Journal of Immunology Research

Journal of Immunology Research / 2015 / Article
Special Issue

Intestinal Microbiota as Modulators of the Immune System

View this Special Issue

Research Article | Open Access

Volume 2015 |Article ID 361604 |

P. Carasi, S. M. Racedo, C. Jacquot, D. E. Romanin, M. A. Serradell, M. C. Urdaci, "Impact of Kefir Derived Lactobacillus kefiri on the Mucosal Immune Response and Gut Microbiota", Journal of Immunology Research, vol. 2015, Article ID 361604, 12 pages, 2015.

Impact of Kefir Derived Lactobacillus kefiri on the Mucosal Immune Response and Gut Microbiota

Academic Editor: Borja Sánchez
Received18 Jul 2014
Revised22 Sep 2014
Accepted23 Sep 2014
Published24 Feb 2015


The evaluation of the impact of probiotics on host health could help to understand how they can be used in the prevention of diseases. On the basis of our previous studies and in vitro assays on PBMC and Caco-2 ccl20:luc reporter system presented in this work, the strain Lactobacillus kefiri CIDCA 8348 was selected and administrated to healthy Swiss mice daily for 21 days. The probiotic treatment increased IgA in feces and reduced expression of proinflammatory mediators in Peyer Patches and mesenteric lymph nodes, where it also increased IL-10. In ileum IL-10, CXCL-1 and mucin 6 genes were upregulated; meanwhile in colon mucin 4 was induced whereas IFN-γ, GM-CSF, and IL-1β genes were downregulated. Moreover, ileum and colon explants showed the anti-inflammatory effect of L. kefiri since the LPS-induced increment of IL-6 and GM-CSF levels in control mice was significantly attenuated in L. kefiri treated mice. Regarding fecal microbiota, DGGE profiles allowed differentiation of experimental groups in two separated clusters. Quantitative PCR analysis of different bacterial groups revealed only significant changes in Lactobacillus population. In conclusion, L. kefiri is a good candidate to be used in gut inflammatory disorders.

1. Introduction

Interactions between commensal bacteria, intestinal epithelial and immune cells play a crucial role in the maintenance of gut homeostasis [1, 2]. Microbial recognition through pattern-recognition receptors induces the expression and release of many different immune mediators, such as chemokines and pro- or anti-inflammatory cytokines which contribute to orchestrating both the innate and the adaptive immune response [3, 4]. The use of probiotics to modulate immune responses at mucosal and systemic level constitutes a very interesting alternative regarding the prevention and treatment of infectious diseases [5, 6] and different immunopathologies such as inflammatory bowel diseases and allergies [79] or metabolic disorders [10, 11].

Kefir grains are constituted by a complex symbiotic microbiota, and they are used to obtain fermented milks named “kefir” [12]. Several health-promoting properties such as immunological, antimicrobial, antitumoral, and hypocholesterolemic effects have been associated with kefir-consumption [1317] and the study of the beneficial properties attributed to kefir-isolated microorganisms constitutes a field of great interest for the development of functional foods.

Immunomodulatory properties have been reported for different yeasts and bacteria isolated from kefir grains. Among kefir yeasts, Kluyveromyces marxianus CIDCA 8154 and Saccharomyces cerevisiae CIDCA 8112 downregulate intestinal epithelial innate response through a mechanism dependent on NF-kB modulation [18]. In the case of lactic acid bacteria retrieved from kefir, L. kefiranofaciens has been proven to ameliorate colitis in a DSS-induced murine model [19] and to produce antiasthmatic effects on ovalbumin-allergic asthma mice [20]. On the other hand, Carey and Kostrzynska [21] showed that L. kefiri attenuates the proinflammatory response in intestinal epithelial cells induced by Salmonella Typhimurium and Hong et al. [22] showed its influence on Th1 and proinflammatory cytokines production on macrophages.

One of the most important lactobacilli retrieved from kefir is Lactobacillus kefiri [2326]. In previous studies, our workgroup has demonstrated that secretion products and surface proteins from L. kefiri exert a protective action against the invasion of Salmonella enterica serovar Enteritidis to Caco-2 cells [27] and also against the cytotoxic effects of clostridial toxins on Vero cells [28]. Moreover, L. kefiri strains have been proven to be safe [29] and to adhere to gastrointestinal mucus [30]. On the other hand, L. kefiri strains preserve a high percentage of viability after both spray-drying [31, 32] and freeze-drying procedures [33]. All the mentioned properties show the potentiality of L. kefiri as probiotic microorganism.

The study of the mechanisms underlying probiotic effect on the host on nonpathological conditions may be helpful for evaluating safety and further application of beneficial microorganisms in the prevention and treatment of different diseases. Taking into account the potentiality of L. kefiri as a novel probiotic, we propose to evaluate the immunomodulatory properties of kefir-isolated L. kefiri strains by in vitro and in vivo assays, along with changes in gut microbiota composition induced by L. kefiri administration.

2. Materials and Methods

2.1. Bacterial Strains and Growth Conditions

Lactobacillus kefiri CIDCA 83111, 83113, 83115, 8321, 8325, 8345, and 8348 were isolated from kefir grains [12]. L. kefiri JCM 5818 was obtained from the Japanese Collection of Microorganisms (Reiken, Japan). Previously, L. kefiri CIDCA 83115, 8321, 8345, and 8348 were characterized as aggregating strains; meanwhile L. kefiri CIDCA 83111, 83113, and JCM 5818 were described as nonaggregative strains [34]. Lactobacilli were cultured in MRS-broth (DIFCO, Detroit, USA) 37°C for 48 h in aerobic conditions. Frozen stock cultures were stored at −80°C in skim milk until use.

2.2. Stimulation Assay with Caco-2 ccl20:luc Reporter System

The experiments were performed as described previously [35]. Briefly, Caco-2 cells stably transfected with a luciferase reporter construction under the control of CCL20 promoter (Caco-2 ccl20:luc) [36] were cocultured 2 h with a suspension of the L. kefiri strains (107 CFU per well) to be tested (multiplicity of incubation = 100). Then, cells were stimulated using flagellin from Salmonella enterica ser. Typhimurium (FliC) (1 μg mL−1) for 6 h. Luciferase activity was measured in a Labsystems Luminoskan TL Plus luminometer (Thermo Scientific, USA) using a luciferase assay system (Promega, Madison, WI, USA). Luminescence was normalized and expressed as the percentage of the mean of stimulated control (NAL).

2.3. PBMC Stimulation Experiments

Peripheral blood samples pretested for the absence of HIV or hepatitis virus infections were obtained from healthy volunteers (EFS Aquitaine, Bordeaux Blood Bank). Human PBMCs were isolated by centrifugation on Ficoll-Hypaque gradients. After washing, 2 × 106 cells/well were cultured in 12-well plates in RPMI-1640 medium supplemented with 2 g L−1 NaHCO3, 300 mg L−1 L-glutamine, 100 μg mL−1 streptomycin, 100 IU mL−1 penicillin (Sigma Chemical Co., St. Louis, MO, USA) and 10% FBS.

L. kefiri stimulation experiments on PBMC were performed coculturing 2 × 107 bacteria per well () during 24 h at 37°C in an atmosphere of 95% air and 5% CO2. Culture supernatants were collected and kept at −80°C until cytokines analysis. Experiences were realized in triplicate. Cell viability was not affected after 24 h of coincubation with bacteria (data not shown).

2.4. Quantification of Cytokine Levels in Culture Supernatants

Profiles of cytokines were analyzed after L. kefiri strain stimulation of PBMC using the Human Th1/Th2 11plex FlowCytomix Kit (eBioscience). It was designed to measure human IFN-γ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12 p70, TNF-α, and TNF-β. Analysis was performed in a flow cytometer BD Accuri C6 (BD Biosciences). TGF-β was measured using the eBioscience human/mouse TGF beta 1 Ready-SET-Go! ELISA Kit (minimum detectable concentration 8.0 pg/mL).

2.5. Mice

Male Swiss albino mice, 4-week-old (Janvier, Le Genest St Isle, France), were quarantined 2 weeks after arrival and were housed under standard laboratory conditions with free access to food and water. The temperature was kept at 22°C and a 12-hour light/dark schedule was maintained. All procedures were performed according to the guidelines of the local ethics committee and in strict accordance with the guidelines issued by the European Economic Community “86/609.” Mice were randomly divided into two groups (/group) and received by gavage 108 CFU of L. kefiri CIDCA 8348 (Lk group) or PBS (control group) daily for 7 days and 21 days; at each time point 6 mice of each group were sacrificed.

2.6. Tissue and Stool Sampling

Stools were collected at days 7, 14, and 21 and stored at −80°C until analysis. At the end of the experimental protocol, day 7 or 21, ileum and colon samples were collected and were preserved at −20°C in RNAlater (QIAGEN, Hilden, Germany) until RNA extraction. On day 21 Peyer Patches (PP) and mesenteric lymph nodes (mLN) were also removed and preserved at −20°C in RNAlater for expression analysis, and ileum and colon explants were collected in RPMI medium and processed immediately in order to analyze cytokines’ secretion.

2.7. Quantification of Gene Expression in Tissue Samples by qRT-PCR
2.7.1. RNA Extraction

Total RNA was isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) with an additional DNase treatment (Turbo DNA-free, Ambion, Inc.) according to the manufacturer’s instructions.

2.7.2. cDNA Synthesis

One μg of total RNA was reverse-transcribed using the Maxima Reverse Transcriptase (Fermentas, France) with anchored-oligo (dT) 18 primer, according to manufacturers’ instructions.

2.7.3. Quantitative PCR

Quantitative real-time PCR analyses were performed using a CHROMO 4 System (Bio-Rad). The reaction mixture comprised Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, France), 0.5 μmol  of each primer, and the respective standardized cDNA as a template. Target gene copy numbers were normalized against the housekeeping genes hypoxanthine phosphoribosyltransferase (HPRT) and β2 microglobulin (B2m). Cytokine and chemokine genes evaluated were il1b, il6, il10, il12p70, il17a, il23, ifng, tnfa, tgfb, cxcl1, baff, april, gmcsf; the transcription factors studied were foxp3 and rorgt; epithelial barrier and IgA related genes were zo-1, occludin, and pIgR; mucin genes were muc1, muc2, muc3, muc4, muc6, and muc13. Primer sequences and PCR conditions are available upon request (E-mail: A negative control reaction without template was included for each primer combination.

2.8. Evaluation of Cytokine Secretion by Ileum and Colon Explants

Ileum and colon explants were cultured in RPMI medium supplemented with 10% fetal bovine serum (Gibco-Invitrogen, Carlsbad, CA, USA), 100 μg mL−1 streptomycin and 100 IU mL−1 penicillin G, 100 μg mL−1 gentamycin or RPMI complete medium with addition of 10 μg mL−1 of LPS from E. coli as a stimulus (all from Sigma Chemical Co., St. Louis, MO, USA) for 24 h at 37°C in an atmosphere of 95% air and 5% CO2 [37]. Supernatants were collected, centrifuged, and frozen for later cytokines (IL-6, IL-4, IL-10, IL-17A, IFN-γ, and GM-CSF) measurements (Ready-SET-Go! ELISA Kit, eBioscience, France). All assays were performed according to the manufacturer’s instructions. The minimum detectable concentrations were 4.0 pg mL−1 (IL-6, IL-4, and GM-CFS), 15 pg mL−1 (IFN-γ), and 30.0 pg mL (IL-10 and IL-17A).

2.9. Determination of Total IgA in Stools

At 7, 14, and 21 days after L. kefiri treatment the level of total IgA in stools was measured by ELISA according to the technique described by BD Pharmigen. Briefly, Maxisorp Nunc plates were coated overnight with purified rat anti-mouse IgA (BD 556969). The plates were washed with PBS containing 0.05% v/v Tween 20 (PBS-T) and blocked with FBS 10% v/v in PBS. Plates were incubated for 2 h at room temperature with purified mouse IgA kappa (BD 553476) or fecal samples. Plates were revealed using biotin rat anti-mouse IgA (BD 556978), streptavidin horseradish peroxidase (BD 554066), and trimethylbenzidine (TMB substrate reagent set BD OptEIA 555214). Using a Mutliscan FC microplate reader (Thermo Scientific) absorbance was read at 450 nm. All determinations were performed in triplicate.

2.10. Microbiota Population Analysis in Feces by q-PCR

Microbiota population analysis in feces was performed on the day 21 of the experience. DNA extraction was performed using the NucleoSpin Soil Genomic DNA isolation kit (Macherey-Nagel) according to the manufacturer’s instructions except the feces solubilisation step. Quantification of bacterial populations was carried out using primers synthesized by Biomers (France). PCR reactions were performed on a CHROMO 4 System (Bio-Rad) using Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, France). Twenty ng DNA and 0.2 μmol L−1 of each primer were used in PCR mix. A negative control reaction without template was included for each primer combination. Melting curve was conducted from 70°C to 90°C read every 0.5°C during 2 s. The resulting data were collected and analyzed using Opticon Monitor. Standard curves were made with pure cultures of appropriate strains extracted using the same protocol as feces. Primers sequences are able on Table 1.

PopulationForward and reverse primers (5′-3′)Reference



Faecalibacterium prausnitzii AGATGGCCTCGCGTCCGA



Clostridium leptum groupGCACAAGCAGTGGAGT

Clostridium coccoides groupCGGTACCTGACTAAGAAGC
Bifidobacterium spp.TCGCGTCYGGTGTGAAAG

Bacteroides fragilis groupCTGAACCAGCCAAGTAGCG

Segmented filamentous bacteria GACGCTGAGGCATGAGAGCAT

Lactobacillus murinus GTGGCGAACGGGTGAGTAA

Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC

2.11. Qualitative Analysis of Fecal Microbiota by PCR-DGGE

HDA1 and HDA2-GC (GC clamp required for DGGE analysis [38], targeting the V2-V3 region [39]) were used to assess microbial diversity in each sample. The PCR products were separated in 8% polyacrylamide gels (37.5 : 1 acrylamide : bisacrylamide) with a range of 30–50% denaturing gradient (100% denaturant consisted of 7 M urea and 40% deionized formamide) cast with Bio-Rad’s Model 475 gradient delivery system (BioRad, Hercules, CA, USA). The electrophoresis was performed in TAE 0.5X buffer for 5 h at a constant electric current of 125 mA and a temperature of 60°C with the DCode Mutation Detection System (Bio-Rad, Hercules, CA, USA). Clustering analysis was performed using the UPGMA (unweighted pair group method with arithmetic mean clustering algorithm) to calculate the dendrograms.

2.12. Statistical Analysis

Statistical comparisons for significant differences were performed according to Student’s -test. Differences with were considered significant.

3. Results

3.1. Cytokines Profile of PBMC Cocultured with L. kefiri Strains

A preliminary screening of the eight L. kefiri strains was carried out using PMBC. PBMC and bacteria coculture assays were performed and profiles of cytokines secreted during incubation with the strains were analyzed. The levels of IL-2, IL-4, IL-5, TNF-β y TGF-β1 were under the lower range of reliable detection. Meanwhile a significant increase in IL-1β, IL-6, IL-10, TNF-α, IL-8, and IL-12 p70 concentrations was observed for all tested microorganisms (Table 2). In an attempt to predict the type of Th response they could promote, we analyzed the TNF-α/IL-10 and IL-10/IL-12 ratios (Table 3).

L. kefiri IL-1IL-6IL-8IL-10IFN-TNF-IL-12p70

CIDCA 83211294 ± 5261552 ± 7095771 ± 1284205 ± 76131 ± 2210436 ± 3785312 ± 72
CIDCA 83252050 ± 752571 ± 944824 ± 531313 ± 1159 ± 3816169 ± 45572 ± 94
CIDCA 83451655 ± 82033 ± 154399 ± 106230 ± 385 ± 2015368 ± 1075449 ± 21
CIDCA 83481936 ± 102719 ± 133855 ± 40435 ± 9083 ± 413551 ± 198502 ± 121
CIDCA 831151023 ± 601778 ± 123621 ± 34192 ± 949 ± 28613 ± 500738 ± 206
CIDCA 83111604 ± 832401 ± 813806 ± 167253 ± 1103 ± 239908 ± 175815 ± 189
CIDCA 831131148 ± 261722 ± 953920 ± 202201 ± 1153 ± 227514 ± 427475 ± 59
JCM 5818591 ± 103919 ± 404228 ± 1284 ± 262 ± 136872 ± 1647246 ± 94
Nonstimulated PBMC35 ± 271 ± 6418 ± 20221 ± 115 ± 11175 ± 541 ± 13

L. kefiri TNF-/IL-10IL-10/IL-12

CIDCA 832150.9 ± 11.4c,d 0.66 ± 0.24d,e,f
CIDCA 832551.7 ± 0.1d0.55 ± 0.06e
CIDCA 834566.8 ± 4.7e0.51 ± 0.02e
CIDCA 834831.2 ± 0.5b0.87 ± 0.18f
CIDCA 8311544.9 ± 2.6c0.26 ± 0.01b
CIDCA 8311139.2 ± 0.7c0.31 ± 0.02c
CIDCA 8311337.4 ± 2.1c0.42 ± 0.02d
JCM 581881.8 ± 19.6f0.34 ± 0.03c
Nonstimulated PBMC8.3 ± 0.2a0.005 ± 0.002a

The highest TNF-α/IL-10 ratio was observed for the nonaggregating strain L. kefiri JCM 5818 and the lowest for the autoaggregative strain L. kefiri CIDCA 8348. In agreement with these results, L. kefiri CIDCA 8348 showed the highest IL-10/IL-12 ratio while L. kefiri JCM 5818 was, among other strains such as CIDCA 83111, 83113, and 83115, in the opposite ratio, expecting a poor anti-inflammatory effect.

3.2. Regulation of Caco-2 ccl20:luc Reporter System by L. kefiri Strains

The ability of the eight strains of L. kefiri to modulate intestinal innate response to proinflammatory stimuli such as flagellin (FliC) was studied using a Caco-2 ccl20:luc reporter system [18, 36]. Only three strains (CIDCA 8348, 83111, and JCM 5818) downregulated cell activation induced by FliC (Figure 1), suggesting their potential anti-inflammatory properties.

L. kefiri CIDCA 8348 was chosen to perform in vivo studies on Swiss mice since parameters associated with safety and other beneficial properties have been previously demonstrated [29]. Moreover, L. kefiri CIDCA 8348 is an aggregative strain. This is an important property for probiotics since it has been proposed that aggregation represents a mechanism by which gastrointestinal commensals adhere to each other and it could allow them to colonize persistently in biofilms on the host’s mucosa [40].

3.3. Kinetics of Fecal IgA Response after Oral Administration of L. kefiri CIDCA 8348 in Swiss Mice

Stool suspensions were assayed for total IgA by ELISA to evaluate the induction of mucosal IgA (Figure 2). An induction was observed after 14 days of probiotic administration and the levels continue rising after 21 days. Even though no differences in IgA secretion were observed after 7 days of treatment between groups, flow cytometry quantified IgA+ cells were significantly higher in mLN from Lk group (data not shown).

3.4. Effect of L. kefiri Administration on Gene Expression of Gut Mucosa

The expression of cytokines, chemokines, mucins, and epithelial barrier genes as well as IgA related genes was studied by qRT-PCR in ileum and colon after 7 and 21 days of oral administration of L. kefiri CIDCA 8348.

As shown in Figure 3, a seven-day treatment significantly downregulated IL-1β and IL-17A gene expression in ileum; meanwhile mucin 3 and mucin 6 were upregulated. In contrast, in colon only gene expression of mucin 4 was modified.

The administration of L. kefiri for a longer period, 21 days, produced higher expression levels of IL-10, CXCL-1, and mucin 6 genes in ileum (Figure 4(a)). In colon, downregulation of IFN-γ, GM-CSF, and IL-1β genes was observed together with the upregulation of mucin 4 (Figure 4(a)).

The effect of L. kefiri treatment for 21 days on gene expression was also evaluated in Peyer patches (PP) and mesenteric lymph nodes (mLN) (Figure 4(b)). In PP the expression of IL-23, IFN-γ, and IL-6 was downregulated. Interestingly, in mLN not only proinflammatory mediators (IL-6, IL-23, IL-17A, and GM-CSF) and RORγt transcription factor were downregulated but also IL-10 gene expression was increased.

3.5. Ex Vivo Mice Intestinal Explants to Study Mucosal Anti-Inflammatory Effect of L. kefiri

To analyze the ability of L. kefiri treatment to modulate the mucosal immune response in a proinflammatory environment, ex vivo experiments were performed stimulating ileum and colon explants with LPS from not treated (control) and 21-day L. kefiri treated mice. LPS stimulation induced an increment of IL-6 and GM-CSF levels in control mice (Figures 5(a) and 5(b)). These increments were significantly attenuated in both ileum and colon explants of L. kefiri treated mice (Figures 5(a) and 5(b)). Moreover, in colon explants from Lk group a higher secretion of IL-10 was observed in LPS stimulated samples (Figure 5(b)). The levels of IL-4, IL-17, IFN-γ, and TNF-α were undetectable in both Lk and control mice explants.

3.6. Effect of L. kefiri Administration on Fecal Microbiota

The qualitative profile of fecal microbiota was determined by PCR-DGGE (Figure 6(a)). Microbial diversity was assessed by the number of amplification bands generated from each sample. There were no differences between control and Lk group ( and , resp.). However, changes in the microbial community composition were produced since the cluster analysis based on the Pearson product-moment correlation coefficient and UPGMA linkage allowed differentiation of the experimental groups in two clusters (Figure 6(b)).

As expected, an increment in Lactobacillus population was observed by qPCR but quantitative differences were not observed in the two major phyla, Firmicutes or Bacteroidetes (Figure 6(c)). Moreover, no significant changes were detected in other evaluated bacterial populations (Table 1).

4. Discussion

In the last years, an increasing number of in vitro and in vivo experiments have supported the idea that probiotic microorganisms confer their health benefits to the host by interacting with the immune system, particularly through establishing and maintaining a balance between pro- and anti-inflammatory cytokines [41, 42]. In kefir, bacteria and yeasts exist in symbiotic association and contributed to beneficial properties. Several authors have demonstrated the ability of kefir to modulate the mucosal immune response in mice and suggest that a Th1 response was controlled by Th2 cytokines [15, 16]. Some immunological effects were attributed to the formation of bioactive peptides during milk fermentation and also to production of exopolysaccharides as kefiran [13]. However, features regarding the effects of bacteria remain very important. It has been recently described that one strain of L. kefiranofaciens protects mice in a model of allergy [20] and also in an experimental model of colitis [19], but to our knowledge, our work constitutes the first report of the in vivo immunomodulatory activity of L. kefiri.

In the present work we demonstrated that L. kefiri strains induced the secretion of proinflammatory Th1 mediators such as IL-1β, IFN-γ, IL-6, IL-12p70, and TNF-α in PBMC as well as the production of the Th2 cytokine IL-10. These findings are not surprising, since several authors have reported the upregulation of these proinflammatory cytokines by probiotic bacteria on PBMC [6, 4345] or in mice macrophages by L. kefiranofaciens [22]. However, we found that L. kefiri strains stimulate immune cells to produce different ratios of cytokines, suggesting that they could possess different T cell polarizing abilities.

Cytokines are mutually regulated molecules; thus the balance between them influences CD4+ T-cell differentiation towards Th1, Th2, or Th17 cells. IL-12 induces Th1-mediated responses; meanwhile the anti-inflammatory cytokine IL-10 suppresses the production of IL-12 among other Th1 cytokines. The observed differences in the production of IL-12, IL-10, and TNF-α could contribute to understanding the type of response a strain may promote [45, 46]. JCM 5818 showed the highest TNF-α/IL-10 ratio whereas CIDCA 8348 presented the lower ratio. Moreover, CIDCA 8348 showed also the highest IL-10/IL-12 ratio which presupposes that it is a good anti-inflammatory candidate [47]. In concordance with these results, the strain CIDCA 8348 was also capable, along with other two L. kefiri strains, of eliciting an anti-inflammatory response on flagellin-stimulated intestinal epithelial cells (Caco-ccl20 reporter system) which has been previously reported for several probiotic bacteria [48] and yeasts [18, 49]. Curiously, JCM 5818 strain that presented the most anti-inflammatory capacity using Caco-ccl20 reporter system presented the most proinflammatory profile using PBMC. It might be interesting in the future to study the in vivo anti-inflammatory properties of this strain.

Although in vitro research using PBMC from healthy donors or intestinal epithelial cells can be used to screen the immunomodulatory activity of probiotic strains candidates, while reducing considerably the use of animals for screening purposes, they could not always be a good indicator of in vivo effect [4, 46, 47]. In consequence, to better understand the immunomodulatory ability of L. kefiri, the strain CIDCA 8348 was selected to be administered orally to mice in order to analyze the effect on different aspects of mucosal immune response and microbiota modulation.

CIDCA 8348 strain occasioned an increment in IgA+ B cells in mLN and it correlated with an increase of IgA in fecal samples of L. kefiri-treated mice. These findings are in agreement with results reported for some lactobacilli-based probiotics [50, 51] or even for the administration of kefir-fermented milk [16, 52]. SIgA, the predominant immunoglobulin in secretions, is a key element in maintaining gut homeostasis and in the protection of mucosal surfaces against pathogens [53]. Expression of molecules involved in class switch to IgA, expansion of IgA-expressing B cells, and their differentiation to IgA secreting plasma cells was studied. Even though no changes in the expression of APRIL, BAFF, and TGFβ1 genes in PP, mLN, ileum, or colon were observed, IL-10 was significantly induced in both ileum and mLN. It has been described that this cytokine induces IgA production, either through induction of TGFβ within the target B cell itself or through enhancement of the postswitch maturation [54]. Nevertheless, a downregulation of the expression of proinflammatory cytokines (IL-1β and IL-17A) was observed in ileum tissue at 7th day of administration of L. kefiri. This effect became more evident after 21 days of treatment, when a significant decrease of several proinflammatory mediators was determined in Peyer’s patches (IL-6, GM-CSF, IL-17A, and IFN-γ), mesenteric lymphoid nodes (IL-6, GM-CSF, and IL-17A), and colon (GM-CSF, IFN-γ, and IL-1β) showing the anti-inflammatory ability of this L. kefiri strain in vivo. This kind of results, which support the suppression of proinflammatory immunity by probiotics, was reported for different nonpathogenic and probiotic bacteria by other authors in healthy [55] or disease models [47], but this is the first report for L. kefiri isolated from kefir. Moreover, the anti-inflammatory cytokine IL-10 was increased in ileum as well as the chemokine CXCL-1. This interesting chemoattractant, analogous in function to human IL-8, is an important regulator of neutrophil recruitment from the lamina propria to the epithelium and has been shown to be essential in protection against DSS-induced colitis [56].

On the other hand, intestinal explants from L. kefiri-treated mice showed a downregulation of IL-6 and GM-CSF after in vitro stimulation with a proinflammatory mediator such as LPS in comparison with control mice. Taken together, all these experiments allowed us to confirm the anti-inflammatory phenotype associated with L. kefiri CIDCA 8348 administration.

Regarding another feature on mucosal physiology, we studied the effect of L. kefiri administration on the expression of mucin genes. Mucins are the main component of the mucus layer and it has been described that their secretion could be modified by changes in host microbiota, infections, and probiotic or antibiotic treatments [5759]. Only a few authors have evaluated the effect of probiotic administration in healthy lab animals. Particularly, Dykstra et al. [60] observed differential induction of muc1, muc2, and muc3 in ileum and colon after administration of Lactobacillus plantarum 299 v to Sprague-Dawley rats. In addition, studies performed in Swiss mice revealed that administration of L. plantarum L91 induced muc2 in colon [61]; meanwhile Jiang et al. [62] reported that L. rhamnosus GG-treated C57BL/6NHsd mice overexpressed muc3 without changes in muc1, muc2, or muc4. In L. kefiri-treated mice muc3 and muc6 increased their expression in the ileum after 7 days of treatment whereas at 21 days only muc6 was increased. In colon, at 7 and 21 days muc4 expression was increased in L. kefiri-treated mice. These changes could be associated with the presence of L. kefiri in the gut or with the modifications in microbiota populations induced by it [63]. Moreover, differences in the quantity and composition of the local microbiota [64] as well as the characteristics and thickness of the mucus layer [58, 65] could have an impact in the way L. kefiri interacts with the epithelium or its effect on microbiota.

5. Conclusion

In this study, we demonstrated that L. kefiri strains isolated from kefir stimulated the production of different ratios of pro/anti-inflammatory cytokines in vitro. We proved that the administration of L. kefiri CIDCA 8348 to mice not only downregulates expression of proinflammatory mediators but also increases anti-inflammatory molecules in gut immune system inductive and effector sites. Likewise, the increment in IgA production together with mucin induction and the impact in microbiota demonstrate the importance of this probiotic in the regulation of intestinal homeostasis. Thus, it is a good candidate to be used in gut inflammatory disorders.


PBMC:Peripheral blood mononuclear cells
GM-CSF:Granulocyte macrophage colony-stimulating factor
CXCL-1:Chemokine (C-X-C motif) ligand 1
TNF:Tumor Necrosis Factor.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.


This work was supported by Agencia Nacional de Promoción Científica y Tecnológica (PICT 00479/06), CONICET, Universidad Nacional de La Plata (Project 11X/548), and Bordeaux Science Agro, Ministère de l’Agriculture Français. P. Carasi and D. Romanin are fellows of CONICET; M Serradell is a member of the Carrera de Investigador Científico y Tecnológico of CONICET. S. Racedo, C. Jacquot, and M. C. Urdaci are researchers of Bordeaux Science Agro, Université de Bordeaux. P. Carasi was also supported by Boehringer Ingelheim Fonds (travel grants programme).


  1. D. Kelly and I. E. Mulder, “Microbiome and immunological interactions,” Nutrition Reviews, vol. 70, supplement 1, pp. S18–S30, 2012. View at: Publisher Site | Google Scholar
  2. M. Rescigno, “The intestinal epithelial barrier in the control of homeostasis and immunity,” Trends in Immunology, vol. 32, no. 6, pp. 256–264, 2011. View at: Publisher Site | Google Scholar
  3. V. Delcenserie, D. Martel, M. Lamoureux, J. Amiot, Y. Boutin, and D. Roy, “Immunomodulatory effects of probiotics in the intestinal tract,” Current Issues in Molecular Biology, vol. 10, no. 1, pp. 37–54, 2008. View at: Google Scholar
  4. J. M. Wells, “Immunomodulatory mechanisms of lactobacilli,” Microbial cell factories, vol. 10, supplement 1, p. S17, 2011. View at: Publisher Site | Google Scholar
  5. J. Heineman, S. Bubenik, S. McClave, and R. Martindale, “Fighting fire with fire: is it time to use probiotics to manage pathogenic bacterial diseases?” Current Gastroenterology Reports, vol. 14, no. 4, pp. 343–348, 2012. View at: Publisher Site | Google Scholar
  6. S. B. Gaudana, A. S. Dhanani, and T. Bagchi, “Probiotic attributes of lactobacillus strains isolated from food and of human origin,” British Journal of Nutrition, vol. 103, no. 11, pp. 1620–1628, 2010. View at: Publisher Site | Google Scholar
  7. R. B. Sartor, “Therapeutic manipulation of the enteric microflora in inflammatory bowel diseases: antibiotics, probiotics, and prebiotics,” Gastroenterology, vol. 126, no. 6, pp. 1620–1633, 2004. View at: Publisher Site | Google Scholar
  8. K. Shida and M. Nanno, “Probiotics and immunology: separating the wheat from the chaff,” Trends in Immunology, vol. 29, no. 11, pp. 565–573, 2008. View at: Publisher Site | Google Scholar
  9. Z. Q. Toh, A. Anzela, M. L. K. Tang, and P. V. Licciardi, “Probiotic therapy as a novel approach for allergic disease,” Frontiers in Pharmacology, vol. 3, no. 11, article 171, 2012. View at: Publisher Site | Google Scholar
  10. N. M. Delzenne, A. M. Neyrinck, F. Bäckhed, and P. D. Cani, “Targeting gut microbiota in obesity: effects of prebiotics and probiotics,” Nature Reviews Endocrinology, vol. 7, no. 11, pp. 639–646, 2011. View at: Publisher Site | Google Scholar
  11. J. Aggarwal, G. Swami, and M. Kumar, “Probiotics and their effects on metabolic diseases: an update,” Journal of Clinical and Diagnostic Research, vol. 7, no. 1, pp. 173–177, 2013. View at: Publisher Site | Google Scholar
  12. G. L. Garrote, A. G. Abraham, and G. L. de Antoni, “Chemical and microbiological characterisation of kefir grains,” Journal of Dairy Research, vol. 68, no. 4, pp. 639–652, 2001. View at: Publisher Site | Google Scholar
  13. E. Farnworth, “Kefir—a complex probiotic,” Food Science & Technology Bulletin, vol. 2, no. 1, pp. 1–17, 2005. View at: Google Scholar
  14. E. J. Kakisu, A. G. Abraham, P. F. Pérez, and G. L. de Antoni, “Inhibition of Bacillus cereus in milk fermented with kefir grains,” Journal of Food Protection, vol. 70, no. 11, pp. 2613–2616, 2007. View at: Google Scholar
  15. G. Vinderola, G. Perdigon, J. Duarte, D. Thangavel, E. Farnworth, and C. Matar, “Effects of kefir fractions on innate immunity,” Immunobiology, vol. 211, no. 3, pp. 149–156, 2006. View at: Publisher Site | Google Scholar
  16. C. G. Vinderola, J. Duarte, D. Thangavel, G. Perdigón, E. Farnworth, and C. Matar, “Immunomodulating capacity of kefir,” Journal of Dairy Research, vol. 72, no. 2, pp. 195–202, 2005. View at: Publisher Site | Google Scholar
  17. A. M. D. O. Leite, M. A. L. Miguel, R. S. Peixoto, A. S. Rosado, J. T. Silva, and V. M. F. Paschoalin, “Microbiological, technological and therapeutic properties of kefir: a natural probiotic beverage,” Brazilian Journal of Microbiology, vol. 44, no. 2, pp. 341–349, 2013. View at: Publisher Site | Google Scholar
  18. D. Romanin, M. Serradell, D. G. Maciel, N. Lausada, G. L. Garrote, and M. Rumbo, “Down-regulation of intestinal epithelial innate response by probiotic yeasts isolated from kefir,” International Journal of Food Microbiology, vol. 140, no. 2-3, pp. 102–108, 2010. View at: Publisher Site | Google Scholar
  19. Y. P. Chen, P. J. Hsiao, W. S. Hong, T. Y. Dai, and M. J. Chen, “Lactobacillus kefiranofaciens M1 isolated from milk kefir grains ameliorates experimental colitis in vitro and in vivo,” Journal of Dairy Science, vol. 95, no. 1, pp. 63–74, 2012. View at: Publisher Site | Google Scholar
  20. W.-S. Hong, Y.-P. Chen, T.-Y. Dai, I.-N. Huang, and M.-J. Chen, “Effect of heat-inactivated kefir-isolated lactobacillus kefiranofaciens M1 on preventing an allergic airway response in mice,” Journal of Agricultural and Food Chemistry, vol. 59, no. 16, pp. 9022–9031, 2011. View at: Publisher Site | Google Scholar
  21. C. M. Carey and M. Kostrzynska, “Lactic acid bacteria and bifidobacteria attenuate the proinflammatory response in intestinal epithelial cells induced by Salmonella enterica serovar typhimurium,” Canadian Journal of Microbiology, vol. 59, no. 1, pp. 9–17, 2013. View at: Publisher Site | Google Scholar
  22. W. S. Hong, H. C. Chen, Y. P. Chen, and M. J. Chen, “Effects of kefir supernatant and lactic acid bacteria isolated from kefir grain on cytokine production by macrophage,” International Dairy Journal, vol. 19, no. 4, pp. 244–251, 2009. View at: Publisher Site | Google Scholar
  23. H.-C. Chen, S.-Y. Wang, and M.-J. Chen, “Microbiological study of lactic acid bacteria in kefir grains by culture-dependent and culture-independent methods,” Food Microbiology, vol. 25, no. 3, pp. 492–501, 2008. View at: Publisher Site | Google Scholar
  24. K. T. Magalhães, G. V. M. de Pereira, D. R. Dias, and R. F. Schwan, “Microbial communities and chemical changes during fermentation of sugary Brazilian kefir,” World Journal of Microbiology and Biotechnology, vol. 26, no. 7, pp. 1241–1250, 2010. View at: Publisher Site | Google Scholar
  25. G. L. Garrote, M. A. Serradell, A. G. Abraham, M. C. Añon, C. A. Fossati, and G. L. de Antoni, “Development of an immunochemical method to detect Lactobacillus kefir,” Food and Agricultural Immunology, vol. 16, no. 3, pp. 221–233, 2005. View at: Publisher Site | Google Scholar
  26. Z. Kesmen and N. Kacmaz, “Determination of lactic microflora of kefir grains and kefir beverage by using culture-dependent and culture-independent methods,” Journal of Food Science, vol. 76, no. 5, pp. M276–M283, 2011. View at: Publisher Site | Google Scholar
  27. M. A. Golowczyc, P. Mobili, G. L. Garrote, A. G. Abraham, and G. L. de Antoni, “Protective action of Lactobacillus kefir carrying S-layer protein against Salmonella enterica serovar Enteritidis,” International Journal of Food Microbiology, vol. 118, no. 3, pp. 264–273, 2007. View at: Publisher Site | Google Scholar
  28. P. Carasi, F. M. Trejo, P. F. Pérez, G. L. de Antoni, and M. D. L. A. Serradell, “Surface proteins from Lactobacillus kefir antagonize invitro cytotoxic effect of Clostridium difficile toxins,” Anaerobe, vol. 18, no. 1, pp. 135–142, 2012. View at: Publisher Site | Google Scholar
  29. P. Carasi, M. Diaz, S. M. Racedo, G. De Antoni, M. C. Urdaci, and M. D. L. A. Serradell, “Safety characterization and antimicrobial properties of kefir-isolated lactobacillus kefiri,” BioMed Research International, vol. 2014, Article ID 208974, 7 pages, 2014. View at: Publisher Site | Google Scholar
  30. P. Carasi, N. M. Ambrosis, G. L. de Antoni, P. Bressollier, M. C. Urdaci, and M. de los Angeles Serradell, “Adhesion properties of potentially probiotic Lactobacillus kefiri to gastrointestinal mucus,” Journal of Dairy Research, vol. 81, no. 1, pp. 16–23, 2014. View at: Publisher Site | Google Scholar
  31. M. A. Golowczyc, J. Silva, P. Teixeira, G. L. de Antoni, and A. G. Abraham, “Cellular injuries of spray-dried Lactobacillus spp. isolated from kefir and their impact on probiotic properties,” International Journal of Food Microbiology, vol. 144, no. 3, pp. 556–560, 2011. View at: Publisher Site | Google Scholar
  32. M. A. Golowczyc, J. Silva, A. G. Abraham, G. L. de Antoni, and P. Teixeira, “Preservation of probiotic strains isolated from kefir by spray drying,” Letters in Applied Microbiology, vol. 50, no. 1, pp. 7–12, 2010. View at: Publisher Site | Google Scholar
  33. P. A. Bolla, M. de Los Angeles Serradell, P. J. de Urraza, and G. L. de Antoni, “Effect of freeze-drying on viability and in vitro probiotic properties of a mixture of lactic acid bacteria and yeasts isolated from kefir,” Journal of Dairy Research, vol. 78, no. 1, pp. 15–22, 2011. View at: Publisher Site | Google Scholar
  34. P. Mobili, M. de los Ángeles Serradell, S. A. Trejo, F. X. A. Puigvert, A. G. Abraham, and G. L. de Antoni, “Heterogeneity of S-layer proteins from aggregating and non-aggregating Lactobacillus kefir strains,” Antonie van Leeuwenhoek, vol. 95, no. 4, pp. 363–372, 2009. View at: Publisher Site | Google Scholar
  35. P. Carasi, C. Jacquot, D. E. Romanin et al., “Safety and potential beneficial properties of Enterococcus strains isolated from kefir,” International Dairy Journal, vol. 39, no. 1, pp. 193–200, 2014. View at: Publisher Site | Google Scholar
  36. C. Nempont, D. Cayet, M. Rumbo, C. Bompard, V. Villeret, and J.-C. Sirard, “Deletion of Flagellin's hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5-dependent immunity,” The Journal of Immunology, vol. 181, no. 3, pp. 2036–2043, 2008. View at: Publisher Site | Google Scholar
  37. L. Chatelais, A. Jamin, C. G.-L. Guen, J.-P. Lallès, I. le Huërou-Luron, and G. Boudry, “The level of protein in milk formula modifies ileal sensitivity to LPS later in life in a piglet model,” PLoS ONE, vol. 6, no. 5, Article ID e19594, 2011. View at: Publisher Site | Google Scholar
  38. G. Muyzer, E. C. de Waal, and A. G. Uitterlinden, “Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA,” Applied and Environmental Microbiology, vol. 59, no. 3, pp. 695–700, 1993. View at: Google Scholar
  39. J. Walter, G. W. Tannock, A. Tilsala-Timisjarvi et al., “Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers,” Applied and Environmental Microbiology, vol. 66, no. 1, pp. 297–303, 2000. View at: Publisher Site | Google Scholar
  40. F. Turroni, F. Serafini, E. Foroni et al., “Role of sortase-dependent pili of Bifidobacterium bifidum PRL2010 in modulating bacterium-host interactions,” Proceedings of the National Academy of Sciences of the United States of America, vol. 110, no. 27, pp. 11151–11156, 2013. View at: Publisher Site | Google Scholar
  41. B. Corthésy, H. R. Gaskins, and A. Mercenier, “Cross-talk between probiotic bacteria and the host immune system,” Journal of Nutrition, vol. 137, no. 3, pp. 781–790, 2007. View at: Google Scholar
  42. V. Taverniti, M. Minuzzo, S. Arioli et al., “In vitro functional and immunomodulatory properties of the Lactobacillus helveticus MIMLh5-Streptococcus salivarius ST3 association that are relevant to the development of a pharyngeal probiotic product,” Applied and Environmental Microbiology, vol. 78, no. 12, pp. 4209–4216, 2012. View at: Publisher Site | Google Scholar
  43. H. Dong, I. Rowland, and P. Yaqoob, “Comparative effects of six probiotic strains on immune function in vitro,” British Journal of Nutrition, vol. 108, no. 3, pp. 459–470, 2012. View at: Publisher Site | Google Scholar
  44. B. Evrard, S. Coudeyras, A. Dosgilbert et al., “Dose-dependent immunomodulation of human dendritic cells by the probiotic Lactobacillus rhamnosus lcr35,” PLoS ONE, vol. 6, no. 4, Article ID e18735, 2011. View at: Publisher Site | Google Scholar
  45. S. de Roock, M. van Elk, M. O. Hoekstra, B. J. Prakken, G. T. Rijkers, and I. M. de Kleer, “Gut derived lactic acid bacteria induce strain specific CD4+ T cell responses in human PBMC,” Clinical Nutrition, vol. 30, no. 6, pp. 845–851, 2011. View at: Publisher Site | Google Scholar
  46. E. Mileti, G. Matteoli, I. D. Iliev, and M. Rescigno, “Comparison of the immunomodulatory properties of three probiotic strains of Lactobacilli using complex culture systems: prediction for in vivo efficacy,” PLoS ONE, vol. 4, no. 9, Article ID e7056, 2009. View at: Publisher Site | Google Scholar
  47. B. Foligne, S. Nutten, C. Grangette et al., “Correlation between in vitro and in vivo immunomodulatory properties of lactic acid bacteria,” World Journal of Gastroenterology, vol. 13, no. 2, pp. 236–243, 2007. View at: Publisher Site | Google Scholar
  48. B. Bahrami, M. W. Child, S. Macfarlane, and G. T. Macfarlane, “Adherence and cytokine induction in Caco-2 cells by bacterial populations from a three-stage continuous-culture model of the large intestine,” Applied and Environmental Microbiology, vol. 77, no. 9, pp. 2934–2942, 2011. View at: Publisher Site | Google Scholar
  49. S. Sougioultzis, S. Simeonidis, K. R. Bhaskar et al., “Saccharomyces boulardii produces a soluble anti-inflammatory factor that inhibits NF-κB-mediated IL-8 gene expression,” Biochemical and Biophysical Research Communications, vol. 343, no. 1, pp. 69–76, 2006. View at: Publisher Site | Google Scholar
  50. C. Maldonado Galdeano and G. Perdigón, “The probiotic bacterium Lactobacillus casei induces activation of the gut mucosal immune system through innate immunity,” Clinical and Vaccine Immunology, vol. 13, no. 2, pp. 219–226, 2006. View at: Publisher Site | Google Scholar
  51. C. A. Dogi, C. M. Galdeano, and G. Perdigón, “Gut immune stimulation by non pathogenic Gram(+) and Gram(-) bacteria. Comparison with a probiotic strain,” Cytokine, vol. 41, no. 3, pp. 223–231, 2008. View at: Publisher Site | Google Scholar
  52. M. C. Franco, M. A. Golowczyc, G. L. de Antoni, P. F. Pérez, M. Humen, and M. D. L. A. Serradell, “Administration of kefir-fermented milk protects mice against Giardia intestinalis infection,” Journal of Medical Microbiology, vol. 62, part 12, pp. 1815–1822, 2013. View at: Publisher Site | Google Scholar
  53. C. L. Ohland and W. K. MacNaughton, “Probiotic bacteria and intestinal epithelial barrier function,” The American Journal of Physiology—Gastrointestinal and Liver Physiology, vol. 298, no. 6, pp. G807–G819, 2010. View at: Publisher Site | Google Scholar
  54. A. J. Macpherson, M. B. Geuking, and K. D. McCoy, “Homeland security: IgA immunity at the frontiers of the body,” Trends in Immunology, vol. 33, no. 4, pp. 160–167, 2012. View at: Publisher Site | Google Scholar
  55. M. J. Smelt, B. J. de Haan, P. A. Bron et al., “L. plantarum, L. salivarius, and L. lactis attenuate Th2 responses and increase Treg frequencies in healthy mice in a strain dependent manner,” PLoS ONE, vol. 7, no. 10, Article ID e47244, 2012. View at: Publisher Site | Google Scholar
  56. B. M. Fournier and C. A. Parkos, “The role of neutrophils during intestinal inflammation,” Mucosal Immunology, vol. 5, no. 4, pp. 354–366, 2012. View at: Publisher Site | Google Scholar
  57. E. Amit-Romach, Z. Uni, S. Cheled, Z. Berkovich, and R. Reifen, “Bacterial population and innate immunity-related genes in rat gastrointestinal tract are altered by vitamin A-deficient diet,” Journal of Nutritional Biochemistry, vol. 20, no. 1, pp. 70–77, 2009. View at: Publisher Site | Google Scholar
  58. M. A. McGuckin, S. K. Lindén, P. Sutton, and T. H. Florin, “Mucin dynamics and enteric pathogens,” Nature Reviews Microbiology, vol. 9, no. 4, pp. 265–278, 2011. View at: Publisher Site | Google Scholar
  59. C. Ubeda and E. G. Pamer, “Antibiotics, microbiota, and immune defense,” Trends in Immunology, vol. 33, no. 9, pp. 459–466, 2012. View at: Publisher Site | Google Scholar
  60. N. S. Dykstra, L. Hyde, D. Adawi et al., “Pulse probiotic administration induces repeated small intestinal Muc3 expression in rats,” Pediatric Research, vol. 69, no. 3, pp. 206–211, 2011. View at: Publisher Site | Google Scholar
  61. A. Chandran, R. K. Duary, S. Grover, and V. K. Batish, “Relative expression of bacterial and host specific genes associated with probiotic survival and viability in the mice gut fed with lactobacillus plantarum Lp91,” Microbiological Research, vol. 168, no. 9, pp. 555–562, 2013. View at: Publisher Site | Google Scholar
  62. H. Jiang, J. Przybyszewski, D. Mitra et al., “Soy protein diet, but not Lactobacillus rhamnosus GG, decreases mucin-1, trefoil factor-3, and tumor necrosis factor-α in colon of dextran sodium sulfate-treated C57BL/6 mice,” Journal of Nutrition, vol. 141, no. 7, pp. 1239–1246, 2011. View at: Publisher Site | Google Scholar
  63. S. K. Lindén, T. H. J. Florin, and M. A. McGuckin, “Mucin dynamics in intestinal bacterial infection,” PLoS ONE, vol. 3, no. 12, Article ID e3952, 2008. View at: Publisher Site | Google Scholar
  64. A. Hakansson and G. Molin, “Gut microbiota and inflammation,” Nutrients, vol. 3, no. 6, pp. 637–682, 2011. View at: Publisher Site | Google Scholar
  65. M. Andrianifahanana, N. Moniaux, and S. K. Batra, “Regulation of mucin expression: mechanistic aspects and implications for cancer and inflammatory diseases,” Biochimica et Biophysica Acta: Reviews on Cancer, vol. 1765, no. 2, pp. 189–222, 2006. View at: Publisher Site | Google Scholar
  66. X. Guo, X. Xia, R. Tang, J. Zhou, H. Zhao, and K. Wang, “Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs,” Letters in Applied Microbiology, vol. 47, no. 5, pp. 367–373, 2008. View at: Publisher Site | Google Scholar
  67. R. F. Wang, W. W. Cao, and C. E. Cerniglia, “Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation,” International Journal of Systematic Bacteriology, vol. 46, no. 1, pp. 341–343, 1996. View at: Publisher Site | Google Scholar
  68. X. W. Huijsdens, R. K. Linskens, M. Mak, S. G. M. Meuwissen, C. M. J. E. Vandenbroucke-Grauls, and P. H. M. Savelkoul, “Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR,” Journal of Clinical Microbiology, vol. 40, no. 12, pp. 4423–4427, 2002. View at: Publisher Site | Google Scholar
  69. N. Larsen, F. K. Vogensen, F. W. J. van den Berg et al., “Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults,” PLoS ONE, vol. 5, no. 2, Article ID e9085, 2010. View at: Publisher Site | Google Scholar
  70. T. Matsuki, K. Watanabe, J. Fujimoto, T. Takada, and R. Tanaka, “Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces,” Applied and Environmental Microbiology, vol. 70, no. 12, pp. 7220–7228, 2004. View at: Publisher Site | Google Scholar
  71. T. Rinttilä, A. Kassinen, E. Malinen, L. Krogius, and A. Palva, “Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR,” Journal of Applied Microbiology, vol. 97, no. 6, pp. 1166–1177, 2004. View at: Publisher Site | Google Scholar
  72. C. Liu, Y. Song, M. McTeague, A. W. Vu, H. Wexler, and S. M. Finegold, “Rapid identification of the species of the Bacteroides fragilis group by multiplex PCR assays using group- and species-specific primers,” FEMS Microbiology Letters, vol. 222, no. 1, pp. 9–16, 2003. View at: Publisher Site | Google Scholar
  73. I. T. W. Harley, D. A. Giles, P. T. Pfluger et al., “Differential colonization with segmented filamentous bacteria and Lactobacillus murinus do not drive divergent development of diet-induced obesity in C57BL/6 mice,” Molecular Metabolism, vol. 2, no. 3, pp. 171–183, 2013. View at: Publisher Site | Google Scholar
  74. A. Deloris Alexander, R. P. Orcutt, J. C. Henry, J. Baker Jr., A. C. Bissahoyo, and D. W. Threadgill, “Quantitative PCR assays for mouse enteric flora reveal strain-dependent differences in composition that are influenced by the microenvironment,” Mammalian Genome, vol. 17, no. 11, pp. 1093–1104, 2006. View at: Publisher Site | Google Scholar
  75. S. Arboleya, A. Binetti, N. Salazar et al., “Establishment and development of intestinal microbiota in preterm neonates,” FEMS Microbiology Ecology, vol. 79, no. 3, pp. 763–772, 2012. View at: Publisher Site | Google Scholar

Copyright © 2015 P. Carasi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2021, as selected by our Chief Editors. Read the winning articles.