Journal of Food Quality / 2020 / Article / Tab 1

Research Article

Effects of Bitter Melon Saponin on the Glucose and Lipid Metabolism in HepG2 Cell and C. elegans

Table 1

Primer sequences for cells and C. elegans.

ModelsGenesForward sequences (5′-3′)Reverse sequences (5′-3′)

HepG2 cellsAMPKACAGGCATATGGTGGTCCATAGAGATTGGGTGAGCCACAACTTGTTC
ACC2GCAAGAACGTGTGGGGTTACTTCGTAGTGGGCTTGCTGAAAA
CPT1GGTGAACAGCAACTATTATGTCATCCTCTGGAACTGCATC
GLUT4GCTACCTCTACATCATCCATCTCACCCGGCTACAAAGACC
PGC-1αGGGGCTCTCCAGAACATCATTCAAGGGGTCTACATGGCAA
GAPDHGGGGCTCTCCAGAACATCATTCAAGGGGTCTACATGGCAA

C. elegansFat-5CGGCCGCCCTCTTCCGTTACTGGCTGCCATCCGACCCAGT
Fat-6TCAACAGCGCTGCTCACTATTTCGACTGGGGTAATTGAGG
Fat-7CAACAGCGCTGCTCACTATTCACCAACGGCTACAACTGTG
Nhr-49AGGCTCGTGTCAATCAAGAGATGTGATGCCGATGCTCCAGAATCACTTC
β-ActinGCCGGAGACGACGCTCCACGCGGCCTCGTCTCCGACGTACGAGTC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.