Oxidative Medicine and Cellular Longevity

Oxidative Medicine and Cellular Longevity / 2019 / Article
Special Issue

(In)Fertility and Oxidative Stress: New Insights into Novel Redox Mechanisms Controlling Fundamental Reproductive Processes

View this Special Issue

Research Article | Open Access

Volume 2019 |Article ID 9151067 | 17 pages | https://doi.org/10.1155/2019/9151067

Metformin Improves Fertility in Obese Males by Alleviating Oxidative Stress-Induced Blood-Testis Barrier Damage

Academic Editor: Elisabete Silva
Received04 Feb 2019
Revised08 May 2019
Accepted10 Jun 2019
Published10 Sep 2019

Abstract

Background/Aims. Obesity, which is related to increased oxidative stress in various tissues, is a risk factor for male infertility. Metformin is reported to have an antioxidant effect; however, the precise role of metformin in obesity-induced male infertility remains unknown. The current study is aimed at exploring the effects of metformin and characterizing its underlying mechanism in the fertility of obese males. Methods. An obese male mouse model was generated by feeding mice with a high-fat diet; then, the mice were administered metformin in water for 8 weeks. Reproductive ability, metabolic parameters, and follicle-stimulating hormone (FSH) were assessed by cohabitation, enzymatic methods, and ELISA, respectively. Damage to the integrity of the blood-testis barrier (BTB), which ensures spermatogenesis, was assessed by transmission electron microscopy and immunofluorescence with a biotin tracer. Malondialdehyde (MDA), superoxide dismutase (SOD), and reactive oxygen species (ROS) were employed for the assessments of oxidative stress. BTB-related proteins were measured by immunoblotting. Nuclear factor κB (NF-κB) was assessed by immunofluorescence. Results. High-fat-diet-fed mice presented evident lipid metabolic disturbances, disrupted BTB integrity, and decreased reproductive function. Metformin alleviated the decrease in male fertility, decreased ectopic lipid deposition in the testis, and increased serum FSH levels. A further mechanistic analysis revealed that metformin ameliorated the high-fat-diet-induced injury to the BTB structure and permeability and restored the disordered BTB-related proteins, which might be associated with an improvement in oxidative stress and a recovery of NF-κB activity in Sertoli cells (SCs). Conclusion. Metformin improves obese male fertility by alleviating oxidative stress-induced BTB damage. These findings provide new insights into the effect of metformin on various diseases and suggest future possibilities in the treatment of male infertility.

1. Introduction

Obesity is a complex metabolic disease that is determined by lifestyle factors, including environmental (food variety and intake, physical activity) and genetic factors. In recent decades, obesity has become a predominant health problem and has increased globally at an alarming rate [1]. Obesity increases the risk for hypertension, diabetes, cardiovascular disease, and some cancers [26]. Furthermore, the negative impact of obesity on the male genital system is gradually being recognized. According to clinical investigations, overweight men or men with obesity show a decline in sperm quality, an increase in sperm DNA damage, and a decrease in embryo implantation rates compared with men with normal body mass index (BMI) [710]. Additionally, animal experiments have shown that a high-fat diet can increase the male infertility rate and decrease sperm parameters [1113]. Many previous studies involving mechanistic explorations have mainly focused on the effects of obesity or a high-fat diet on germ cells or Leydig cells. However, whether and how obesity damages Sertoli cells (SCs) or the blood-testis barrier (BTB) remains unclear.

SCs nurse developing germ cells and form the BTB between opposing SCs and adjacent Sertoli-germ cells [1416]. The BTB is one of the tightest blood-tissue barriers, and it physically divides the seminiferous epithelium into the basal and apical compartments, in which different stages of germ cell development occur; these compartments are crucial to male fertility [17]. Several previous studies have demonstrated that various stimulators, such as high glucose [18], perfluorooctanesulfonate [19], cadmium [20, 21], amodiaquine [22], and bisphenol A [21], adversely affect male fertility via impairment of the BTB; however, whether obesity that is induced by a high-fat diet can provoke deleterious effects on the BTB has not been elucidated. The BTB comprises tight junctions (TJs), basal ectoplasmic specializations (basal ESs), gap junctions, and desmosomes. TJs, which coexist with basal ESs, are located between basal ESs and are reinforced by basal ESs [23]. The expression levels of TJ-related proteins (occludin and ZO-1) and basal ES-related proteins (N-cadherin and beta-catenin) are downregulated by exogenous stimulators, such as cadmium [20], perfluorooctanesulfonate [19], amodiaquine [22], and bisphenol A [24]. These studies indicate that TJs and basal ESs might be the molecular targets of exogenous stimulators.

Obesity can increase oxidative stress in the whole body [25], and an increase in testicular oxidative stress is a common feature in much of what underlies male infertility [26]. However, whether oxidative stress is involved in lipotoxicity-induced injury to SCs and the BTB is unclear. Metformin is a first-line hypoglycaemic agent. Beyond its glucose-lowering effects, metformin exhibits antioxidant properties in various tissues, an effect that is independent of its effect on insulin sensitivity, and acts to decrease lipid peroxidation [27, 28]. A recent clinical study has demonstrated for the first time that metformin improved semen quality in men with hyperinsulinaemia [29], but the underlying molecular mechanism is unclear. Moreover, a study in patients with polycystic ovarian syndrome (PCOS) has reported that metformin reduces angiogenesis through the nuclear factor κB (NF-κB) pathway [30]. However, whether metformin can improve the fertility of obese males and alleviate the damage of BTB in testis by inhibiting oxidative stress remains unknown.

In the present study, to determine the effect of metformin on fertility in obese males, an obese mouse model was induced with a high-fat diet, and metformin was administered. First, the effect of metformin on the reproductive ability of male mice was investigated. Alterations to the ultrastructure, BTB integrity, the expression of TJ proteins, and basal ES proteins were further assessed. In addition, the levels of oxidative stress and NF-κB activity were measured to characterize the intracellular mechanism. This study demonstrates a crucial role of metformin in obesity-induced male infertility.

2. Materials and Methods

2.1. Animals and Treatment

Seven-week-old C57BL/6 male mice and nine-week-old C57BL/6 female mice were obtained from the Vital River Corporation (Beijing, China) and housed in a temperature- and humidity-controlled room ( and , respectively) on a 12-hour light/dark cycle with free access to water and food. All experimental procedures were approved by the ethics committee of Shandong Provincial Hospital affiliated with Shandong University, and the methods were performed according to the approved guidelines.

As shown in Figure S1, one week after feeding to adapt to the housing conditions, the male mice were randomly divided into two groups: the normal-diet group (N, ) was fed a standard diet (Beijing Keao Xieli Feed Co. Ltd., China) in which 10% of the calories were from fat, and the high-fat-diet group (H, ) was fed a high-fat diet (product #D12492, Research Diets Inc., New Brunswick, NJ, USA) in which 60% of the calories were from fat. Ten mice from each group were sacrificed at the end of the 8th week of feeding. The remaining mice in the N group were maintained on their standard diet (NN, ), whereas the mice fed a high-fat diet () were further subdivided into two subgroups. The first subgroup (HH, ) was maintained on the high-fat diet, and the second subgroup (HH + MET, ) was maintained on the high-fat diet with ~200 mg/kg body weight/day metformin (SFDA approval number H20023371, Sino-American Shanghai Squibb Pharmaceuticals Ltd., Shanghai, China) given in the drinking water [31]. The body weights of the mice were monitored at 5 pm every week during the entire feeding period (the adaptation week and the subsequent 8 or 16 weeks). All mice were sacrificed at the end of the 16th week of feeding.

2.2. Reproductive Ability Assay

To assess the reproductive ability of the male mice, at the 7th and 15th weeks after different feeding conditions, each male mouse was individually housed and mated with two female mice, which were randomly grouped by weight, for 5 consecutive days. On the second day, vaginal plugs were inspected to determine whether coitus had occurred. Female mice with vaginal plugs were moved into another cage and observed until the pups were born. The fertility of male mice was calculated according to the number of pregnant females. The number and weights of the pups were also statistically analyzed.

2.3. Blood Collection and Tissue Removal

At the 8th and 16th week, after being fasted for 8 h, all mice were anaesthetized by intraperitoneal injection with pentobarbital (40 mg/kg body weight) and sacrificed. Blood samples were obtained, and serum was extracted by centrifugation for the lipid profile and sex hormone analyses. For long-term storage, sera were kept at -80°C. Epididymal fat and testes were obtained immediately and weighed. The testis was fixed in modified Davidson’s fluid (MDF) [32] for morphological analysis and immunofluorescence, fixed in 2.5% glutaraldehyde and 1% osmium tetroxide for ultrastructure analysis, or stored in liquid nitrogen for assessments by Oil red O staining, determination of mRNA and protein expression, and oxidative stress-related testing.

2.4. Serum Lipid Profile and Sex Hormone Analysis

The serum levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein-cholesterol (HDL-c), low-density lipoprotein-cholesterol (LDL-c), and glucose (Glu) were determined using enzymatic methods with an Olympus AU5400 automatic biochemical analyzer (Olympus Co. Ltd., Japan). The follicle-stimulating hormone (FSH) level in the serum was measured using an ELISA kit (Abnova, Taiwan, China) according to the manufacturer’s protocol for each assay.

2.5. Oil Red O Staining

To determine testicular lipid accumulation, frozen sections of the testis (10 μm) were fixed in 95% ethanol for 10 s, washed with distilled water for 10 s, stained with Oil red O (Changsha Guge Biotechnology Co. Ltd., China) for 10 min, washed again with distilled water for 10 s, and counterstained with haematoxylin for 30 s. Representative photomicrographs were captured using a microscope (Carl Zeiss, Germany).

2.6. Haematoxylin and Eosin (H&E) Staining Analysis

Testicular tissue samples were dehydrated in a graded series of ethanol solutions, embedded in paraffin, and coronally sectioned using a section cutter (Leica, USA) at a thickness of 4 μm. H&E staining was performed for morphological observation using a system incorporated in the Carl Zeiss microscope.

2.7. Testicular Transmission Electron Microscopy (TEM) Analysis

To characterize the changes in testis at the ultrastructural level, the testis was dehydrated in a progressive ethanol and acetone solution, embedded in Epon 812, sectioned using a LKB ultramicrotome (LKB Instruments Inc., Sweden), stained with uranyl acetate followed by lead citrate, observed with a JEM-1200EX Transmission Electron Microscope (JEOL, Japan), and photographed.

2.8. BTB Integrity Assay

The integrity of the BTB assessment was evaluated using a biotin tracer as described previously [19]. In short, the mice were anaesthetized, and the testes were exposed before sacrifice. The gaps below the testicular tunica albuginea were injected with 50 μl of EZ-Link Sulfo-NHS-LC-Biotin (10 mg/ml, freshly dissolved in physiological saline containing 1 mM CaCl2; Pierce Biotechnology Inc., IL, USA). After 30 min, the animals were euthanized, and their testes were frozen in liquid nitrogen in preparation for cryosectioning (10 μm). The sections were fixed in 4% paraformaldehyde (PFA) for 20 min, washed with phosphate-buffered saline with 0.1% Tween20 (PBST) three times, blocked in 0.01 M phosphate buffer solution (PBS) containing 15% goat serum (Zhongshan Jinqiao Biotechnology Co. Ltd., China) and 1% bovine serum albumin (BSA, wt/vol) for 1 h, incubated with Alexa Fluor® 568-conjugated streptavidin (Life Technologies Corp.-Invitrogen, CA, USA) and 4-6-diamidino-2-phenylindole (DAPI, blue) (Invitrogen, UK) for 2 h at room temperature, and washed again with PBST five times (5 min per time). After mounting with antifade mounting medium P0128 (Beyotime Biotechnology, China), the sections were analyzed by fluorescence microscopy (Axio Imager A2, Carl Zeiss, Germany).

2.9. Immunoblotting Analysis

Frozen testes were lysed in RIPA buffer with a protease inhibitor cocktail, PMSF and sodium orthovanadate (Santa Cruz Biotechnology Inc., CA, USA), to extract the whole protein. The cytosol and nuclear protein were obtained using the Nuclear and Cytoplasmic Protein Extraction Kit (CWBIO, China) according to the manufacturer’s instructions. The protein concentration was quantified using a BCA protein assay kit (Pierce Biotechnology Inc., IL, USA). A total of 120 μg whole protein or 60 μg nucleoprotein lysates was resolved by SDS-PAGE using 8% denaturing polyacrylamide gel, electrotransferred to a PVDF membrane (Millipore, America), and blotted with specific antibodies, namely, anti-ZO-1, anti-occludin, anti-N-cadherin, anti-beta-catenin, anti-nectin2, and anti-NF-κB/p65, with anti-beta-actin or anti-LaminB1 as a loading control for cytosolic proteins or nuclear proteins, respectively. The appropriate secondary antibodies conjugated to horseradish peroxidase (HRP) (Amersham, Little Chalfont Bucks, UK) were used at a 1 : 5000 dilution. The membranes were visualized using the HyGLO HRP detection kit (Denville, NJ, USA). The antibodies are shown in Table 1.


AntibodySpeciesDilutionCorporationCatalogue number

ZO-1Rabbit1 : 50Thermo Fisher Scientific40-2200
OccludinRabbit1 : 62.5Thermo Fisher Scientific71-1500
N-cadherinRabbit1 : 500Proteintech Group Inc.13769-1-AP
beta-CateninRabbit1 : 1000Proteintech Group Inc.51067-2-AP
Nectin2Rabbit1 : 10000AbcamAb135246
NF-κB/p65Rabbit1 : 2500Abcamab32536
beta-ActinRabbit1 : 7500Proteintech Group Inc.60008-1
LaminB1Mouse1 : 7500Proteintech Group Inc.66095-1

2.10. Isolation of RNA and Real-Time Polymerase Chain Reaction (PCR) Analysis

Total RNA was isolated from the tissues using an RNeasy Total RNA Isolation Kit (TaKaRa Bio Inc., Japan) and reverse-transcribed into cDNA (TaKaRa Bio Inc., Japan). Then, SYBR Green (DBI, Germany) quantitative PCR analysis reactions were performed using the Roche LightCycler 480 Detection System (Roche, Belgium). Each reaction comprised 10 μl of SYBR Green, 1 μl of cDNA, 1 μl of each primer pair (10 μmol/μl), and 8 μl of distilled water. The beta-actin gene was simultaneously detected as an endogenous reference. The relative gene expression levels were quantified using the method, and the results are expressed as the fold change relative to the endogenous reference. The primer sequences are listed in Table 2.


GeneSpeciesForward primerReverse primer

ZO-1MouseGCCGCTAAGAGCACAGCAATCCCCACTCTGAAAATGAGGA
OccludinMouseTTGAAAGTCCACCTCCTTACAGACCGGATAAAAAGAGTACGCTGG
N-cadherinMouseAGCGCAGTCTTACCGAAGGTCGCTGCTTTCATACTGAACTTT
beta-CateninMouseCCCAGTCCTTCACGCAAGAGCATCTAGCGTCTCAGGGAACA
Nectin2MouseGCATCATTGGAGGTATTATCGCTGAGGGAGGTCCTTCCAGTTC
NF-κB/p65MouseCGGGATGGCTACTATGAGGCCGTGAAAGGGGTTATTGTTGGT
beta-ActinMouseGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT

2.11. Malondialdehyde (MDA), Superoxide Dismutase (SOD), and Reactive Oxygen Species (ROS) Measurements

Assay kits for MDA and SOD were provided by Beyotime Biotechnology (China), and an assay kit for ROS was provided by Nanjing Jiancheng Bioengineering Institute (China). The MDA content, SOD activity, and ROS levels were measured using the kits according to the manufacturer’s instructions, and these measurements were normalized to total protein.

2.12. Immunofluorescence

The testicular tissues were fixed with MDF and embedded in paraffin blocks. The sections were deparaffinized, and antigen retrieval was performed with Tris-EDTA (). After blocking with 10% normal goat or donkey serum (Zhongshan Jinqiao Biotechnology Co. Ltd., China) for 60 min at room temperature, the slides were incubated overnight at 4°C with ZO-1 (1 : 25) or NF-κB/p65 (1 : 250) primary antibody. For the negative control, 0.01 mol/l PBS was added instead of the primary antibody. The tissues were then incubated with the Alexa Fluor® 488F (ab) 2 fragment of goat anti-rabbit IgG (H+L) (Thermo Fisher Scientific, USA) or with a donkey anti-Rabbit IgG (H+L) highly cross-absorbed secondary antibody, namely, Alexa Fluor® 555 (Thermo Fisher Scientific, USA) at a 1 : 1000 dilution at room temperature for 1 h. The nuclei were stained with DAPI, and the coverslips were sealed to the microscope slides using the mounting medium P0128. The specimens were imaged under a Carl Zeiss fluorescence microscope.

2.13. Statistical Analyses

Significant differences between the obtained values () were determined by an independent sample -test or one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) multiple comparison test. A value of <0.05 was considered significant.

3. Results

3.1. High-Fat Diet Increases Body Weight, Induces Abnormalities in Glucose and Lipid Metabolism, and Downregulates Fertility in Male Mice

To evaluate the effect of a high-fat diet on the general characteristics and fertility of the mice, some mice were sacrificed after 8 weeks of feeding, and relevant parameters were examined. As shown in Figure 1(a), male C57BL/6 mice fed the high-fat diet gained significantly more body weight than the mice fed a normal diet ( vs. , ), which is consistent with the general pictures shown in Figure 1(b). Accompanied by weight gain, there was a significant increase of epididymal adipose in high-fat-diet mice ( vs. , , Figure 1(d)), although there was no change in testicular weight (Figure 1(c)). These findings demonstrated that an obese mouse model induced with a high-fat diet was successfully established.

Obesity is often accompanied by dyslipidaemia [33], which is defined as an increase of plasma TG and LDL-c or a decrease of plasma HDL-c [33, 34], or by hyperglycaemia [35]. Thus, the serum lipid profile and Glu in the obese mouse model were assessed. The results showed that the serum Glu levels and serum TC, HDL-c, and LDL-c in the high-fat-diet-fed mice increased significantly relative to those in the normal-diet-fed mice (Glu, vs. ; TC, vs. ; HDL-c, vs. ; LDL-c, vs. , ), but there was no difference in serum TG (Figures 1(e) and 1(f)). These alterations are consistent with the results during the 16th week of feeding (Figures 2(e) and 2(f)). These results indicated that glucose and lipid metabolism was highly disrupted in the high-fat-diet-induced obese mouse model.

FSH regulates spermatogenesis and the function of SCs in mammals. To analyze whether the high-fat diet affects FSH, the level of serum FSH was measured. As shown in Figure 1(g), the serum FSH levels were lower in the high-fat-diet-fed mice than in the normal-diet-fed mice ( vs. , ). These results indicated that FSH was abnormal in the high-fat-diet-induced obese mouse model.

To further assess the effect of the high-fat diet on the fertility of the male mice, the reproductive abilities of the male mice with different diets were assessed via cohabitation with female mice. No difference in the fertility rate or the number of pups per litter was observed between the high-fat-diet-fed mice and the normal-diet-fed mice (Figures 1(h) and 1(i)). The average pup weight of the offspring of the high-fat-diet-fed mice was significantly lower than that of the offspring of the normal-diet-fed mice ( vs. , , Figure 1(j)), suggesting that a high-fat diet might affect the offspring’s size.

3.2. Metformin Ameliorates the Decrease in Male Fertility Caused by a High-Fat Diet Independently of the Regulation of Serum Glucose and Lipids

To investigate the effect of metformin on male fertility, the general characteristics, serum parameters, and fertility of mice were assessed after another 8 weeks of oral administration of metformin. As shown in Figures 2(a) and 2(b), the body weight of the oral metformin group did not decrease compared with that of the group fed the high-fat diet alone. Consistent with the body weight, there were no differences in the testicular and epididymal adipose weights between the high-fat-diet group and the oral metformin group (Figures 2(c) and 2(d)). These results indicated that metformin did not ameliorate the weight gain or epididymal adipose accumulation caused by the high-fat diet during the additional 8 weeks of dosing. During the 16th week, serum Glu, TC, HDL-c, and LDL-c levels were increased significantly in the high-fat-diet-fed mice relative to those in the normal-diet-fed mice (Glu, vs. ; TC, vs. ; HDL-c, vs. ; LDL-c, vs. , ), whereas these parameters did not differ between the high-fat-diet-fed mice and the oral metformin mice except HDL-c (a kind of “positive” cholesterol) [33, 36] ( vs. , , Figures 2(e) and 2(f)). These results indicated that metformin did not improve glucose and “adverse” serum lipid [33] metabolism at the present dosage and duration. However, compared with the serum FSH levels of the high-fat-diet-fed mice, those of the oral metformin mice were restored to normal levels ( vs. , ) (Figure 2(g)). Intriguingly, although low-dosage metformin had no effect on high-fat-diet-induced dyslipidaemia or glucose, the reproductive ability assay showed that the fertility rate and number of pups per litter in the oral metformin group were significantly higher than those in the high-fat-diet group (fertility rate, vs. ; number of pups per litter, vs. , ) and close to the normal level (Figures 2(h) and 2(i)). These results indicated that the decline in male fertility induced by a high-fat diet could be ameliorated through metformin treatment that independently regulated serum glucose and adverse lipids.

3.3. Metformin Improves High-Fat-Diet-Induced Testicular Lipid Deposition and Morphological Abnormalities

To determine the effect of the high-fat diet on lipid content in the testis, Oil red O staining was performed to visualize lipid deposition in the same cycle of the seminiferous epithelium. The testis sections of the high-fat-diet-fed mice exhibited abundant lipid content, mainly in the interstitial portion, and the lipid ectopic accumulation in seminiferous tubules was also increased. The testicular lipid deposition in seminiferous tubules of the oral metformin mice was clearly lower than that in the high-fat-diet-fed mice ( vs. , ) (Figures 3(a) and 3(b)). These observations indicated that prior to the improvements in serum lipids and glucose, treatment with metformin alleviated ectopic lipid deposition in the testis.

To further assess the changes in the seminiferous tubules following exposure to a high-fat diet and oral metformin in mice, testicular morphology was analyzed by H&E staining. As shown in Figure 3(c), the seminiferous epithelia in the high-fat-diet group were severely disorganized, and cell adhesion between SCs and spermatogenic cells was disrupted and loosely arranged. After treatment with oral metformin, the spermatogenic epithelial morphology was improved, and the adhesion between cells was similar to that between cells in the normal-diet group. These findings demonstrated that metformin improved the high-fat-diet-induced disruption in the general structure of the seminiferous tubules.

3.4. Metformin Repairs the BTB Integrity Disruption Induced by a High-Fat Diet

The integrated BTB structure is one of the tightest blood-tissue barriers in the body, and it is crucial for maintaining cell adhesion between the opposing SCs and adjacent Sertoli-germ cells. To characterize the BTB morphology at the ultrastructural level, a TEM analysis of the testis from each group of mice was performed. As depicted in Figure 4(a), the BTBs in the normal-diet-fed mice and oral metformin mice were lined with endoplasmic reticulum (ER) cisternae and clearly delimited, continuous, and tight. In contrast, the cell junctions adjoining SCs appeared discontinuous and dehisced in the seminiferous tubules from the high-fat-diet-fed mice. These data showed that metformin repaired the injured integrity of the BTB, which was compromised severely by the high-fat diet. Furthermore, ER expansion and increased proteins alongside the BTB were found in the high-fat-diet-fed mice. The black particles beside the TJs, appearing as a net-like meshwork, represent polymers of interacting junctional transmembrane proteins [37]. These results indicated the possible existence of ER stress and the abnormal expression of BTB-related proteins.

Next, to further explore the effect of lipotoxicity on BTB integrity and the effect of metformin in the process, we analyzed BTB integrity with a biotin tracer (Figures 4(b) and 4(c)). In normal testes, junctions between the Sertoli-Sertoli and Sertoli-spermatid interfaces formed tight barriers that prevented large molecules from passing through. However, the BTB was opened after 16 weeks on the high-fat diet. Red fluorescent dye that was injected into the interstitium of the testes diffused into the BTB and appeared abundantly in the adluminal compartment. Additionally, only a small amount of red fluorescence appeared in the adluminal compartment of the HH+MET mice ( vs. , ) (Figure 4(b), HH vs. HH+MET). These results indicated that the integrity of the BTB in the testes of the high-fat-diet-fed mice was indeed disrupted and metformin essentially repaired this disruption.

3.5. Metformin Recovers the Disruption in Junction Protein Expression Induced by a High-Fat Diet

The integrity of the BTB is based on various junction proteins that form coexisting TJs and ectoplasmic specializations. To further verify the damage to the BTB induced by the high-fat diet and the protective effect of metformin, the mRNA and protein levels of BTB-related molecules were detected on the 16th week. Compared with the levels in the testis of the normal-diet group, although there was no significant change in the mRNA levels, TJ integral membrane proteins including ZO-1 and occludin were upregulated significantly in the testis of the high-fat-diet group (ZO-1, vs. , ; occludin, vs. , ). Metformin improved the abnormal protein expression of ZO-1 and occludin (ZO-1, vs. , ; occludin, vs. , ) (Figures 5(a)5(c)). These results indicated that the modification of ZO-1 and occludin protein synthesis might be related to the protective effect of metformin on BTB damage induced by a high-fat diet.

In addition to the abnormalities in junction protein expression, the localization of the junction protein on the BTB affects the function of the BTB. To further verify the expression and localization of junction proteins on the BTB in testicular SCs, immunofluorescence of ZO-1 was performed. The high-fat diet increased ZO-1 accumulation on the BTB; metformin recovered the increase in ZO-1 on the BTB (Figure 5(d)), which was consistent with testicular ultrastructure and immunoblotting analyses of the testis. However, the localization of ZO-1 on the BTB was unaltered.

3.6. Metformin Suppresses the Oxidative Stress Level in the Testis via Inhibition of NF-κB/p65 Activity in SC Nuclei

Obesity can increase oxidative stress in the whole body [25], and an increase in testicular oxidative stress is a common feature in much of what underlies male infertility [26]. Therefore, to evaluate whether metformin improves male mouse fertility by alleviating oxidative stress, testicular oxidative stress-related indexes were assessed in each group on the 16th week, and the indexes included MDA, an index of lipid peroxidation and one of the commonly used biomarkers of oxidative stress [38]; SOD, a type of scavenger of oxygen radicals [39] and a type of critical antioxidant enzyme that protects cells from oxidative stress [40]; and ROS, a kind of oxidative stress inducer species. As shown in Figure 6(a), although there was no difference in SOD activity, the fluorescence intensity of ROS was significantly higher in the testes of the high-fat-diet-fed mice than in those of the normal-diet-fed mice ( vs. , ). In the testes of the oral metformin mice, the fluorescence intensity of ROS ( vs. , ) and concentration of MDA ( vs. , ) significantly decreased to the normal level. These results indicated that metformin alleviated high-fat-diet-induced excess oxidative stress in the testes.

Oxidative stress leads to inflammation, a process that is most strongly influenced by the level of oxidative stress and mediated primarily by NF-κB, which is a proinflammatory factor. To further verify whether NF-κB was involved in the process, the protein in nuclei and mRNA expression levels of NF-κB/p65 in the testis were assessed. Metformin treatment resulted in a significant decrease of the expression level of NF-κB/p65 in the whole testis ( vs. and vs. , ) (Figures 6(c) and 6(d)). However, high-fat diet and metformin did not affect NF-κB/p65 mRNA expression in the whole testicular tissue (Figure 6(b)). NF-κB is normally located in the cytoplasm, and activated NF-κB localizes to the nucleus. To further represent the level of NF-κB/p65 in SC nuclei, NF-κB expression in SC nuclei was detected through an immunofluorescence method using cross-sections of deparaffinized testes. As shown in Figure 6(e), red fluorescence in the SC nuclei represents activated NF-κB. The greatest abundance of activated NF-κB in the SC nuclei existed in the high-fat-diet-fed mice, and the abundance in the oral metformin mice was similar to that in the normal-diet-fed mice. These results indicated that metformin reduced the expression of NF-κB/p65 in the SC nuclei, which might be related to the reduction in excess oxidative stress in the testes induced by the high-fat diet.

4. Discussion

Obesity, which is associated with male infertility, has increased dramatically worldwide. Metformin, a commonly used hypoglycaemic agent, has been shown to play roles in nondiabetic diseases through antioxidant effects. However, whether metformin can improve the damage to male fertility caused by obesity remains unclear. In this study, by constructing a high-fat-diet-induced obese male mouse model and administering metformin in water, we demonstrated that metformin reduced the high level of oxidative stress in the testis of high-fat-diet-fed obese mice before improvements in serum glucose and adverse lipids. In addition to the improvements in oxidative stress in the testis, the disrupted expression of junction proteins was ameliorated, the injured structure and integrity of the BTB were amended, and fertility was improved by metformin. These results suggested that metformin improved the reproductive function of obese male mice via an antioxidant effect independently of its regulation of serum glucose and lipids.

Metformin, a widely used medicine for the treatment of type 2 diabetes mellitus, has extensive protective effects on many organs and cells, such as the vessels, heart, brain, and ovaries [4144]. Moreover, metformin can improve the reproductive function of obese females among patients with PCOS in clinical applications [45]. However, the role of metformin in the male gonads is controversial. An in vitro study has demonstrated that metformin played a beneficial role in energy metabolism in SCs [46]. Furthermore, metformin stimulates alanine production in SCs, inducing antioxidant activity and maintaining the NADH/NAD+ equilibrium. However, other studies have reported that metformin might disrupt normal testicular physiological processes, leading to spermatogenic failure [47]. These are indeed crucial results demonstrating the detrimental effects of metformin, which are apparently contradictory to the results presented here. Apart from the experimental methods used, the results of the previous study were obtained from healthy animals with apparently normal serum glucose and lipid metabolism. However, in our study, the effect of metformin was analyzed under hyperlipidaemic and hyperglycaemic conditions during adulthood in mice, which may explain the conflicting results when compared with other research.

The negative impact of obesity on the male genital system is gradually being recognized. Obesity-induced decreases in male fertility have been demonstrated in animal models and clinical investigations, and abnormalities in pituitary-gonadal axis hormones have been demonstrated in morbidly obese men [48, 49]. In our study, the high-fat diet resulted in decreased fertility in obese male mice, and further experiments demonstrated that the decreased fertility was accompanied by abnormalities in lipid metabolism and sex hormones. Apart from dyslipidaemia in obese male mice, ectopic lipid accumulation was abundant in the testicular interstitium, and some of the lipids penetrated the basement membrane and deposited ectopically in the basement compartment of the seminiferous tubules; the structure and integrity of the BTB were destroyed. This result demonstrates that lipotoxicity indeed injured the BTB, and the testis/seminiferous tubules were in a lipotoxic microenvironment. Of note, testicular lipid deposition did not increase testicular weight, which might be due to organ specificity of the testis or high-fat diet for a short period of time. In male peripheral gonads, lipid accumulation mainly deposited in the epididymis and surrounded testis, and a longer-term high-fat diet will be given in further study. Metformin played a substantial role in regulating lipid metabolism, and the 8-week treatment with metformin markedly reduced the ectopic lipid deposition in the testis; however, serum glucose and adverse lipids were not influenced significantly, which might be due to the lower dosage of metformin. Relative to the dose of metformin (200 mg/kg/d) used in this experiment, the dosage for humans suggested in the control of diabetes is 2000 mg/d (); correspondingly, the dosage of metformin that might reduce serum glucose in male mice should be 260 mg/kg/d (). To further verify this speculation, a higher dosage of metformin will be administered in further study. However, the data also suggest that metformin prioritizes the adjustment of lipid metabolism in the testicular tissue before regulating serum glucose and lipids. In addition to abnormalities in lipid metabolism, changes in gonadotropin levels were also analyzed; FSH, which decreased significantly in the high-fat-diet-fed mice, plays an important role in spermatogenesis via the FSH receptor (FSHR) [50]. With the decline in FSH, fertility decreased and the BTB was impaired in the high-fat-diet-fed mice. Fertility and the integrity of BTB were recovered with the increase in FSH in the mice-administered metformin. These results indicate that a high-fat diet has a detrimental effect on pituitary gonadotropin FSH, which might also occur via lipotoxicity in the pituitary. Metformin, in addition to directly affecting the peripheral target gonad, can improve reproductive capacity by regulating the centre of the gonadal axis.

Previous studies on the mechanisms of male fertility have mainly focused on sperm parameters, Leydig cells, or reproductive hormones [9, 5153]. The function of the SCs was overlooked. SCs provide nutrition and BTB support in spermatogenesis. Disrupting BTB integrity harms the reproductive system and results in reproductive dysfunction [19, 54]. As mentioned above, in the high-fat-diet-fed mice, abundant lipids were deposited ectopically in the testicular interstitium, and some lipids were deposited ectopically in the seminiferous tubules, indicating lipotoxicity in the testis or seminiferous tubules. In the high-fat-diet-fed mice, the expression of TJ-related proteins (ZO-1 and occludin) increased significantly, which were basically consistent with the previous studies [55]. Morgan et al. [55] found that the upregulation of ZO-1 and occludin was a compensation for BTB damage. Such changes might be an adaptive change because SCs increasingly synthesize tight-junction proteins and attempt to repair the dehiscent BTB. Disordered junction protein expression leads to injury to the structure and integrity of the BTB. TJ-associated proteins may be the targets of lipotoxicity, and this is consistent with previous studies of the effects of other exogenous stimulators on SC BTB, such as perfluorooctanesulfonate, cadmium, amodiaquine, and bisphenol A [1922, 24]. In oral metformin mice, lipid accumulation in the testicular interstitium and seminiferous tubules decreased dramatically. In addition, with a concomitant decrease in ectopic lipid deposition, the disordered junction protein expression, damaged structure, and integrity of the BTB were ameliorated, and the decrease in fertility was resolved. These results indicate that metformin can directly regulate testicular lipid metabolism and hence reverse the injury to the BTB, improving decreased fertility.

Metformin has antioxidant properties. Previous studies have demonstrated that metformin can reduce ROS [56] and that, partly by reducing oxidative stress inducer species, metformin can confer health and lifespan benefits to laboratory mice and C. elegans [57, 58]. The high-fat-diet-fed mice exhibited decreased reproductive function together with increased ROS. Previous studies have demonstrated that hydrogen peroxide, the most abundant ROS in pathophysiology, can reduce the expression of occludin, a marker TJ protein and a principal target of redox processes, in cultured MDCK-II cells and that O2- can decrease occludin expression in cultured brain endothelial cells [59]. ROS also modulates the patterns of gene expression through functional alterations to transcription factors, such as NF-κB [60]. NF-κB activation is required in TNF-α-downregulated ZO-1 expression in the intestinal TJ barrier [61], and NF-κB inhibitors (caffeic acid phenethyl ester) can recover the decreased expression of occludin and ZO-1 induced by methotrexate in the intestinal barrier [62]. In other words, NF-κB is involved in the regulation of the expression of TJ-related proteins in other blood-tissue barriers and may regulate the expression of BTB-related proteins. Likewise, our data demonstrate that the level of ROS is significantly higher in high-fat-diet-fed mice than in normal-diet-fed mice and that NF-κB is activated abundantly in high-fat-diet-fed mice compared with normal-diet-fed mice. Thus, the activated ROS-NF-κB signalling pathway might be a contributor to high-fat-diet-induced BTB damage. Inhibition of NF-κB signalling represents a viable strategy for disease therapy [63]. The levels of ROS and the abundance of activated NF-κB/p65 in SC nuclei were significantly lower in the mice administered metformin than in the high-fat-diet-fed mice. This indicates that treatment with metformin reduces ROS levels, inhibits the activity of NF-κB in SC nuclei, likely ameliorates lipotoxicity-induced disruption of BTB-associated proteins, and further repairs the structure and integrity of the BTB, upregulating the decrease in the fertility of obese male mice. All of these observations point towards crosstalk between an ROS-NF-κB mediator and the intervening role of metformin in determining BTB function in a testicular fat ectopic accumulation microenvironment. The studies performed by Bonnefont-Rousselot et al. [64] and Esteghamati et al. [65] demonstrated that metformin has a remarkable effect on oxidative stress. Our study further demonstrated that metformin inhibits the activity of NF-κB in the SC nuclei of obese male mice and hence exerts a beneficial effect on the BTB.

5. Conclusion

In summary, the results of this study confirm that a high-fat diet causes abnormalities in glucose and lipid metabolism and serum FSH, increases oxidative stress, and disrupts BTB integrity in the testis, harming the reproductive system. Treatment with metformin decreases ectopic lipid accumulation in the testis, reduces the levels of oxidative stress, ameliorates the high-fat-diet-induced injury to the BTB, and improves fertility in obese male mice. The ROS-NF-κB pathway may be a mechanism of metformin in this protective process (a diagram is shown in Figure 7). However, the mechanism of metformin is highly complex, and further studies are needed, including an examination of the mechanism underlying the effects of metformin on pituitary gonadotropin FSH and NF-κB signalling. These results are important evidence of the beneficial effects of metformin on infertility in obese males and provide an effective treatment option for male infertility in obese men. Clinical trials will be analyzed to further confirm the beneficial effects of metformin on the fertility of obese men.

Abbreviations

FSH:Follicle-stimulating hormone
BTB:Blood-testis barrier
MDA:Malondialdehyde
SOD:Superoxide dismutase
ROS:Reactive oxygen species
NF-κB:Nuclear factor κB
SCs:Sertoli cells
BMI:Body mass index
TJs:Tight junctions
Basal ESs:Basal ectoplasmic specializations
PCOS:Polycystic ovarian syndrome
MDF:Modified Davidson’s fluid
TC:Total cholesterol
TG:Triglycerides
HDL-c:High-density lipoprotein-cholesterol
LDL-c:Low-density lipoprotein-cholesterol
Glu:Glucose
H&E:Haematoxylin and eosin
TEM:Testicular transmission electron microscopy
PFA:Paraformaldehyde
PBST:Phosphate-buffered saline with 0.1% Tween20
PBS:Phosphate buffer solution
BSA:Bovine serum albumin
DAPI:4-6-Diamidino-2-phenylindole
HRP:Horseradish peroxidase
PCR:Polymerase chain reaction
ER:Endoplasmic reticulum
FSHR:FSH receptor.

Data Availability

The data used to support the findings of this study are included within the article.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Authors’ Contributions

The work presented here was conducted in collaboration with all authors. Jifeng Ye performed the experiments and wrote the main manuscript. Mingqi Sun and Dandan Luo prepared the animals. Xiaolin Xu and Xiaohui Su detected the serum parameters. Zhenhua Tian and Meijie Zhang assisted in sorting out information. Chunxiao Yu designed the experiments and wrote the main manuscript. Qingbo Guan designed the experiments. All authors reviewed the manuscript.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation (81770860, 81471078, and 81641030) and the Key Research and Development Plan of Shandong Province (2016GSF201007).

Supplementary Materials

Figure S1: the flowchart of the animal experiments. One week after feeding to adapt to the housing conditions, the male mice were randomly divided into two groups: the normal-diet group (N, ) was fed a standard diet, and the high-fat-diet group (H, ) was fed a high-fat diet. Ten mice from each group were sacrificed at the end of the 8th week of feeding. The remaining mice in the N group were maintained on their standard diet (NN, ), whereas the mice fed a high-fat diet () were further subdivided into two subgroups. The first subgroup (HH, ) was maintained on the high-fat diet, and the second subgroup (HH + MET, ) was maintained on the high-fat diet with ~200 mg/kg body weight/day metformin given in the drinking water. (Supplementary Materials)

References

  1. World Health Organization, “Obesity and overweight,” 2017, Fact sheet no. 311 http://www.who.int/mediacentre/factsheets/fs311/en/. View at: Google Scholar
  2. R. de Mutsert, Q. Sun, W. C. Willett, F. B. Hu, and R. M. van Dam, “Overweight in early adulthood, adult weight change, and risk of type 2 diabetes, cardiovascular diseases, and certain cancers in men: a cohort study,” American Journal of Epidemiology, vol. 179, no. 11, pp. 1353–1365, 2014. View at: Publisher Site | Google Scholar
  3. I. Ponce-Garcia, M. Simarro-Rueda, J. A. Carbayo-Herencia et al., “Prognostic value of obesity on both overall mortality and cardiovascular disease in the general population,” PLoS One, vol. 10, no. 5, article e0127369, 2015. View at: Publisher Site | Google Scholar
  4. T. J. Kim, H. Y. Shin, Y. Chang et al., “Metabolically healthy obesity and the risk for subclinical atherosclerosis,” Atherosclerosis, vol. 262, pp. 191–197, 2017. View at: Publisher Site | Google Scholar
  5. E. M. Cespedes Feliciano, C. H. Kroenke, J. A. Meyerhardt et al., “Metabolic dysfunction, obesity, and survival among patients with early-stage colorectal cancer,” Journal of Clinical Oncology, vol. 34, no. 30, pp. 3664–3671, 2016. View at: Publisher Site | Google Scholar
  6. J. M. Genkinger, C. M. Kitahara, L. Bernstein et al., “Central adiposity, obesity during early adulthood, and pancreatic cancer mortality in a pooled analysis of cohort studies,” Annals of Oncology, vol. 26, no. 11, pp. 2257–2266, 2015. View at: Publisher Site | Google Scholar
  7. C. Dupont, C. Faure, N. Sermondade et al., “Obesity leads to higher risk of sperm DNA damage in infertile patients,” Asian Journal of Andrology, vol. 15, no. 5, pp. 622–625, 2013. View at: Publisher Site | Google Scholar
  8. N. Sermondade, C. Faure, L. Fezeu et al., “BMI in relation to sperm count: an updated systematic review and collaborative meta-analysis,” Human Reproduction Update, vol. 19, no. 3, pp. 221–231, 2013. View at: Publisher Site | Google Scholar
  9. J. Samavat, I. Natali, S. Degl’Innocenti et al., “Acrosome reaction is impaired in spermatozoa of obese men: a preliminary study,” Fertility and Sterility, vol. 102, no. 5, pp. 1274–1281.e2, 2014. View at: Publisher Site | Google Scholar
  10. A. Soubry, L. Guo, Z. Huang et al., “Obesity-related DNA methylation at imprinted genes in human sperm: results from the TIEGER study,” Clinical Epigenetics, vol. 8, no. 1, p. 51, 2016. View at: Publisher Site | Google Scholar
  11. H. W. Bakos, M. Mitchell, B. P. Setchell, and M. Lane, “The effect of paternal diet-induced obesity on sperm function and fertilization in a mouse model,” International Journal of Andrology, vol. 34, 5, part 1, pp. 402–410, 2011. View at: Publisher Site | Google Scholar
  12. C. D. B. Fernandez, F. F. Bellentani, G. S. A. Fernandes et al., “Diet-induced obesity in rats leads to a decrease in sperm motility,” Reproductive Biology and Endocrinology, vol. 9, no. 1, p. 32, 2011. View at: Publisher Site | Google Scholar
  13. N. O. Palmer, H. W. Bakos, J. A. Owens, B. P. Setchell, and M. Lane, “Diet and exercise in an obese mouse fed a high-fat diet improve metabolic health and reverse perturbed sperm function,” American Journal of Physiology-Endocrinology and Metabolism, vol. 302, no. 7, pp. E768–E780, 2012. View at: Publisher Site | Google Scholar
  14. W. Y. Liu, Z. B. Wang, L. C. Zhang, X. Wei, and L. Li, “Tight junction in blood-brain barrier: an overview of structure, regulation, and regulator substances,” CNS Neuroscience & Therapeutics, vol. 18, no. 8, pp. 609–615, 2012. View at: Publisher Site | Google Scholar
  15. D. Günzel and A. S. L. Yu, “Claudins and the modulation of tight junction permeability,” Physiological Reviews, vol. 93, no. 2, pp. 525–569, 2013. View at: Publisher Site | Google Scholar
  16. E. A. Runkle and D. Mu, “Tight junction proteins: from barrier to tumorigenesis,” Cancer Letters, vol. 337, no. 1, pp. 41–48, 2013. View at: Publisher Site | Google Scholar
  17. P. T. K. Saunders, “Germ cell-somatic cell interactions during spermatogenesis,” Reproduction Supplement, vol. 61, pp. 91–101, 2003. View at: Google Scholar
  18. M. G. Alves, A. D. Martins, J. E. Cavaco, S. Socorro, and P. F. Oliveira, “Diabetes, insulin-mediated glucose metabolism and Sertoli/blood-testis barrier function,” Tissue Barriers, vol. 1, no. 2, article e23992, 2013. View at: Publisher Site | Google Scholar
  19. Y. Lu, B. Luo, J. Li, and J. Dai, “Perfluorooctanoic acid disrupts the blood-testis barrier and activates the TNFα/p38 MAPK signaling pathway in vivo and in vitro,” Archives of Toxicology, vol. 90, no. 4, pp. 971–983, 2016. View at: Publisher Site | Google Scholar
  20. C. de Angelis, M. Galdiero, C. Pivonello et al., “The environment and male reproduction: the effect of cadmium exposure on reproductive function and its implication in fertility,” Reproductive Toxicology, vol. 73, pp. 105–127, 2017. View at: Publisher Site | Google Scholar
  21. D. D. Mruk and C. Y. Cheng, “Environmental contaminants: is male reproductive health at risk?” Spermatogenesis, vol. 1, no. 4, pp. 283–290, 2011. View at: Publisher Site | Google Scholar
  22. Y. R. Niu, B. Wei, B. Chen et al., “Amodiaquine-induced reproductive toxicity in adult male rats,” Molecular Reproduction and Development, vol. 83, no. 2, pp. 174–182, 2016. View at: Publisher Site | Google Scholar
  23. C. Y. Cheng and D. D. Mruk, “The blood-testis barrier and its implications for male contraception,” Pharmacological Reviews, vol. 64, no. 1, pp. 16–64, 2012. View at: Publisher Site | Google Scholar
  24. A. T. A. G. de Freitas, M. A. Ribeiro, C. F. Pinho, A. R. Peixoto, R. F. Domeniconi, and W. R. Scarano, “Regulatory and junctional proteins of the blood-testis barrier in human Sertoli cells are modified by monobutyl phthalate (MBP) and bisphenol A (BPA) exposure,” Toxicology In Vitro, vol. 34, pp. 1–7, 2016. View at: Publisher Site | Google Scholar
  25. A. Munoz and M. Costa, “Nutritionally mediated oxidative stress and inflammation,” Oxidative Medicine and Cellular Longevity, vol. 2013, Article ID 610950, 11 pages, 2013. View at: Publisher Site | Google Scholar
  26. T. T. Turner and J. J. Lysiak, “Oxidative stress: a common factor in testicular dysfunction,” Journal of Andrology, vol. 29, no. 5, pp. 488–498, 2008. View at: Publisher Site | Google Scholar
  27. P. Faure, E. Rossini, N. Wiernsperger, M. J. Richard, A. Favier, and S. Halimi, “An insulin sensitizer improves the free radical defense system potential and insulin sensitivity in high fructose-fed rats,” Diabetes, vol. 48, no. 2, pp. 353–357, 1999. View at: Publisher Site | Google Scholar
  28. G. Kanigür-Sultuybek, M. Güven, İ. Onaran, V. Tezcan, A. Cenani, and H. Hatemi, “The effect of metformin on insulin receptors and lipid peroxidation in alloxan and streptozotocin induced diabetes,” Journal of Basic and Clinical Physiology and Pharmacology, vol. 6, no. 3-4, pp. 271–280, 1995. View at: Publisher Site | Google Scholar
  29. E. Bosman, A. D. Esterhuizen, F. A. Rodrigues, P. J. Becker, and W. A. Hoffmann, “Effect of metformin therapy and dietary supplements on semen parameters in hyperinsulinaemic males,” Andrologia, vol. 47, no. 9, pp. 974–979, 2015. View at: Publisher Site | Google Scholar
  30. B. K. Tan, R. Adya, J. Chen et al., “Metformin decreases angiogenesis via NF-κB and Erk1/2/Erk5 pathways by increasing the antiangiogenic thrombospondin-1,” Cardiovascular Research, vol. 83, no. 3, pp. 566–574, 2009. View at: Publisher Site | Google Scholar
  31. Y. Wu, F. Wang, M. Fu, C. Wang, M. J. Quon, and P. Yang, “Cellular stress, excessive apoptosis, and the effect of metformin in a mouse model of type 2 diabetic embryopathy,” Diabetes, vol. 64, no. 7, pp. 2526–2536, 2015. View at: Publisher Site | Google Scholar
  32. J. R. Latendresse, A. R. Warbrittion, H. Jonassen, and D. M. Creasy, “Fixation of testes and eyes using a modified Davidson’s fluid: comparison with Bouin’s fluid and conventional Davidson’s fluid,” Toxicologic Pathology, vol. 30, no. 4, pp. 524–533, 2002. View at: Publisher Site | Google Scholar
  33. B. K. Kit, M. D. Carroll, D. A. Lacher, P. D. Sorlie, J. M. DeJesus, and C. Ogden, “Trends in serum lipids among US youths aged 6 to 19 years, 1988–2010,” JAMA, vol. 308, no. 6, pp. 591–600, 2012. View at: Publisher Site | Google Scholar
  34. T. J. Anderson, G. B. J. Mancini, J. Genest Jr., J. Grégoire, E. M. Lonn, and R. A. Hegele, “The new dyslipidemia guidelines: what is the debate?” The Canadian Journal of Cardiology, vol. 31, no. 5, pp. 605–612, 2015. View at: Publisher Site | Google Scholar
  35. S. C. Bain, M. Feher, D. Russell-Jones, and K. Khunti, “Management of type 2 diabetes: the current situation and key opportunities to improve care in the UK,” Diabetes, Obesity & Metabolism, vol. 18, no. 12, pp. 1157–1166, 2016. View at: Publisher Site | Google Scholar
  36. F. Yuan, H. Dong, K. Fang, J. Gong, and F. Lu, “Effects of green tea on lipid metabolism in overweight or obese people: a meta-analysis of randomized controlled trials,” Molecular Nutrition & Food Research, vol. 62, no. 1, 2018. View at: Publisher Site | Google Scholar
  37. S. Aijaz, M. S. Balda, and K. Matter, “Tight junctions: molecular architecture and function,” International Review of Cytology, vol. 248, pp. 261–298, 2006. View at: Publisher Site | Google Scholar
  38. D. Tsikas, S. Rothmann, J. Y. Schneider et al., “Development, validation and biomedical applications of stable-isotope dilution GC-MS and GC-MS/MS techniques for circulating malondialdehyde (MDA) after pentafluorobenzyl bromide derivatization: MDA as a biomarker of oxidative stress and its relation to 15(S)-8-iso-prostaglandin F2α and nitric oxide (·NO),” Journal of Chromatography B, vol. 1019, pp. 95–111, 2016. View at: Publisher Site | Google Scholar
  39. W. Droge, “Free radicals in the physiological control of cell function,” Physiological Reviews, vol. 82, no. 1, pp. 47–95, 2002. View at: Publisher Site | Google Scholar
  40. V. N. Reddy, E. Kasahara, M. Hiraoka, L. R. Lin, and Y. S. Ho, “Effects of variation in superoxide dismutases (SOD) on oxidative stress and apoptosis in lens epithelium,” Experimental Eye Research, vol. 79, no. 6, pp. 859–868, 2004. View at: Publisher Site | Google Scholar
  41. C. M. Sena, P. Matafome, T. Louro, E. Nunes, R. Fernandes, and R. M. Seica, “Metformin restores endothelial function in aorta of diabetic rats,” British Journal of Pharmacology, vol. 163, no. 2, pp. 424–437, 2011. View at: Publisher Site | Google Scholar
  42. H. Sasaki, H. Asanuma, M. Fujita et al., “Metformin prevents progression of heart failure in dogs: role of AMP-activated protein kinase,” Circulation, vol. 119, no. 19, pp. 2568–2577, 2009. View at: Publisher Site | Google Scholar
  43. R. R. Zhao, X. C. Xu, F. Xu et al., “Metformin protects against seizures, learning and memory impairments and oxidative damage induced by pentylenetetrazole-induced kindling in mice,” Biochemical and Biophysical Research Communications, vol. 448, no. 4, pp. 414–417, 2014. View at: Publisher Site | Google Scholar
  44. H. Sova, U. Puistola, L. Morin-Papunen, and P. Karihtala, “Metformin decreases serum 8-hydroxy-2-deoxyguanosine levels in polycystic ovary syndrome,” Fertility and Sterility, vol. 99, no. 2, pp. 593–598, 2013. View at: Publisher Site | Google Scholar
  45. J. M. Lord, I. H. K. Flight, and R. J. Norman, “Metformin in polycystic ovary syndrome: systematic review and meta-analysis,” BMJ, vol. 327, no. 7421, p. 951, 2003. View at: Publisher Site | Google Scholar
  46. M. G. Alves, A. D. Martins, C. V. Vaz et al., “Metformin and male reproduction: effects on Sertoli cell metabolism,” British Journal of Pharmacology, vol. 171, no. 4, pp. 1033–1042, 2014. View at: Publisher Site | Google Scholar
  47. O. Adaramoye, O. Akanni, O. Adesanoye, O. Labo-Popoola, and O. Olaremi, “Evaluation of toxic effects of metformin hydrochloride and glibenclamide on some organs of male rats,” Nigerian Journal of Physiological Sciences, vol. 27, no. 2, pp. 137–144, 2012. View at: Google Scholar
  48. G. W. Strain, B. Zumoff, J. Kream et al., “Mild hypogonadotropic hypogonadism in obese men,” Metabolism, vol. 31, no. 9, pp. 871–875, 1982. View at: Publisher Site | Google Scholar
  49. S. Pellitero, I. Olaizola, A. Alastrue et al., “Hypogonadotropic hypogonadism in morbidly obese males is reversed after bariatric surgery,” Obesity Surgery, vol. 22, no. 12, pp. 1835–1842, 2012. View at: Publisher Site | Google Scholar
  50. H. Krishnamurthy, N. Danilovich, C. R. Morales, and M. R. Sairam, “Qualitative and quantitative decline in spermatogenesis of the follicle-stimulating hormone receptor knockout (FORKO) mouse,” Biology of Reproduction, vol. 62, no. 5, pp. 1146–1159, 2000. View at: Publisher Site | Google Scholar
  51. D. Guo, W. Wu, Q. Tang et al., “The impact of BMI on sperm parameters and the metabolite changes of seminal plasma concomitantly,” Oncotarget, vol. 8, no. 30, pp. 48619–48634, 2017. View at: Publisher Site | Google Scholar
  52. S. S. du Plessis, S. Cabler, D. A. McAlister, E. Sabanegh, and A. Agarwal, “The effect of obesity on sperm disorders and male infertility,” Nature Reviews Urology, vol. 7, no. 3, pp. 153–161, 2010. View at: Publisher Site | Google Scholar
  53. J. Zhao, L. Zhai, Z. Liu, S. Wu, and L. Xu, “Leptin level and oxidative stress contribute to obesity-induced low testosterone in murine testicular tissue,” Oxidative Medicine and Cellular Longevity, vol. 2014, Article ID 190945, 14 pages, 2014. View at: Publisher Site | Google Scholar
  54. Y. Fan, Y. Liu, K. Xue et al., “Diet-induced obesity in male C57BL/6 mice decreases fertility as a consequence of disrupted blood-testis barrier,” PLoS One, vol. 10, no. 4, article e0120775, 2015. View at: Publisher Site | Google Scholar
  55. D. H. Morgan, O. Ghribi, L. Hui, J. D. Geiger, and X. Chen, “Cholesterol-enriched diet disrupts the blood-testis barrier in rabbits,” American Journal of Physiology-Endocrinology and Metabolism, vol. 307, no. 12, pp. E1125–E1130, 2014. View at: Publisher Site | Google Scholar
  56. C. Algire, O. Moiseeva, X. Deschenes-Simard et al., “Metformin reduces endogenous reactive oxygen species and associated DNA damage,” Cancer Prevention Research, vol. 5, no. 4, pp. 536–543, 2012. View at: Publisher Site | Google Scholar
  57. A. Martin-Montalvo, E. M. Mercken, S. J. Mitchell et al., “Metformin improves healthspan and lifespan in mice,” Nature Communications, vol. 4, no. 1, article 2192, 2013. View at: Publisher Site | Google Scholar
  58. B. Onken and M. Driscoll, “Metformin induces a dietary restriction-like state and the oxidative stress response to extend C. elegans healthspan via AMPK, LKB1, and SKN-1,” PLoS One, vol. 5, no. 1, article e8758, 2010. View at: Publisher Site | Google Scholar
  59. I. E. Blasig, C. Bellmann, J. Cording et al., “Occludin protein family: oxidative stress and reducing conditions,” Antioxidants & Redox Signaling, vol. 15, no. 5, pp. 1195–1219, 2011. View at: Publisher Site | Google Scholar
  60. R. van den Berg, G. R. M. M. Haenen, H. van den Berg, and A. Bast, “Transcription factor NF-κB as a potential biomarker for oxidative stress,” The British Journal of Nutrition, vol. 86, Supplement 1, pp. S121–S127, 2001. View at: Publisher Site | Google Scholar
  61. T. Y. Ma, G. K. Iwamoto, N. T. Hoa et al., “TNF-α-induced increase in intestinal epithelial tight junction permeability requires NF-κB activation,” American Journal of Physiology-Gastrointestinal and Liver Physiology, vol. 286, no. 3, pp. G367–G376, 2004. View at: Publisher Site | Google Scholar
  62. S. Beutheu Youmba, L. Belmonte, L. Galas et al., “Methotrexate modulates tight junctions through NF-κB, MEK, and JNK pathways,” Journal of Pediatric Gastroenterology and Nutrition, vol. 54, no. 4, pp. 463–470, 2012. View at: Publisher Site | Google Scholar
  63. T. D. Gilmore and M. R. Garbati, “Inhibition of NF-κB signaling as a strategy in disease therapy,” Current Topics in Microbiology and Immunology, vol. 349, pp. 245–263, 2011. View at: Publisher Site | Google Scholar
  64. D. Bonnefont-Rousselot, B. Raji, S. Walrand et al., “An intracellular modulation of free radical production could contribute to the beneficial effects of metformin towards oxidative stress,” Metabolism, vol. 52, no. 5, pp. 586–589, 2003. View at: Publisher Site | Google Scholar
  65. A. Esteghamati, D. Eskandari, H. Mirmiranpour et al., “Effects of metformin on markers of oxidative stress and antioxidant reserve in patients with newly diagnosed type 2 diabetes: a randomized clinical trial,” Clinical Nutrition, vol. 32, no. 2, pp. 179–185, 2013. View at: Publisher Site | Google Scholar

Copyright © 2019 Jifeng Ye et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

1072 Views | 561 Downloads | 6 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.