Journal of Food Quality / 2018 / Article / Tab 1

Research Article

Composition of High Molecular Weight Glutenin Subunits in Polish Common Wheat Cultivars (Triticum aestivum L.)

Table 1

Sets of alleles: specific markers for the identification of wheat HMW glutenin genes used in the study.

Genes Forward and reverse primer sequences (5′-3′)Expected
DNA fragment
References

1Dx2 or 1Dx5F: GCCTAGCAACCTTCACAATC
R: GAAACCTGCTGCGGACAAG
413–430 bp or 450 bpD’Ovidio and
Anderson [5]
1Dy10 or 1Dy12F: GTTGGCCGGTCGGCTGCCATG
R: TGGAGAAGTTGGATAGTACC
400 bp or 612 bp Ahmad [6]

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.