Table 1: Sets of alleles: specific markers for the identification of wheat HMW glutenin genes used in the study.

Genes Forward and reverse primer sequences (5′-3′)Expected
DNA fragment
References

1Dx2 or 1Dx5F: GCCTAGCAACCTTCACAATC
R: GAAACCTGCTGCGGACAAG
413–430 bp or 450 bpD’Ovidio and
Anderson [5]
1Dy10 or 1Dy12F: GTTGGCCGGTCGGCTGCCATG
R: TGGAGAAGTTGGATAGTACC
400 bp or 612 bp Ahmad [6]