Isolation and Identification of <i>Escherichia coli</i> O157:H7 Lytic Bacteriophage from Environment Sewage

Sjahriani, Tessa; Wasito, Eddy Bagus; Tyasningsih, Wiwiek

doi:https://doi.org/10.1155/2021/7383121

International Journal of Food Science

On this page

Abstract Introduction Materials and Methods Results and Discussion Conclusions Data Availability Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2021 | Article ID 7383121 | https://doi.org/10.1155/2021/7383121

Isolation and Identification of Escherichia coli O157:H7 Lytic Bacteriophage from Environment Sewage

Tessa Sjahriani,¹Eddy Bagus Wasito,²and Wiwiek Tyasningsih³

Academic Editor: Zheng-Fei Yan

Received02 May 2021

Accepted24 Jul 2021

Published12 Aug 2021

Abstract

Escherichia coli O157:H7 is one of the pathogenic bacteria causing foodborne disease. The use of lytic bacteriophages can be a good solution to overcome the disease. This study is aimed at isolating lytic bacteriophages from environmental sewage with E. coli O157:H7 bacterial cells. The sample used in this study was eight bacteriophages, and the technique used in identifying E. coli O157:H7 carriers of the stx1 and stx2 genes was PCR. The double layer plaque technique was used to classify bacteriophages. Plaque morphology, host specificity, and electron micrograph were used to identify the bacteriophages. The result obtained plaque morphology as a clear zone with the largest diameter size of 3.5 mm. Lytic bacteriophage could infect E. coli O157:H7 at the highest titer of . Bacteriophages have been identified as Siphoviridae and Myoviridae. Phage 3, phage 4, and phage 8 could infect Atypical Diarrheagenic E. coli 1 (aDEC1) due to their host specificity. The Friedman statistical tests indicate that lytic bacteriophage can significantly lyse E. coli O157:H7 (). The lysis of E. coli O157:H7 by phage 1, phage 2, phage 3, and phage 5 bacteriophages was statistically significant, according to Conover’s posthoc test (). The conclusion obtained from this study is that lytic bacteriophages from environmental sewage could lyse E. coli O157:H7. Therefore, it could be an alternative biocontrol agent against E. coli O157:H7 that contaminates food causing foodborne disease.

1. Introduction

Foodborne diseases are diseases caused by consuming food and or drinks contaminated by various microorganisms or pathogenic microbes (foodborne pathogens) [1]. Foodborne diseases and cases of food poisoning are of wide concern in public health, especially in developing countries [2]. One of the key goals of national food safety programs is to reduce the number of cases of foodborne disease [3]. Escherichia coli O157:H7 is suspected of causing 63.000 instances of foodborne illness, 2.100 hospitalizations, 20 deaths, and a $ 271 million economic burden [4, 5]. E. coli O157:H7 was existed in the feces of asymptomatic children attending elementary school in Surabaya, East Java, Indonesia [6]. East Java is the largest contributor to the national cattle population, accounting for roughly 43% of the total, with beef production accounting for 20% of the total, or roughly 575,557 tonnes, and beef consumption accounting for 447,460 tonnes [7]. The Kalimas River, one of Surabaya’s main waterways, has been found to be contaminated by market sewage from a nearby site that lacks a wastewater treatment plant [8–10]. Therefore, interventions with a focus on food safety are needed to prevent the occurrence of foodborne pathogens in both children and people in general [11].

E. coli O157:H7 could cause disease by toxin releasing called shiga-like toxin (stx), which could result in food poisoning [12]. Shiga toxin producing E. coli causes more than 2.5 million diseases worldwide each year, resulting 269 deaths [11]. Lytic bacteriophages provide a natural and nontoxic method to reduce and control the growth of human pathogenic bacteria because bacteriophages are part of the environmental ecosystem [13] and as a component of human microbiome [14]. Because antibiotics are known to cause resistance [15], this could be an alternative option. Herbal antibiotics, in addition to antibiotics, have a complex nature that is used to destroy bacteria and strengthen the immune system [16]. In this context, weak organic acids [primarily acetic acid, though work with citric acid has also been done on a small scale for many years to treat infections] have been used on a small scale to treat infections for many years; however, the majority of these publications are in the clinical literature and generally report single cases or small surveys [17]. Although many phytochemicals have antibacterial properties, they are not currently employed as commercial antibiotics. As a result, plants must be researched in order to have a proper understanding of their therapeutic properties, safety, and efficacy, so that herbal medicines can be utilized to replace and supplement synthetic pharmaceuticals [18].

Bacteriophages are mostly composed of nucleic acid, which is nontoxic. Therefore, it is beneficial as it has a low impact on the environment with relatively affordable costs. As a bacteriophage is used for a biocontrol agent, the interaction between bacteriophage proteins with biology or environmental components, animals, and the immune responses of a person which could be increased for potential negative effects needs to be considered (for example, when antibiotics make a deletion or elimination of the growth of bacteria, as a form of self defense, the bacteria will release a type of protein or toxin that can trigger a person’s immune response) [19].

2. Materials and Methods

2.1. Bacterial Stock Culture Preparation

Stock culture of E. coli O157:H7 isolate stored in Tryptic Soy Broth Media (Oxoid, United Kingdom) with 15% glycerol at -20°C was obtained from the Microbiology Laboratory, Soetomo General Academic Hospital, Surabaya, East Java, Indonesia. Stock culture of E. coli O157:H7 was subcultured on Mac Conkey Agar plate media (Oxoid, UK), incubated at 37°C for 24 hours and stored at low temperature.

2.1.1. Bacterial DNA Extraction

Bacterial DNA extraction referred to Geneaid (2017) procedural [20].

2.1.2. Amplification of Bacterial DNA Target

PCR was performed using 2 mL of template in a 20 mL volume of the PCR PreMix (Promega corporation). The PCR mixture consisted of 1 U thermostable DNA polymerase, 250 mM dNTP, 50 mM Tris-HCl (pH 8.3), 40 mM KCl, and 1.5 mM MgCl₂. PCR was carried out in a gene thermal cycler (Bio-Rad, Tokyo, Japan). The optimized cycle program of denaturation, annealing, and extension temperatures was as follows: 1 cycle of 2 min at 94°C; 35 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C; and 1 cycle of 5 min at 72°C.

Primer of shiga toxin genes of stx1 uses forward CAGTTAATGTGGTGGCGAAGG and reverse CACCAGACAATGTAACCGCTG of 1221 bp and Stx2 forward ATCCTATTCCCGGGAGTTACG-3 and reverse GCGTCATCGTATACACAGGAGC of 1247 bp [21]. The PCR products were analyzed using 2% agarose gel electrophoresis with ethidium bromide staining, with a 100 bp DNA Ladder Marker (Promega corporation). Electrophoresis was carried out at 100 volts for 35 minutes. Visualization of the band that appeared was done through a UV transilluminator and photographed [22] by Spectrolyne TC-312E/F, Japan.

2.2. Bacteriophage Preparation

The samples used for bacteriophage isolation were taken from traditional market sewage, abbatoir, and Kalimas River of Surabaya, Indonesia (as seen on Table 1). Each 15 mL of sample was taken using a sterile tube.

2.2.1. Isolation of Bacteriophage

Sample filtration used the modified Thung et al. method, as much as 1 mL of liquid waste sample was diluted into 9 mL of Nutrient Broth (Oxoid, UK) media, centrifuged at 3000 rpm for 20 minutes, and then the supernatant was filtered using 0.45 μm millipore membrane (Minisart, Sartorius). The 4.5 mL filtrate was then mixed with 0.5 mL of E. coli O157:H7 at exponential phase culture (McFarland 0.5 ~ ) and added 5 mL of Nutrient Broth. Next, the mixture was incubated for 24 hours in a waterbath at 37°C. It was then centrifuged at 3000 rpm at 4°C for 15 minutes. The supernatant was taken by a syringe and filtered using 0.22 μm millipore membrane (Minisart, Sartorius). The supernatant that has been filtered was inserted into a sterile tube and stored at low temperature [23].

2.2.2. Lytic Bacteriophage Morphology by the Double Layer Agar Method

Bacteriophage stocks were then inoculated using the modified method of Bonilla et al. by the double layer plaque technique. A total of 100 μL of lytic bacteriophage stock were diluted into the Ringer buffer with serial 10-fold dilutions. Then, each serial dilution of lytic bacteriophages was taken as much as 100 μL and each was mixed with 100 μL of E. coli O157:H7 bacteria at exponential phase culture (McFarland 0.5) into a new sterile Eppendorp tube and incubated at 37°C for 30 minutes. Soft agar consisting 70% nutrient agar media that was previously made was then warmed at 56°C. After that, the previous mixture was added by pouring technique on nutrient agar media. Incubation was carried out at 37°C for 24 hours [24], and then the plaque formed was observed as lytic bacteriophage existence [23].

As lytic bacteriophages were observed, the purification of lytic bacteriophages was carried out by the plaque formed using Pasteur pipettes and enriched, so that more plaques would produce. Each plaque was transferred to 10 mL of E. coli O157:H7 bacterial culture at exponential phase (McFarland 0.5) and incubated for 24 hours, then centrifuged at 3000 rpm at 4°C for 20 minutes. The bacteriophage filtrate was then filtered using 0.22 μm millipore membrane (Minisart, Sartorius).

The result was in the form of a bacteriophage filtrate, and then it was carried out in an NA plate media. The plaque formed was then removed and inserted into the Ringer buffer. The bacteriophage suspension was vortexed and left about 5 to 10 minutes at room temperature, and so then the bacteriophages could attach the E. coli O157:H7 bacteria. Then, centrifugation was done at 3000 rpm at 4°C for 20 minutes for two replication times. The supernatant was filtered using a 0.22 μm millipore filter membrane (Minisart, Sartorius) and then stored as bacteriophage stock at low temperature (4°C) [23].

2.2.3. Bacteriophage Purification

A modified method of Thung et al. of bacteriophage propagation was used. The plaque formed previously was then removed and inserted into the Ringer buffer (4 : 1). The bacteriophage suspension was vortexed and left about 5 to 10 minutes at room temperature, and so then the bacteriophages could attach the E. coli O157:H7 bacteria. Then, centrifugation was done at 3000 rpm at 4°C for 20 minutes for two replication times. The supernatant was filtered using a 0.22 μm millipore filter membrane (Minisart, Sartorius) and then stored as bacteriophage stock at low temperature (4°C) [23].

2.2.4. Bacteriophage Propagation

Bacteriophage propagation was using the modified method of Bonilla et al., and a total of 10 mL of E. coli O157:H7 bacteria cultured in Nutrient Broth medium (Oxoid, UK) at exponential phase (McFarland 0.5) were centrifuged at 3000 rpm at 4°C for 20 minutes. The pellets formed were each infected with 100 μL of lytic bacteriophages. Each mixture was incubated at 37°C for 30 minutes, and the mixture was then added to 10 mL of Nutrient Broth medium and incubated for 24 hours at 37°C. Then, each of them was centrifuged at 3000 rpm at 4°C for 20 minutes. The supernatant formed was taken with a syringe and filtered with a 0.22 μm filter membrane (Minisart, Sartorius). Each supernatant that had been filtered was inserted into a sterile tube and stored as a bacteriophage stock at low temperature (4°C) [24] at Department of Microbiology, Faculty of Medicine, Universitas Airlangga, Surabaya, East Java, Indonesia.

2.2.5. Bacteriophage Quantification

Bacteriophage quantification was measured by counting the amount of plaque formed in NA media plates as plaque forming units/mL (PFU/mL). Each lytic bacteriophage stock was diluted by 10-fold serial, and then 100 μL from each dilution of the bacteriophage isolate was taken and transferred to 100 μL of the E. coli O157:H7 bacterial culture, after incubated for 24 hours on Nutrient Broth medium (Oxoid, UK). The suspension was incubated for 30 minutes at 37°C. A total of 7 mL of soft agar that was previously made at 56°C were mixed. After that, each one of the suspensions was poured onto NA plate media (Oxoid, UK) and incubated at 37°C for 24 hours. After incubation, we then observed the plaque formed and expressed as PFU/mL [24].

2.3. Electron Micrograph of Bacteriophage

The Eijkman Institute in Jakarta, Indonesia, used transmission electron microscopy to identify the shape of the bacteriophage. A total of 10 μL of bacteriophage were dropped onto a 400 mesh grid and left for 30 seconds. On carbon-coated grids, bacteriophage samples were negatively stained with 5 μL of 2% (w/v) uranyl acetate. The grids were viewed using a JEM-1010 TEM (JEOL, Tokyo, Japan) [25].

2.4. Lysis of E. coli O157:H7 Bacteriophage

Lysis of E. coli O157:H7 by bacteriophages was using the modified method of Mirzaei and Nilsson and Aryal. One milliliter of E. coli O157:H7 bacteria that had been grown on MacConkey Agar plates was transferred onto Nutrient Broth media (Oxoid, UK) at exponential phase (McFarland 0.5), and each was infected with 1 mL of bacteriophage stock. Each mixture was then incubated for 2 hours, 4 hours, 6 hours, and 8 hours. The opacity assessment of McFarland densitometry was carried out to calculate the number of live bacteria [25, 26].

2.5. Bacterial Suspension Preparation for Host Specificity

The bacteria used for the host specificity test of lytic bacteriophages were Atypical Diarrheagenic E. coli isolates (aDEC1, aDEC2, aDEC3, aDEC4, aDEC5) (from hospital inpatient care of diarrhea) and keep storage clinical storage Salmonella paratyphi A, Salmonella paratyphi B, and Shigella flexneri isolates (from the Microbiology Laboratory of Medical Faculty of Universitas Airlangga Culture Collection, Surabaya, Indonesia). Atypical Diarrheagenic E. coli (aDEC1, aDEC2, aDEC3, aDEC4, aDEC5), S. paratyphi A, S. paratyphi B, and S. flexneri isolates were stored in Tryptic Soy Broth Media with 15% glycerol at -20°C.

Stock culture of aDEC1, aDEC2, aDEC3, aDEC4, and aDEC5 was inoculated into Mac Conkey Agar plate media (Oxoid, UK) and incubated at 37°C for 24 hours. A positive result gives rise to a pink to rose red colonies, such as its ability to ferment lactose [27, 28] (Figure 1). Stock cultures of S. paratyphi A, S. paratyphi B, and S. flexneri isolates were inoculated into Salmonella Shigella Agar plate media (Oxoid, UK) and incubated at 37°C for 24 hours. A positive result gave rise to colorless for S. paratyphi A and S. flexneri, shown as colorless with black centers for S. paratyphi B as its ability to produce hydrogen sulfide (H₂S) [29] (Figure 2).

Atypical Diarrheagenic E. coli, S. paratyphi A, S. paratyphi B, and S. flexneri cultures were then identified by biochemical assay on Triple Sugar Iron Agar/TSIA (Oxoid, UK), Sulfate Indol Motility/SIM (Oxoid, UK), Simmons Citrate Agar/SCA (Oxoid, UK), and Urea broth (Oxoid, UK) [30] (see Table 2).

2.6. Host Specificity of Bacteriophages

In cultures of aDEC1, aDEC2, aDEC3, aDEC4, aDEC5, S. paratyphi A, S. paratyphi B, and S. flexneri, bacteriophage host specificity was observed using 100 μL of each bacterium previously grown in Tryptic Soy Broth Media (Oxoid, UK) by exponential phase (McFarland 0.5), mixed with 100 μL of lytic bacteriophages stock, and diluted into the Ringer buffer with serial 10-fold dilutions. Then, each serial dilution of lytic bacteriophage was taken as much as 100 μL into a new sterile Eppendorf tube and incubated at 37°C for 30 minutes for the lytic bacteriophages to attach. A total of 7 mL of soft agar that was previously made at 56°C was mixed by pouring technique on Nutrient Agar plate media, and incubation was carried out at 37°C for 24 hours. Then, the plaque formed was observed and counted [23].

2.7. Statistical Analysis

Statistical analysis used in this study was a nonparametric test in the form of the Friedman test. A significant result was continued with Conover’s posthoc.

3. Results and Discussion

3.1. Detection of Shiga Toxin Genes

The results of molecular identification of E. coli O157:H7 isolates carrying the stx1 and stx2 genes using the PCR technique show that only the stx1 gene was borne by E. coli O157:H7 isolates, as shown in Figure 3:

In contrast to the stx2 gene, this study discovered the stx1 gene formed by E. coli O157:H7 to the present in a 1220 bp band approximately. This gene was also found in the feces of children in Southern Iran [31] and human feces with clinical manifestations in Japan [32]. As a result, E. coli O157:H7 must also be monitored as a foodborne pathogen.

3.2. Bacteriophage Sample

The samples were collected from the environmental sources as shown in the following table:

3.3. Isolation of Bacteriophage

Plaques in E. coli O157:H7 carrying shiga toxin gene cultures grown in the double layer plaque indicate the presence of lytic bacteriophages (see Figure 4).

Bacteriophages could affect bacterial lysis because they are able to recognize receptors on the surface of the host bacteria, so that bacteriophages are able to transfer their genetic material into the host cell and replicate in the host cell causing lysis [33]. From Table 3, it can be seen that the diameter size was around 0.7 to 3.5 mm. Topka et al. obtained bacteriophages with clear colors with diameters of around 2-3 mm [34]. Regarding this, Yazdi et al. conducted a study with diameters of around 1.5-2 mm [35].

There are several factors that could affect plaque formation. Rapidity to lyse bacterial cells was one factor that could determine plaque morphology and size. This factor could cause different appearances of plaques, either in morphology or in size [36]. Plaque diameter was closely related to propagation, and having the right size was desirable for an effective lytic bacteriophage [37].

The rate of plaque formation was influenced by environmental conditions (temperature, pH, and aeration) and the accessibility of the bacteriophage to the target bacteria [38, 39]. Previous studies also reported that cofactors such as Ca²⁺ ions can stabilize the fragile interface of the virion with its receptors [40, 41]. The size and amount of bacteriophage plaque resulting from host cell infection are related to the ability of the bacteriophage to replicate in the host cell. Plaque size is also influenced by several factors, such as agar concentration, incubation conditions, and the log phase of host bacteria [42].

3.4. Concentration of Lytic Bacteriophage

The concentrations of the purified bacteriophages were then calculated based on the amount of plaque formed. The amount of plaque formed was then calculated in plaque forming units (PFU/mL), which is a measure of the amount of virus infective per volume of fluid. In addition, the lytic bacteriophage concentration was calculated as seen in Table 4:

Bacteriophage quantification was measured by counting the amount of plaque formed, and the concentration obtained was of to . The number of bacteriophages previously detected was >10⁸ PFU/mL of Bacillus cereus bacteriophage [33], 10¹⁵ PFU/mL of Klebsiella pneumoniae bacteriophage [43], PFU/mL of E. coli bacteriophage [44], PFU/mL [45], and for T4 bacteriophage [46], and [23], [34], and PFU/mL of E. coli bacteriophage [33]. Marti et al. conducted a study with Salmonella spp. bacteriophages with titers of PFU/mL [47]. Bao et al. obtained titers of [48].

Other studies have shown similar results with bacteriophage titres between 10⁸ and 10¹¹ PFU/mL, this could be due to the optimum plating condition, and other parameters such as the buffer in which the bacteriophages were suspended, the incubation media [49], Ca²⁺ ions which can stabilize the fragile interface of the virion with its receptors [40, 41], and the different bacteriophage environment surroundings could also be the influence [23, 50]. This study used Ringer buffer consisting of 1.55 g C₃H₅NaO₃, 3 g NaCl, 0.15 g KCl, and 0.1 g CaCl₂.2H2O, while other studies used SM buffer consisting of 5.8 g NaCl, 2 g MgSO₄·7H2O, 50 mM Tris-Cl (pH 7.5), and 5 mL gelatine in 1 L H₂O [23, 51, 52].

3.5. Electron Micrograph of Bacteriophage

The morphology of bacteriophages, such as the head and tail shapes, was discovered to be identical to the order of Caudovirales [53, 54], based on observations (see Figure 5).

Bacteriophages have a head and tail that vary in size, as seen in Table 5:

Based on the anatomy of the tail, Caudovirales was split into three groups. Myoviridae were bacteriophages with a long contractile tail, while Siphoviridae had a long noncontractile tail [54]. The head diameter of Siphoviridae bacteriophage ranged from 50 to 133.3 nm, while Myoviridae bacteriophage had a head diameter of 83.3 to 100 nm. The tail length of Siphoviridae bacteriophages ranged from 100 to 288 nm, while the tail length of Myoviridae bacteriophages ranged from 83.3 to 100 nm. The tail diameter of Siphoviridae bacteriophages ranged from 6.3 to 17.4 nm, while the tail length of Myoviridae bacteriophages ranged from 10 to 16.7 nm (see Table 5).

Bao et al. found the bacteriophage Siphoviridae with a tail length of 103.57 nm and a head diameter of 57.14 nm and Myoviridae bacteriophage with a head diameter of 74.3 nm and a tail length of 114.2 nm from chicken waste in chicken farms in China [48], while Lukman et al. also found EPEC bacteriophages with a head diameter of 67-70 nm and a tail length of 83-90 nm as Myoviridae from chickens and beef offal from traditional markets in Tangerang, Indonesia [33]. To ensure bacteriophage classification, more study, such as bacteriophage genome sequencing, is required.

3.6. Lysis of E. coli O157:H7 by Bacteriophage

One mL of E. coli O157:H7 was injected with 1 mL of bacteriophage stock into Triptic Soy Broth media (Oxoid, UK) at 37°C at an incubation interval of 0 hour, 2 hours, 4 hours, 6 hours, and 8 hours. The lysis of E. coli O157:H7 is as seen on Table 6:

The ability of LBP to lyse E. coli O157:H7 can be seen. In comparison to the amount of E. coli O157:H7 in the control, which was 1 without lytic bacteriophage injection, the lowest value of E. coli O157; H7 obtained was , with a maximum of (phage 1). The following table shows the reduction in E. coli O157:H7 caused by lytic bacteriophage:

After the 8-hour incubation period, lytic bacteriophage was able to lyse E. coli O157:H7 by 75% (see Table 7). Yazdi et al. stated that higher bacteriophage concentrations resulted in a faster reduction in the bacterial count, which could be due to an increased attachment rate at higher bacteriophage titers [41]. The speed of plaque formation is considered related to the multiplication rate of bacteriophages. The more bacteriophages are produced, and the more bacterial cells are lysed [38, 42]. In addition, the ability of lysis was also influenced by the multiplicity of infection (MOI), which is the ratio of bacteriophages to the number of target bacteria [53]. Bacterial growth will increase along with the decrease in MOI [33], but MOI cannot completely inhibit cell growth [55].

At first glance, the Myoviridae bacteriophage was faster than the Siphoviridae bacteriophage in lysing E. coli O157:H7 at the beginning of the infection time, but it was not seen at subsequent incubation times and obtained the same number of lysis as the Siphoviridae bacteriophage at the end of the incubation period (after 8 hours). Based on these characteristics, more research is needed on the lysis of bacteriophages with a higher number of Siphoviridae and Myoviridae bacteriophages, as well as a bigger number of E. coli O157:H7 bacterium.

3.7. Host Specificity of Bacteriophages

The host’s specificity is depicted in Figure 6 as plaque formation:

Phage 3, phage 4, and phage 8 were found to have plaque formation in aDEC1 (see Figure 6), with aDEC2, aDEC3, aDEC4, aDEC5, S. paratyphi A, S. paratyphi B, and S. flexneri, and lytic bacteriophage plaque development was not seen. In contrast to aDEC2, aDEC3, aDEC4, aDEC5, S. paratyphi A, S. paratyphi B, and S. flexneri, the presence of plaque in host specificity testing with aDEC1 indicates that phage 3, phage 4, and phage 8 infect other serotypes in one bacterial species, implying that the surface of aDEC1 bacterial cells has the same particular receptors against phage 3, phage 4, and phage 8. In this regard, Akhtar et al. discovered that Salmonella enterica lytic bacteriophages have a host specificity for S. typhimurium [56].

Jamal et al.’s study revealed that bacteriophages that lyse K. pneumoniae could not infect other bacteria, which suggest a narrow host range among other different bacterial strains [40]. It is similar to Abatangelo et al. who studied Staphylococcus aureus bacteriophages [57]. Bao et al. and Jurczak et al. found that Salmonella enterica bacteriophages could also lyse E. coli [48, 58]. Chen et al. found bacteriophages which lysed Pasteurella multocida A, and P capsular type was not able to lyse strains with D or F capsular type or other Gram-negative bacteria, including E. coli, Salmonella spp., and Bordetella bronchiseptica [59]. Lukman et al. also found a bacteriophage that can lyse EPEC and EHEC [33]. Further research on bacteriophage host specificity on another pathogenic E. coli is required based on these traits.

The narrow host specificity of bacteriophages may be viewed as a disadvantage. This characteristic restricts the number of bacteria where the selection for bacteriophage resistance mechanisms can occur in comparison to chemical antibiotics. This perhaps could be circumvented as cocktail bacteriophages with the aim of being able to lyse a wider range of bacterial species. Otherwise, it can be an advantage as it offers fewer side effects on natural flora. Therefore, the subject will not be susceptible to superinfection [19, 60].

3.8. Statistical Analysis

Statistical analysis using JASP 0.14.1.0 programme described a nonparametric test. The Friedman test conducted a significant effect in the lyse of E. coli O157:H7 by lytic bacteriophages (), with estimating a large effect size of Kendall’s W by 0.993 [61] (see Table 8):

From Conover’s posthoc test, the value was obtained for the effect of all groups as written in the following table:

Phage 1 had a statistically significant difference in E. coli O157:H7 quantity compared to phage 6 (), and LBP7 (), whereas phage 2 had a statistically significant difference in E. coli O157:H7 amount compared to phage 3 (), phage 6 (), and phage 7 (), according to Conover’s posthoc test. In addition, phage 5 had a significantly different impact in the lyse of E. coli O157:H7 relative to phage 6 () and phage 7 (). Phage 6 had a significantly different effect in the lyse of E. coli O157:H7 compared to phage 8 (), and phage 7 had a significantly different effect in the lyse of E. coli O157:H7 compared to phage 8 () (see Table 9).

On phage 6 and phage 7, the amount of E. coli O157:H7 was shown to be lower than on phage 1, the number of E. coli O157:H7 detected by phage 3, phage 6, and phage 7 was statistically lower than phage 2, and the number of E. coli O157:H7 detected by phage 6 and phage 7 produced a lower number of E. coli O157:H7 than phage 5.

4. Conclusions

Lytic bacteriophage identified from environmental sewage in Surabaya, Indonesia, shows plaque morphology as a clear zone with the largest diameter size of 3.5 mm, and lytic bacteriophage could infect E. coli O157:H7 carrying the stx1 gene at the highest titer of . Bacteriophages have been identified as Siphoviridae and Myoviridae by electron micrograph.

It was studied that phage 3, phage 4, and phage 8 could infect Atypical Diarrheagenic E. coli 1 (aDEC1) due to their host specificity. The Friedman statistical tests indicate that lytic bacteriophage can significantly lyse E. coli O157:H7 (). The lysis of E. coli O157:H7 by phage 1, phage 2, phage 3, and phage 5 bacteriophages was statistically significant, according to Conover’s posthoc test (). The conclusion obtained from this study is that lytic bacteriophages from environmental sewage could lyse E. coli O157:H7. Therefore, it could be an alternative biocontrol agent against E. coli O157:H7 that contaminates food causing foodborne disease.

Data Availability

The data used to support the findings of this study are included within the article.

Conflicts of Interest

The authors declared that there was no conflict of interest.

Acknowledgments

We would like to thank Mrs. Fariani Syahrul for providing the E. coli O157:H7 isolate, Mrs. Debi Arivo for contributing the enrichment of this manuscript, Mrs. Nur Ita Margyaningsih for the assistance at the Transmission Electron Microscope Laboratory, Eijkman Institute for Molecular Biology, Jakarta, Indonesia, and Mr. Sugeng Harijono for microbiology laboratory assisted. This study was supported by the Education Fund Management Institute (LPDP), Ministry of National Finance, Indonesia.

References

T. Junillon, A. Vimont, D. Mosticone et al., “Simplified detection of food-borne pathogens: an in situ high affinity capture and staining concept,” Journal of Microbiological Methods, vol. 91, no. 3, pp. 501–505, 2012.
View at: Publisher Site | Google Scholar
B. Carbas, L. Cardoso, and A. C. Coelho, “Investigation on the knowledge associated with foodborne diseases in consumers of northeastern Portugal,” Food Control, vol. 30, no. 1, pp. 54–57, 2013.
View at: Publisher Site | Google Scholar
I. Azevedo, H. Albano, J. Silva, and P. Teixeira, “Food safety in the domestic environment,” Food Control, vol. 37, no. 1, pp. 272–276, 2014.
View at: Publisher Site | Google Scholar
S. Hoffmann, B. Maculloch, and M. Batz, “Economic burden of major foodborne illnesses acquired in the United States,” 2015, October 2019, https://www.ers.usda.gov/webdocs/publications/43984/52807_eib140.pdf?v=2385.8.
View at: Google Scholar
M. Poxleitner, W. Pope, D. J. Sera, and V. H. G. Sivanathan, Phage discovery Guide, Chevy Chase (US), 2016, September 2019, https://www.coursehero.com/file/40591240/Phage-Discovery-Guide-Gordonia-2016pdf/.
F. Syahrul, C. U. Wahyuni, H. B. Notobroto, E. B. Wasito, A. C. Adi, and F. Dwirahmadi, “Transmission media of foodborne diseases as an index prediction of diarrheagenic Escherichia coli: study at elementary school, Surabaya, Indonesia,” International Journal of Environmental Research and Public Health, vol. 17, no. 21, p. 8227, 2020.
View at: Publisher Site | Google Scholar
Bisnis.com, “East Java cattle population targeted to grow 3.5% this year,” 2019, https://surabaya.bisnis.com/read/20190709/532/1121842/populasi-sapi-jatim-ditarget-tumbuh-35-tahun-ini.
View at: Google Scholar
Detiknews, “Keputran poultry market that smells badly unpacked,” 2018, September 2019, https://news.detik.com/berita-jawa-timur/d-4198620/lapak-pasar-unggas-keputran-yang-berbau-tak-sedap-dibongkar.
View at: Google Scholar
“Surabaya City Government evicts 40 poultry stands at Keputran market,” 2019, January 2020, https://jatimnet.com/pemkot-surabaya-gusur-40-stand-unggas-di-pasar-keputran.
View at: Google Scholar
“Smells, PD pasar regulates waste disposal of Keputran poultry traders,” 2019, January 2020, https://jatimnet.com/berbau-pd-pasar-atur-pembuangan-limbah-pedagang-unggas-keputran.
View at: Google Scholar
M. D. Kirk, S. M. Pires, R. E. Black et al., “World Health Organization estimates of the global and regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis,” PLoS Medicine, vol. 12, no. 12, article e1001921, 2015.
View at: Publisher Site | Google Scholar
J. Fathi, F. Ebrahimi, S. Nazarian, and Y. Tarverdizade, “Purification of shiga-like toxin from Escherichia coli O157: H7 by a simple method,” Journal of Applied Biotechnology Reports, vol. 4, no. 4, pp. 707–711, 2017.
View at: Google Scholar
N. Bhardwaj, S. K. Bhardwa, A. Deep, S. Dahiya, and S. Kapoor, “Lytic bacteriophages as biocontrol agents of foodborne pathogens,” Asian Journal of Animal and Veterinary, vol. 10, no. 11, pp. 708–723, 2015.
View at: Publisher Site | Google Scholar
H. Huh, S. Wong, J. St Jean, and R. Slavcev, “Bacteriophage interactions with mammalian tissue: therapeutic applications,” Advanced Drug Delivery Reviews, vol. 145, pp. 4–17, 2019.
View at: Publisher Site | Google Scholar
B. Aslam, W. Wang, M. I. Arshad et al., “Antibiotic resistance: a rundown of a global crisis,” Infection and Drug Resistance, vol. 11, pp. 1645–1658, 2018.
View at: Publisher Site | Google Scholar
K. Basappa and G. J. Venu, “Natural alternatives to antibiotic agents,” Asian Journal of Biomedical and Pharmaceutical Sciences, vol. 3, no. 25, pp. 1–4, 2013.
View at: Google Scholar
F. M. L. Bushell, P. D. Tonner, S. Jabbari, A. K. Schmid, and P. A. Lund, “Synergistic impacts of organic acids and pH on growth of Pseudomonas aeruginosa: a comparison of parametric and Bayesian non-parametric methods to model growth,” Front Microbiol, vol. 10, pp. 1–15, 2019.
View at: Google Scholar
P. Mathur, “Need of herbal antibiotics,” Clinical Pathology & Research Journal, vol. 2, no. 1, 2018.
View at: Publisher Site | Google Scholar
C. Loc-Carrillo and S. T. Abedon, “Pros and cons of phage therapy,” Bacteriophage, vol. 1, no. 2, pp. 111–114, 2011.
View at: Publisher Site | Google Scholar
Geneaid, Presto ™ Mini gDNA Bacteria Kit, Geneaid, 2017.
G. S. MOON, W. J. KIM, and W. S. SHIN, “Optimization of rapid detection of Escherichia coli O157:H7 and listeria monocytogenes by PCR and application to field test,” Journal of Food Protection, vol. 67, no. 8, pp. 1634–1640, 2004.
View at: Publisher Site | Google Scholar
K. M. Taha, “Agarose gel electrophoresis agriculture college-animal resources preparation of agarose gel,” 2016, September 2019, https://www.researchgate.net/publication/308904762_Agarose_Gel_electrophoresis.
View at: Google Scholar
T. Y. Thung, B. M. F. Siti Norshafawatie, J. M. K. J. K. Premarathne et al., “Isolation of food-borne pathogen bacteriophages from retail food and environmental sewage,” International Food Research Journal, vol. 24, no. 1, pp. 450–454, 2017.
View at: Google Scholar
N. Bonilla, M. I. Rojas, G. N. F. Cruz et al., “Phage on tap-a quick and efficient protocol for the preparation of bacteriophage laboratory stocks,” PeerJ, vol. 7, p. 2016, 2016.
View at: Google Scholar
M. K. Mirzaei and A. S. Nilsson, “Correction: Isolation of phages for phage therapy: a comparison of spot tests and efficiency of plating analyses for determination of host range and efficacy,” PLoS One, vol. 10, no. 5, article e0127606, 2015.
View at: Publisher Site | Google Scholar
S. Aryal, “McFarland standards principle preparation uses limitations.pdf,” 2020, September 2020, https://microbenotes.com/mcfarland-standards/.
View at: Google Scholar
B. T. Dikobe, N. P. Sithebe, and C. N. Ateba, “Detection ofE. coliisolates in water from Setumo Dam Mmabatho Area – North West Province, South Africa usingmdhspecific PCR analysis,” Journal of Human Ecology, vol. 36, no. 1, pp. 29–35, 2011.
View at: Publisher Site | Google Scholar
S. Aryal, “MacConkey Agar-composition, principle, uses, preparation and colony morphology,” 2018, December 2019, https://microbiologyinfo.com/macconkey-agar-composition-principle-uses-preparation-and-colony-morphology/.
View at: Google Scholar
S. Aryal, “Salmonella Shigella (SS) Agar-composition, principle, uses, preparation and result interpretation,” 2011, December 2019, https://microbiologyinfo.com/salmonella-shigella-ss-agar-composition-principle-uses-preparation-and-result-interpretation/.
View at: Google Scholar
N. Varghese, P. P. Joy, and N. Varghese, “Microbiology laboratory manual,” 2016, November 2020, https://www.researchgate.net/publication/306018042_Microbiology_Laboratory_Manual#fullTextFileContent.
View at: Google Scholar
M. Kargar and M. Homayoon, “Prevalence of shiga toxins (stx₁, stx₂), eaeA and hly genes of Escherichia coli O157:H7 strains among children with acute gastroenteritis in southern of Iran,” Asian Pacific Journal of Tropical Medicine, vol. 8, no. 1, pp. 24–28, 2015.
View at: Publisher Site | Google Scholar
S. Hoang Minh, E. Kimura, D. Hoang Minh, K. Honjoh, and T. Miyamoto, “Virulence characteristics of shiga toxin-producing Escherichia coli from raw meats and clinical samples,” Microbiology and Immunology, vol. 59, no. 3, pp. 114–122, 2015.
View at: Publisher Site | Google Scholar
C. Lukman, C. Yonathan, S. Magdalena, and D. E. Waturangi, “Isolation and characterization of pathogenic Escherichia coli bacteriophages from chicken and beef offal,” BMC Research Notes, vol. 13, no. 1, p. 8, 2020.
View at: Publisher Site | Google Scholar
G. Topka, S. Bloch, B. Nejman-Faleńczyk et al., “Characterization of bacteriophage vB-EcoS-95, isolated from urban sewage and revealing extremely rapid lytic development,” Front Microbiol, vol. 9, 2019.
View at: Publisher Site | Google Scholar
M. Yazdi, M. Bouzari, E. A. Ghaemi, and K. Shahin, “Isolation, characterization and genomic analysis of a novel bacteriophage VB_EcoS-Golestan infecting multidrug-resistant Escherichia coli isolated from urinary tract infection,” Scientific Reports, vol. 10, no. 1, article 7690, 2020.
View at: Publisher Site | Google Scholar
R. Gallet, S. Kannoly, and I. N. Wang, “Effects of bacteriophage traits on plaque formation,” BMC Microbiology, vol. 11, no. 1, p. 181, 2011.
View at: Publisher Site | Google Scholar
L. Amarillas, L. Rubí-Rangel, C. Chaidez, A. González-Robles, L. Lightbourn-Rojas, and J. León-Félix, “Isolation and characterization of phiLLS, a novel phage with potential biocontrol agent against multidrug-resistant Escherichia coli,” Frontiers in Microbiology, vol. 8, 2017.
View at: Publisher Site | Google Scholar
M. H. Ly-Chatain, “The factors affecting effectiveness of treatment in phages therapy,” Frontiers in Microbiology, vol. 5, 2014.
View at: Publisher Site | Google Scholar
S. Fister, C. Robben, A. K. Witte, D. Schoder, M. Wagner, and P. Rossmanith, “Influence of environmental factors on phage-bacteria interaction and on the efficacy and infectivity of phage P100,” Frontiers in Microbiology, vol. 7, 2016.
View at: Publisher Site | Google Scholar
M. Jamal, T. Hussain, C. R. Das, and S. Andleeb, “Characterization of siphoviridae phage Z and studying its efficacy against multidrug-resistant Klebsiella pneumoniae planktonic cells and biofilm,” Journal of Medical Microbiology, vol. 64, no. 4, pp. 454–462, 2015.
View at: Publisher Site | Google Scholar
M. Yazdi, M. Bouzari, and E. A. Ghaemi, “Isolation and characterization of a lytic bacteriophage (vB_PmiS-TH) and its application in combination with ampicillin against planktonic and biofilm forms of Proteus mirabilis isolated from urinary tract infection,” Journal of Molecular Microbiology and Biotechnology, vol. 28, no. 1, pp. 37–46, 2018.
View at: Publisher Site | Google Scholar
P. Hyman, “Phages for phage therapy: Isolation, characterization, and host range breadth,” Pharmaceuticals, vol. 12, no. 1, p. 35, 2019.
View at: Publisher Site | Google Scholar
R. Gupta, W. Bekele, and A. Ghatak, “Harvesting energy of interaction between bacteria and bacteriophage in a membrane-less fuel cell,” Bioresource Technology, vol. 147, pp. 654–657, 2013.
View at: Publisher Site | Google Scholar
C. M. Warner, N. Barker, S. W. Lee, and E. J. Perkins, “M13 bacteriophage production for large-scale applications,” Bioprocess and Biosystems Engineering, vol. 37, no. 10, pp. 2067–2072, 2014.
View at: Publisher Site | Google Scholar
M. Sochocka, T. Tomczyk, M. Sobczyński, B. Szermer-Olearnik, and J. Boratyński, “The kinetics of Escherichia coli B growth and bacteriophage T4 multiplication in SM-1 novel minimal culture medium,” The Journal of General and Applied Microbiology, vol. 61, no. 3, pp. 75–81, 2015.
View at: Publisher Site | Google Scholar
D. Nabergoj, N. Kuzmić, B. Drakslar, and A. Podgornik, “Effect of dilution rate on productivity of continuous bacteriophage production in cellstat,” Applied Microbiology and Biotechnology, vol. 102, no. 8, pp. 3649–3661, 2018.
View at: Publisher Site | Google Scholar
R. Marti, K. Zurfluh, S. Hagens, J. Pianezzi, J. Klumpp, and M. J. Loessner, “Long tail fibres of the novel broad-host-range T-even bacteriophage S16 specifically recognizeSalmonellaOmpC,” Molecular Microbiology, vol. 87, no. 4, pp. 818–834, 2013.
View at: Publisher Site | Google Scholar
H. Bao, H. Zhang, and R. Wang, “Isolation and characterization of bacteriophages of Salmonella enterica serovar Pullorum,” Poultry Science, vol. 90, no. 10, pp. 2370–2377, 2011.
View at: Publisher Site | Google Scholar
J. Cormier and M. Janes, “A double layer plaque assay using spread plate technique for enumeration of bacteriophage MS2,” Journal of Virological Methods, vol. 196, pp. 86–92, 2014.
View at: Publisher Site | Google Scholar
T. Denes and M. Wiedmann, “Environmental responses and phage susceptibility in foodborne pathogens: implications for improving applications in food safety,” Current Opinion in Biotechnology, vol. 26, pp. 45–49, 2014.
View at: Publisher Site | Google Scholar
D. Jakočiūnė and A. Moodley, “A rapid bacteriophage dna extraction method,” Methods and Protocols, vol. 1, no. 3, p. 27, 2018.
View at: Publisher Site | Google Scholar
D. Gutiérrez, L. Fernández, A. Rodríguez, and P. García, “Practical method for isolation of phage deletion mutants,” Methods and Protocols, vol. 1, no. 1, p. 6, 2018.
View at: Publisher Site | Google Scholar
C. M. Chibani, A. Farr, S. Klama, S. Dietrich, and H. Liesegang, “Classifying the unclassified: a phage classification method,” Viruses, vol. 11, no. 2, p. 195, 2019.
View at: Publisher Site | Google Scholar
H. W. Ackermann and D. Prangishvili, “Prokaryote viruses studied by electron microscopy,” Archives of Virology, vol. 157, no. 10, pp. 1843–1849, 2012.
View at: Publisher Site | Google Scholar
D. Tomat, L. Migliore, V. Aquili, A. Quiberoni, and C. Balagué, “Phage biocontrol of enteropathogenic and shiga toxin-producing Escherichia coli in meat products,” Frontiers in Cellular and Infection Microbiology, vol. 3, 2013.
View at: Publisher Site | Google Scholar
M. Akhtar, S. Viazis, and F. Diez-Gonzalez, “Isolation, identification and characterization of lytic, wide host range bacteriophages from waste effluents against Salmonella enterica serovars,” Food Control, vol. 38, no. 1, pp. 67–74, 2014.
View at: Publisher Site | Google Scholar
V. Abatángelo, N. Peressutti Bacci, C. A. Boncompain et al., “Broad-range lytic bacteriophages that kill Staphylococcus aureus local field strains,” PLoS One, vol. 12, no. 7, article e0181671, 2017.
View at: Publisher Site | Google Scholar
A. Jurczak-Kurek, T. Gąsior, B. Nejman-Faleńczyk et al., “Biodiversity of bacteriophages: morphological and biological properties of a large group of phages isolated from urban sewage,” Scientific Reports, vol. 6, no. 1, 2016.
View at: Publisher Site | Google Scholar
Y. Chen, E. Sun, J. Song, L. Yang, and B. Wu, “Complete genome sequence of a novel T7-like bacteriophage from a Pasteurella multocida capsular type a isolate,” Current Microbiology, vol. 75, no. 5, pp. 574–579, 2018.
View at: Publisher Site | Google Scholar
M. S. M. Brouwer, A. P. Roberts, H. Hussain, R. J. Williams, E. Allan, and P. Mullany, “Horizontal gene transfer converts non-toxigenic Clostridium difficile strains into toxin producers,” Nature Communications, vol. 4, no. 1, 2013.
View at: Publisher Site | Google Scholar
M. A. Sampson Goss, “Statistical analysis in JASP a guide for students. JASP v 0.14,” pp. 100–168, 2020, https://jasp-stats.org/wp-content/uploads/2020/11/Statistical-Analysis-in-JASP-A-Students-Guide-v14-Nov2020.pdf.
View at: Google Scholar

Copyright

Copyright © 2021 Tessa Sjahriani et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

4264

Downloads

1514

Citations