. 558–564, 2000. View at: Publisher Site | Google Scholar
  14. V. Dheenadhayalan, K. Shin, C. Chang et al., “Cloning and characterization of the genes coding for antigen 85A, 85B and 85C of Mycobacterium avium subsp. paratuberculosis,” Mitochondrial DNA, vol. 13, no. 5, pp. 287–294, 2002. View at: Publisher Site | Google Scholar
  15. C. J. Kuo, H. Bell, C. L. Hsieh, C. P. Ptak, and Y. F. Chang, “Novel mycobacteria antigen 85 complex binding motif on fibronectin,” The Journal of Biological Chemistry, vol. 287, no. 3, pp. 1892–1902, 2012. View at: Publisher Site | Google Scholar
  16. S. L. Baldwin, C. D. D'Souza, I. M. Orme et al., “Immunogenicity and protective efficacy of DNA vaccines encoding secreted and non-secreted forms of Mycobacterium tuberculosis Ag85A,” Tubercle and Lung Disease, vol. 79, no. 4, pp. 251–259, 1999. View at: Publisher Site | Google Scholar
  17. A. T. Kamath, C. G. Feng, M. Macdonald, H. Briscoe, and W. J. Britton, “Differential protective efficacy of DNA vaccines expressing secreted proteins of Mycobacterium tuberculosis,” Infection and Immunity, vol. 67, no. 4, pp. 1702–1707, 1999. View at: Google Scholar
  18. J. T. Belisle, V. D. Vissa, T. Sievert, K. Takayama, P. J. Brennan, and G. S. Besra, “Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis,” Science, vol. 276, no. 5317, pp. 1420–1422, 1997. View at: Publisher Site | Google Scholar
  19. T. L. Ratliff, R. McCarthy, W. B. Telle, and E. J. Brown, “Purification of a mycobacterial adhesin for fibronectin,” Infection and Immunity, vol. 61, no. 5, pp. 1889–1894, 1993. View at: Google Scholar
  20. J. S. Schorey, Q. Li, D. W. McCourt et al., “A Mycobacterium leprae gene encoding a fibronectin binding protein is used for efficient invasion of epithelial cells and Schwann cells,” Infection and Immunity, vol. 63, no. 7, pp. 2652–2657, 1995. View at: Google Scholar
  21. J. S. Schorey, M. A. Holsti, T. L. Ratliff, P. M. Allen, and E. J. Brown, “Characterization of the fibronectin-attachment protein of Mycobacterium avium reveals a fibronectin-binding motif conserved among mycobacteria,” Molecular Microbiology, vol. 21, no. 2, pp. 321–329, 1996. View at: Publisher Site | Google Scholar
  22. T. E. Secott, T. L. Lin, and C. C. Wu, “Fibronectin attachment protein homologue mediates fibronectin binding by Mycobacterium avium subsp. paratuberculosis,” Infection and Immunity, vol. 69, no. 4, pp. 2075–2082, 2001. View at: Publisher Site | Google Scholar
  23. T. E. Secott, T. L. Lin, and C. C. Wu, “Fibronectin attachment protein is necessary for efficient attachment and invasion of epithelial cells by Mycobacterium avium subsp. paratuberculosis,” Infection and Immunity, vol. 70, no. 5, pp. 2670–2675, 2002. View at: Publisher Site | Google Scholar
  24. S. L. Jun, J. S. Sung, M. T. Collins et al., “Mycobacterium avium subsp. paratuberculosis fibronectin attachment protein activates dendritic cells and induces a Th1 polarization,” Infection and Immunity, vol. 77, no. 7, pp. 2979–2988, 2009. View at: Publisher Site | Google Scholar
  25. G. R. Hirschfield, M. McNeil, and P. J. Brennan, “Peptidoglycan-associated polypeptides of Mycobacterium tuberculosis,” Journal of Bacteriology, vol. 172, no. 2, pp. 1005–1013, 1990. View at: Google Scholar
  26. W. Xolalpa, A. J. Vallecillo, M. Lara et al., “Identification of novel bacterial plasminogen-binding proteins in the human pathogen Mycobacterium tuberculosis,” Proteomics, vol. 7, no. 18, pp. 3332–3341, 2007. View at: Publisher Site | Google Scholar
  27. J. D. A. van Embden, D. van Soolingen, P. M. Small, and P. W. M. Hermans, “Genetic markers for the epidemiology of tuberculosis,” Research in Microbiology, vol. 143, no. 4, pp. 385–391, 1992. View at: Publisher Site | Google Scholar
  28. U. K. Laemmli, “Cleavage of structural proteins during the assembly of the head of bacteriophage T4,” Nature, vol. 227, no. 5259, pp. 680–685, 1970. View at: Publisher Site | Google Scholar
  29. R. Karlsson, A. Michaelsson, and L. Mattsson, “Kinetic analysis of monoclonal antibody-antigen interactions with a new biosensor based analytical system,” Journal of Immunological Methods, vol. 145, no. 1-2, pp. 229–240, 1991. View at: Publisher Site | Google Scholar
  30. S. F. Dallo, T. R. Kannan, M. W. Blaylock, and J. B. Baseman, “Elongation factor Tu and E1 β subunit of pyruvate dehydrogenase complex act as fibronectin binding proteins in Mycoplasma pneumoniae,” Molecular Microbiology, vol. 46, no. 4, pp. 1041–1051, 2002. View at: Publisher Site | Google Scholar
  31. S. F. Dallo, B. Zhang, J. Denno et al., “Association of Acinetobacter baumannii EF-Tu with cell surface, outer membrane vesicles, and fibronectin,” The Scientific World Journal, vol. 2012, Article ID 128705, 10 pages, 2012. View at: Publisher Site | Google Scholar
  32. S. Balasubramanian, T. R. Kannan, and J. B. Baseman, “The surface-exposed carboxyl region of Mycoplasma pneumoniae elongation factor Tu interacts with fibronectin,” Infection and Immunity, vol. 76, no. 7, pp. 3116–3123, 2008. View at: Publisher Site | Google Scholar
  33. S. Balasubramanian, T. R. Kannan, P. J. Hart, and J. B. Baseman, “Amino acid changes in elongation factor Tu of Mycoplasma pneumoniae and Mycoplasma genitalium influence fibronectin binding,” Infection and Immunity, vol. 77, no. 9, pp. 3533–3541, 2009. View at: Google Scholar
  34. Z. He and J. de Buck, “Localization of proteins in the cell wall of Mycobacterium avium subsp. paratuberculosis K10 by proteomic analysis,” Proteome Science, vol. 8, article 21, 2010. View at: Publisher Site | Google Scholar
  35. K. G. Mawuenyega, C. V. Forst, K. M. Dobos et al., “Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling,” Molecular Biology of the Cell, vol. 16, no. 1, pp. 396–404, 2005. View at: Publisher Site | Google Scholar
  36. S. Gu, J. Chen, K. M. Dobos, E. M. Bradbury, J. T. Belisle, and X. Chen, “Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain,” Molecular and Cellular Proteomics, vol. 2, no. 12, pp. 1284–1296, 2003. View at: Publisher Site | Google Scholar
  37. J. Schaumburg, O. Diekmann, P. Hagendorff et al., “The cell wall subproteome of Listeria monocytogenes,” Proteomics, vol. 4, no. 10, pp. 2991–3006, 2004. View at: Publisher Site | Google Scholar
  38. R. S. Mendes, M. von Atzingen, Z. M. de Morais et al., “The novel leptospiral surface adhesin Lsa20 binds laminin and human plasminogen and is probably expressed during infection,” Infection and Immunity, vol. 79, no. 11, pp. 4657–4667, 2011. View at: Publisher Site | Google Scholar
  39. G. R. Jacobson and J. P. Rosenbusch, “Abundance and membrane association of elongation factor Tu in E. coli,” Nature, vol. 261, no. 5555, pp. 23–26, 1976. View at: Publisher Site | Google Scholar
  40. C. C. Young and R. W. Bernlohr, “Elongation factor Tu is methylated in response to nutrient deprivation in Escherichia coli,” Journal of Bacteriology, vol. 173, no. 10, pp. 3096–3100, 1991. View at: Google Scholar
  41. M. A. M. Marques, S. Chitale, P. J. Brennan, and M. C. V. Pessolani, “Mapping and identification of the major cell wall-associated components of Mycobacterium leprae,” Infection and Immunity, vol. 66, no. 6, pp. 2625–2631, 1998. View at: Google Scholar
  42. S. F. Porcella, R. J. Belland, and R. C. Judd, “Identification of an EF-Tu protein that is periplasm-associated and processed in Neisseria gonorrhoeae,” Microbiology, vol. 142, no. 9, pp. 2481–2489, 1996. View at: Publisher Site | Google Scholar
  43. B. D. Beck, P. G. Arscott, and A. Jacobson, “Novel properties of bacterial elongation factor Tu,” Proceedings of the National Academy of Sciences of the United States of America, vol. 75, no. 3, pp. 1250–1254, 1978. View at: Publisher Site | Google Scholar
  44. D. Granato, G. E. Bergonzelli, R. D. Pridmore, L. Marvin, M. Rouvet, and I. E. Corthésy-Theulaz, “Cell surface-associated elongation factor tu mediates the attachment of lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins,” Infection and Immunity, vol. 72, no. 4, pp. 2160–2169, 2004. View at: Publisher Site | Google Scholar
  45. A. Kunert, J. Losse, C. Gruszin et al., “Immune evasion of the human pathogen Pseudomonas aeruginosa: elongation factor Tuf is a factor H and plasminogen binding protein,” Journal of Immunology, vol. 179, no. 5, pp. 2979–2988, 2007. View at: Publisher Site | Google Scholar
  46. S. Bergmann, M. Rohde, G. S. Chhatwal, and S. Hammerschmidt, “α-Enolase of Streptococcus pneumoniae is a plasmin(ogen)-binding protein displayed on the bacterial cell surface,” Molecular Microbiology, vol. 40, no. 6, pp. 1273–1287, 2001. View at: Publisher Site | Google Scholar
  47. V. Pancholi and V. A. Fischetti, “A major surface protein on group a streptococci is a glyceraldehyde-3-phosphate-dehydrogenase with multiple binding activity,” Journal of Experimental Medicine, vol. 176, no. 2, pp. 415–426, 1992. View at: Publisher Site | Google Scholar

Copyright © 2014 Mariana Noelia Viale et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1299 Views | 531 Downloads | 7 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.