International Journal of Genomics

International Journal of Genomics / 2014 / Article
Special Issue

Drug-Related Genomics in Cancer and Immunological Diseases

View this Special Issue

Research Article | Open Access

Volume 2014 |Article ID 870597 |

Xiao-Lan Li, Chun-Feng Wu, Gui-Sheng Wu, "Genetic Variations of Cytokines and Cytokine Receptors in Psoriasis Patients from China", International Journal of Genomics, vol. 2014, Article ID 870597, 5 pages, 2014.

Genetic Variations of Cytokines and Cytokine Receptors in Psoriasis Patients from China

Academic Editor: Ji-Fu Wei
Received20 Mar 2014
Accepted11 May 2014
Published25 May 2014


Psoriasis is a chronic inflammatory and hyperproliferative skin disease affected by both genetic and environmental factors. The aim of the present study was to investigate polymorphisms in a candidate gene family of interleukin (IL) in unrelated Chinese patients with psoriasis and control subjects without psoriasis. In this case-control study, 200 unrelated Chinese psoriasis patients and 298 age- and sex-matched control subjects were enrolled. Genomic DNA was prepared from peripheral blood obtained from all psoriasis patients and control subjects. We genotyped seven single-nucleotide polymorphisms (SNPs) in candidate genes of six ILs: IL4, IL10, IL12B, IL13, IL15, and IL23R, which have been shown in the literature to be associated with psoriasis in other ethnic groups. Among the seven SNPs in the six IL genes studied, only the rs3212227 in the IL12B gene was found to be associated with psoriasis at genotypic level in the studied population. The C/C genotype in the IL12B gene is a protective factor of psoriasis (; OR = 0.51; 95% CI: 0.27–0.96) in Chinese. Furthermore, the studied Chinese population has extremely low minor allele frequency for IL23R. Together, the data reveal unique genetic patterns in Chinese that may be in part responsible for the lower risk for psoriasis in this population.

1. Introduction

Psoriasis is an immunologically mediated chronic inflammatory and hyperproliferative skin disease affected by both genetic and environmental factors. The prevalence of psoriasis varied among populations with different genetic backgrounds and habitats, from 3% in Northern Europe and 2% in North America and the UK to 0.1–0.3% in American Indians and East Asia [1, 2]. Psoriasis is proposed to be associated with other immune diseases, such as arthritis and Crohn’s disease [3]. Initial causative research has identified strong association between psoriasis and the interleukin genes (IL4, IL10, IL12B, IL13, and IL23R) in the northern European from US and UK [47]. Furthermore, the SNP rs56245420 in the IL15 gene has been found to be associated with psoriasis in the Chinese Han population but not in any of the UK, German, or US Caucasian populations investigated [810], since the minor allele frequency for this SNP and others across IL15 differs quite strikingly between the populations, suggesting heterogeneity in the genetic susceptibility to psoriasis.

In this study, we aimed to determine if psoriasis is associated with six IL genes that have been strongly associated with psoriasis in Europeans but not well studied in Chinese. The seven included SNPs are rs2243250 in the IL4 gene, rs1800872 in the IL10 gene, rs3212227 in the IL12B gene, rs1800925 and rs20541 in the IL13 gene, rs56245420 in the IL15 gene, and rs11209026 in the IL23R gene.

2. Materials and Methods

2.1. Study Population

A total of 200 psoriasis patients and 298 healthy controls were recruited in this study (see Table 2). All participants did not suffer from any other diseases and belonged to Han nationality in Yunnan Province, China. The study was performed according to the Helsinki Declaration with approval of the institutional review boards of the Affiliated Yan’an Hospital of Kunming Medical College and the Kunming Institute of Botany. Informed consent was obtained from each participant before inclusion in this study.

2.2. Determination of Genotype

Genomic DNAs were isolated from whole blood using regular phenol/chloroform method. The SNP rs11209026 in the IL23R gene was genotyped by the TaqMan allelic discrimination method (Applied Biosystems). New PCR-RFLP methods were generated to genotype the SNP rs56245420 in the IL15 gene. Primers 5′-TTT CTG TTA TTA ACA AAC ATC ACT CTG-3′ and 5′-CAA CAC TTG TAC ATA TTT TTA TTC AAt AT-3′ (mismatch is shown in bold lower case) were used for rs56245420. Other five SNPs were genotyped by PCR-RFLP methods described previously with slight modification [1115]. PCR reaction was carried out in a total volume of 20 μL containing 20 ng of genomic DNA, 1 × PCR buffer, 1.5 mM MgCl2, 200 μM of each dNTP, 30 ng of each primer, and 1 unit of Taq DNA polymerase (TakaRa). Samples were denatured at 95°C for 2 min followed by 30 cycles of 94°C for 45 sec, 61°C (rs2395029) or 54°C (rs56245420) for 45 sec, and 72°C for 45 sec and ended with a final extension for 7 min at 72°C. PCR products were digested with 4 U of appropriate restriction endonuclease and electrophoresed on 3% agarose gels and stained with ethidium bromide. The restriction endonucleases, PCR product lengths, and restriction patterns are shown in Table 1.

SNPGenePosition of SNP in genomic sequenceForward primeraReverse primerAnneal temperature (°C)Product length (bp)Restriction endonucleasesFragments of frequent allele genotype (bp)Fragments of heterozygous genotype (bp)Fragments of rare allele genotype (bp)Reference

rs2243250IL4132009154:C/TTAAACTTGGGAGAACATGGTTGGGGAAAGATAGAGTAATA49195AvaII19522 + 173 + 19522 + 173[1]
rs1800872IL10206946407:A/CAGGTGATGTAATATCTCTGTTAAATATCCTCAAAGTTCC57303RsaI65 + 23865 + 238 + 303303[2]
rs3212227IL12B158742950:A/CTTCTATCTGATTTGCTTTATGAAACATTCCATACATCC51233TaqI23368 + 165 + 23368 + 165[3]
rs1800925IL13131992809:C/TGTCGCCTTTTCCTGCTCTTCCCGCGGAATCCAGCATGCCTTGTGAGG65247Bsh1236I23 + 22423 + 224 + 247247[4]
rs20541IL13131995964:C/TTAGGCTGAAGACGGGCAGCAAAGAAACTTTTTCGCGAGGGCC63199MspI22 + 17722 + 177 + 199199[5]
rs56245420IL15142873720:A/TTTTCTGTTATTAACAAACATCACTCTGCAACACTTGTACATATTTTTATTCAATAT54274SspI27 + 24727 + 247 + 274274This study

Mismatch is shown in bold and underlined font.

SNPGenePopulationGenotype (%)Minor allele (%)

Controls189 (63.4)98 (32.9)11 (3.7)120 (20.1)
Psoriasis127 (63.5)61 (30.5)12 (6.0)85 (21.3)

Controls138 (46.3)123 (41.3)37 (12.4)197 (33.1)
Psoriasis93 (46.5)86 (43.0)21 (10.5)128 (32.0)

Controls119 (39.9)128 (43.0)51 (17.1)230 (38.6)
Psoriasis77 (38.5)104 (52.0)19 (9.5)*a142 (35.5)

Controls222 (74.5)72 (24.2)4 (1.3)80 (13.4)
Psoriasis140 (70.0)52 (26.0)8 (4.0)68 (17.0)

Controls146 (49.0)126 (42.3)26 (8.7)178 (29.9)
Psoriasis100 (50.0)80 (40.0)20 (10.0)120 (30.0)

Controls139 (46.6)135 (45.3)24 (8.1)183 (30.7)
Psoriasis78 (39.0)97 (48.5)25 (12.5)147 (36.8)

Controls298 (100)000
Psoriasis200 (100)000

2.3. Data Analysis

Statistics analysis was performed by SPSS software for windows (SPSS Inc.). The frequencies of genotypes and alleles for all the six studied loci were determined assuming codominant inheritance. The Hardy-Weinberg equilibrium (HWE) for six loci in psoriasis patients and controls was tested by means of chi-square tests. The statistical significance of the genotype and allele frequency variables between the psoriasis patients and control group was evaluated by chi-square test with Yates correction for small numbers. Relative risk associated with the significant genotype was estimated by the odds ratio (OR). OR with 95% confidence intervals (95% CI) was tested using a chi-square distribution and the null hypothesis being tested is OR = 1. values <0.05 were considered as statistically significant.

3. Results

Only one of the fourteen Hardy-Weinberg tests (seven polymorphic loci each in the psoriasis patient and control groups) had values smaller than 0.05 ( at rs3212227 in controls). All nine remaining genotype frequencies fit Hardy-Weinberg expectations according to chi-square tests in psoriasis patients and controls (). Therefore, there is no meaningful deviation from WHE, and our population is derived from random mating.

Polymorphism (minor allele frequency > 1%) has been found for all studied SNPs except for rs11209026 in the IL23R gene (Table 2). Table 2 shows that rs3212227 in the IL12B gene () was associated with psoriasis at genotypic level in the studied population. Other SNPs examined were not associated with psoriasis considered from single locus. As shown in Table 3, while the A/C genotype (OR = 1.48; 95% CI: 0.95–2.30) and the alleles (OR = 0.84; 95% CI: 0.63–1.13) at rs3212227 in the IL12B were not a risk factor of psoriasis, the C/C genotype was a protective factor of psoriasis (OR = 0.51; 95% CI: 0.27–0.96).

SNPGenotypePsoriasisControlsOR (95% CI)AllelePsoriasisControlsOR (95% CI)

TC61980.93 (0.63–1.37)C851201.07 (0.78–1.46)
CC12111.62 (0.69–3.78)
TC-CC731091.00 (0.69–1.45)

AC861231.04 (0.71–1.52)C1281970.95 (0.72–1.25)
CC21370.84 (0.46–1.53)
AC-CC1071600.99 (0.69–1.42)

AC1041282.18 (1.21–3.92)A2583661.14 (0.88–1.48)
AA771191.71 (0.96–3.17)
AC-AA1812471.97 (1.12–3.45)

CT52721.15 (0.76–1.74)T68801.32 (0.93–1.86)
TT843.17 (0.94–10.72)
CT-CC60761.25 (0.84–1.86)

CT801260.93 (0.64–1.36)T1201781.01 (0.77–1.33)
TT20261.12 (0.59–2.12)
CT-TT1001520.96 (0.67–1.37)

AT971351.28 (0.87–1.87)T1471831.28 (1.00–1.71)
TT25241.85 (0.99–3.46)
AT-TT1221591.36 (0.94–1.96)

4. Discussion

The etiology of psoriasis is a complex interaction of environmental and biological factors. Genetic factors may play a significant role in the risk of psoriasis in Chinese [10, 16]. Recent genetic studies indicate that the location of these genes varies considerably among populations and families. We are interested to know if psoriasis is associated with the genes that have been strongly associated with psoriasis in Europeans but not well studied in Chinese.

Our results showed that the IL12B gene was associated with psoriasis in Chinese at genotypic level (), which is in line with the findings from European studies [17]. The C/C genotype for rs3212227 in IL12B is a protective factor (OR = 0.51) from psoriasis. Similar result from studying SNP rs6887695 in IL12B showed that the minor allele C was a protective factor from psoriasis [5].

The nonsynonymous SNP in IL23R, rs11209026, widely thought to be the primary psoriasis-associated SNP in IL23R in Europeans, was found not to be polymorphic in Chinese, which is in agreement with the findings of others [18]. The low frequencies of variant in IL23R are accordingly of low risk for psoriasis in Chinese. With single SNP analysis, no association is found between the psoriasis and the IL4, IL10, IL13, and IL15 genes.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.


This work was supported by Grants from the National Natural Science Foundation of China (81360457) and the Natural Science Foundation of Yunnan Province (2012FB099).


  1. J. E. Gudjonsson and J. T. Elder, “Psoriasis: epidemiology,” Clinics in Dermatology, vol. 25, no. 6, pp. 535–546, 2007. View at: Publisher Site | Google Scholar
  2. R. Parisi, D. P. Symmons, C. E. Griffiths, and D. M. Ashcroft, “Global epidemiology of psoriasis: a systematic review of incidence and prevalence,” Journal of Investigative Dermatology, vol. 133, no. 2, pp. 377–385, 2013. View at: Publisher Site | Google Scholar
  3. R. P. Nair, T. Henseler, S. Jenisch et al., “Evidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide scan,” Human Molecular Genetics, vol. 6, no. 8, pp. 1349–1356, 1997. View at: Publisher Site | Google Scholar
  4. K. C. Duffin and G. G. Krueger, “Genetic variations in cytokines and cytokine receptors associated with psoriasis found by genome-wide association,” Journal of Investigative Dermatology, vol. 129, no. 4, pp. 827–833, 2009. View at: Publisher Site | Google Scholar
  5. Y. Liu, C. Helms, W. Liao et al., “A genome-wide association study of psoriasis and psoriatic arthritis identifies new disease loci,” PLoS Genetics, vol. 4, no. 3, 2008. View at: Publisher Site | Google Scholar
  6. R. P. Nair, K. C. Duffin, C. Helms et al., “Genome-wide scan reveals association of psoriasis with IL-23 and NF-κB pathways,” Nature Genetics, vol. 41, no. 2, pp. 199–204, 2009. View at: Publisher Site | Google Scholar
  7. F. Capon, M. J. Bijlmakers, N. Wolf et al., “Identification of ZNF313/RNF114 as a novel psoriasis susceptibility gene,” Human Molecular Genetics, vol. 17, no. 13, pp. 1938–1945, 2008. View at: Publisher Site | Google Scholar
  8. R. L. Smith, S. Eyre, R. B. Warren, H. S. Young, C. E. M. Griffiths, and J. Worthington, “No association between polymorphisms in the interleukin-15 gene and early-onset psoriasis in a UK cohort suggests heterogeneity for this susceptibility locus identified in Chinese psoriasis patients,” Journal of Investigative Dermatology, vol. 128, no. 12, pp. 2904–2905, 2008. View at: Publisher Site | Google Scholar
  9. W. Weger, A. Hofer, P. Wolf et al., “Role of the interleukin 15 96516A>T and IL15 96330C>A gene polymorphisms in caucasian patients with chronic plaque psoriasis,” Journal of Dermatological Science, vol. 51, no. 2, pp. 147–149, 2008. View at: Publisher Site | Google Scholar
  10. X. J. Zhang, K. L. Yan, Z. M. Wang et al., “Polymorphisms in interleukin-15 gene on chromosome 4q31.2 are associated with psoriasis vulgaris in Chinese population,” Journal of Investigative Dermatology, vol. 127, no. 11, pp. 2544–2551, 2007. View at: Publisher Site | Google Scholar
  11. E. Tarazona-Santos and S. A. Tishkoff, “Divergent patterns of linkage disequilibrium and haplotype structure across global populations at the interleukin-13 (IL13) locus,” Genes and Immunity, vol. 6, no. 1, pp. 53–65, 2005. View at: Publisher Site | Google Scholar
  12. P. E. Graves, M. Kabesch, M. Halonen et al., “A cluster of seven tightly linked polymorphisms in the IL-13 gene is associated with total serum IgE levels in three populations of white children,” Journal of Allergy and Clinical Immunology, vol. 105, no. 3, pp. 506–513, 2000. View at: Google Scholar
  13. T. Kawashima, E. Noguchi, T. Arinami et al., “Linkage and association of an interleukin 4 gene polymorphism with atopic dermatitis in Japanese families,” Journal of Medical Genetics, vol. 35, no. 6, pp. 502–504, 1998. View at: Google Scholar
  14. C. C. Mok, J. S. Lanchbury, D. W. Chan, and C. S. Lau, “Interleukin-10 promoter polymorphisms in Southern Chinese patients with systemic lupus erythematosus,” Arthritis and Rheumatology, vol. 41, no. 6, pp. 1090–1095, 1998. View at: Google Scholar
  15. A. Alvarado-Navarro, M. Montoya-Buelna, J. F. Munoz-Valle, R. I. Lopez-Roa, C. Guillen-Vargas, and M. Fafutis-Morris, “The 3′UTR 1188 A/C polymorphism in the interleukin-12p40 gene (IL-12B) is associated with lepromatous leprosy in the West of Mexico,” Immunology Letters, vol. 118, no. 2, pp. 148–151, 2008. View at: Publisher Site | Google Scholar
  16. F. Long, C. Sun, D. Deng, X. Zhou, X. P. Li, and Y. P. Zhang, “TNF-238A is associated with juvenile onset psoriasis in patients of Han population in Southwest China,” Journal of Dermatological Science, vol. 36, no. 2, pp. 109–111, 2004. View at: Publisher Site | Google Scholar
  17. F. Capon, S. Semprini, B. Dallapiccola, and G. Novelli, “Evidence for interaction between psoriasis-susceptibility loci on chromosomes 6p21 and 1q21,” The American Journal of Human Genetics, vol. 65, no. 6, pp. 1798–1800, 1999. View at: Publisher Site | Google Scholar
  18. S. I. Davidson, X. Wu, Y. Liu et al., “Association of ERAP1, but not IL23R, with ankylosing spondylitis in a Han Chinese population,” Arthritis and Rheumatism, vol. 60, no. 11, pp. 3263–3268, 2009. View at: Publisher Site | Google Scholar

Copyright © 2014 Xiao-Lan Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles