Evidence-Based Complementary and Alternative Medicine / 2013 / Article / Tab 3

Research Article

Microarray Analysis of mRNA and MicroRNA Expression Profile Reveals the Role of β-Sitosterol-D-glucoside in the Proliferation of Neural Stem Cell

Table 3

Primer sequences of the internal control gene and the target genes for PCR.

GenesPrimer sequenceAnnealing temperature (°C)Product length (bp)

U6F: 5′GCTTCGGCAGCACATATACTAAAAT3′6089
R: 5′CGCTTCACGAATTTGCGTGTCAT3′
rno-miR-129-5pGSP: 5′GGAACTTTTTGCGGTCTGG3′6063
R: 5′GTGCGTGTCGTGGAGTCG3′
rno-miR-322-5pGSP: 5′GGGCAGCAGCAATTCAT3′6065
R: 5′CAGTGCGTGTCGTGGAG3′
rno-miR-301a-3pGSP: 5′CCCCGTGCAATAGTATTGT3′6065
R: 5′CAGTGCGTGTCGTGGAGT3′

Primer sequences of the internal control gene and the target genes for PCR were listed in Table 3. GSP is the specific primer for the corresponding miRNA and R is the matching primer for the corresponding RT Primer.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.