The Scientific World Journal

The Scientific World Journal / 2014 / Article

Research Article | Open Access

Volume 2014 |Article ID 590803 |

Suat Moi Puah, S. D. Puthucheary, Jin Town Wang, Yi Jiun Pan, Kek Heng Chua, "Molecular Characterization of Putative Virulence Determinants in Burkholderia pseudomallei", The Scientific World Journal, vol. 2014, Article ID 590803, 9 pages, 2014.

Molecular Characterization of Putative Virulence Determinants in Burkholderia pseudomallei

Academic Editor: Adhar C. Manna
Received24 May 2014
Accepted09 Jul 2014
Published11 Aug 2014


The Gram-negative saprophyte Burkholderia pseudomallei is the causative agent of melioidosis, an infectious disease which is endemic in Southeast Asia and northern Australia. This bacterium possesses many virulence factors which are thought to contribute to its survival and pathogenicity. Using a virulent clinical isolate of B. pseudomallei and an attenuated strain of the same B. pseudomallei isolate, 6 genes BPSL2033, BP1026B_I2784, BP1026B_I2780, BURPS1106A_A0094, BURPS1106A_1131, and BURPS1710A_1419 were identified earlier by PCR-based subtractive hybridization. These genes were extensively characterized at the molecular level, together with an additional gene BPSL3147 that had been identified by other investigators. Through a reverse genetic approach, single-gene knockout mutants were successfully constructed by using site-specific insertion mutagenesis and were confirmed by PCR. BPSL2033::Km and BURPS1710A_1419::Km mutants showed reduced rates of survival inside macrophage RAW 264.7 cells and also low levels of virulence in the nematode infection model. BPSL2033::Km demonstrated weak statistical significance () at 8 hours after infection in macrophage infection study but this was not seen in BURPS1710A_1419::Km. Nevertheless, complemented strains of both genes were able to partially restore the gene defects in both in vitro and in vivo studies, thus suggesting that they individually play a minor role in the virulence of B. pseudomallei.

1. Introduction

Burkholderia pseudomallei is a Gram-negative motile bacillus, that is, a facultative anaerobe and an environmental saprophyte. It is readily recovered from the soil and surface waters in endemic areas, that is, Southeast Asia and Northern Australia [1]. This bacterium possesses a remarkable capacity to infect humans and animals, causing melioidosis which is an important cause of sepsis in the tropics [2]. It has been considered a potential bioweapon and so virulence factors that correspond to its pathogenesis are being intensively studied at an increasing rate.

The availability of complete genome sequence database of organisms allows researchers to discover many molecules and mechanisms that may be involved in the virulence of B. pseudomallei [3, 4]. Several approaches, including subtractive hybridization [5], comparative genomics [6], signature-tagged mutagenesis [7], transposon mutagenesis [8], in vivo expression technology [9], microarray [10], and computational methods [11, 12], have accelerated the discovery of virulence factors over the past decades. The availability of the genomic sequences of several B. pseudomallei strains has rapidly added candidate virulence genes to databases.

In general, past studies have focused on genomic differences between species, that is, the virulent B. pseudomallei and a closely related but avirulent family member B. thailandensis [5, 6]. PCR-based subtractive hybridization was recently undertaken in our laboratory using a virulent clinical isolate B. pseudomallei (v) and an attenuated strain of the same B. pseudomallei isolate (av) [13]. PCR-based subtractive hybridization successfully demonstrated 6 subtracted DNA fragments that were unique to the virulent strain of B. pseudomallei, whereas these DNA fragments were not seen in its “attenuated” strain [13]. Sequencing of the subtracted DNA fragments revealed 6 unique genes with unknown functions as follows: BPSL2033, BP1026B_I2784, BP1026B_I2780, BURPS1106A_A0094, BURPS1106A_1131, and BURPS1710A_1419.

Besides the 6 putative “virulence” determinants, BPSL3147 is another potential virulence determinant identified by Cuccui et al. [7]. This gene encodes a putative lipoprotein and is reported to be a putative lipoprotein containing 39.16% amino acid that is identical to a VacJ lipoprotein in Shigella flexneri. The Tn10 mutant of S. flexneri YSH6000T VacJ lipoprotein was unable to spread from cell to cell, suggesting VacJ is important for intercellular spread of the organism [14].

The aim of this study was to extensively characterize the 6 putative virulence determinants which were absent in the “attenuated” strain (av) that is believed to have reduced virulence that occurred after several subcultures and long-term storage in the laboratory, together with an additional candidate, BPSL3147, using the same methodology, that is, gene knockout approach, using in vitro and in vivo assays.

2. Material and Methods

2.1. Bacterial Strains, Media, and Culture Conditions

Bacterial strains and plasmids used are listed in Table 1. The clinical B. pseudomallei strain was isolated from the blood of a patient CMS, at the University Hospital, University of Malaya, Kuala Lumpur, who died from melioidosis as described in previous report [11] and this strain was used throughout the study (henceforth referred to as Bp-CMS). The Escherichia coli strains DH10B, CC118λpir, S17-1λpir, vector pUT-Km, and chloramphenicol acetyltransferase (CAT) cassette were obtained from Prof. Dr. Wang Jin-Town (National Taiwan University, Taiwan). All strains were grown in Luria-Bertani (LB) medium at 37°C and, when appropriate, antibiotics were used at the following final concentrations: ampicillin 100 μg/mL, kanamycin 50 μg/mL, chloramphenicol 100 μg/mL, and streptomycin 100 μg/mL. The mouse leukaemic monocyte macrophage cell line RAW264.7 was obtained from American Type Culture Collection (ATCC, USA). It was cultured and maintained in flasks (Corning, USA) with DMEM (Gifco, USA) supplemented with 10% (v/v) fetal bovine serum (Gifco, USA), 4 mM L-glutamine, and an antibiotic mixture containing 100 U/mL penicillin and 0.1 mg/mL streptomycin at 37°C in 5% CO2.

Strains or plasmidsRelevant characteristic(s)Reference

B. pseudomallei
  Bp-CMSClinical isolate from blood; wild type parental strain for generation of insertion mutantsCurrent study
  BPSL2033::KmBPSL2033::Km derivative of CMS; KanR
  BPSL2033::Km (pC-BPSL2033)BPSL2033::Km complemented with pC-BPSL2033 plasmid; KanR CmR
  BP1026B_I2784::KmBP1026B_I2784::Km derivative of CMS; KanR
  BP1026B_I2784::Km (pC-BP1026B_I2784)BP1026B_I2784::Km complemented with pC-BP1026B_I2784 plasmid; KanR CmR
  BP1026B_I2780::KmBP1026B_I2780::Km derivative of CMS; KanR
  BP1026B_I2780::Km (pC-BP1026B_I2780)BP1026B_I2780::Km complemented with pC-BP1026B_I2780 plasmid; KanR CmR
  BURPS1106A_A0094::KmBURPS1106A_A0094::Km derivative of CMS; KanR
  BURPS1106A_A0094::Km   (pC-BURPS1106A_A0094)BURPS1106A_A0094 ::Km complemented with pC-BURPS1106A_A0094 plasmid; KanR CmR
  BURPS1106A_1131::KmBURPS 1106A_1131::Km derivative of CMS; KanR
  BURPS1106A_1131::Km   (pC-BURPS1106A_1131)BURPS 1106A_1131::Km complemented with pC-BURPS1106A_1131 plasmid; KanR CmR
  BURPS1710A_1419::KmBURPS1710A_1419::Km derivative of CMS; KanR
  BURPS1710A_1419::Km   (pC-BURPS1710A_1419)BURPS1710A_1419::Km complemented in trans with pC-BURPS1710A_1419 plasmid; KanR CmR
  BPSL3147::KmBPSL3147::Km derivative of CMS; KanR
  BPSL3147::Km (pC-BPSL3147)BPSL3147::Km complemented with pC-BPSL3147 plasmid; KanR CmR
E. coli
  DH10BF_ mcrA (mrr-hsdRMS-mcrBC)80lacZ M15 lacX74 recA1 endA1 araD 139 Δ(ara, leu)7697 galU galK -rpsL nupG Prof. Dr. Jin-Town Wang
  CC118pirΔ(ara-leu) araD Δ lacX74 galE galK phoA20 thi-1 rpsE rpoB argE(Am) recA1 pir phage lysogen
  S17-1pirhsdR recA pro RP4-2 (Tc::Mu; Km::Tn7) (pir)
  OP50-1A streptomycin-resistant derivative of E.coli OP50 used as food source in C. elegans cultivation and uninfected control Kind gifts from Prof. Dr. Sheila Nathan
 pUT-KmpUT-Km1 derived plasmid, with miniTn5 excised by EcoRI, tnp excised by SalI, and bla removed by ApaLI and then with an insertion of Km resistance cassette from pUC4K into PstI site; oriR6K mobRP4 KanR AmpRChuang et al., 2006 [15]
 pGEM-T easyCloning vector for PCR cloning; AmpR Promega, USA

2.2. Construction of Mutants

Genes BPSL2033, BP1026B_I2784, BP1026B_I2780, BURPS1106A_A0094, BURPS1106A_1131, BURPS1710A_1419, and BPSL3147 were disrupted by homologous recombination using a suicide vector pUT-Km [15, 16]. Briefly, a partial region of the gene to be inactivated (serving as a significant site of gene exchange through conjugation and recombinant events) was amplified by polymerase chain reaction (PCR) using primer pairs as listed in Table 2. The amplicon was subcloned into pGEM-T easy vector, digested with EcoRI, and subcloned into the suicide vector pUT-Km [15]. Selection of transformants by plating onto LB agar containing kanamycin and rapid screening for desired inserts by colony PCR was performed using primers KmF and KmR. The construct was then transformed into E. coli S17-1λpir and introduced into the wild-type B. pseudomallei (Bp-CMS) by conjugation. An insertion mutant was selected using LB agar supplemented with kanamycin and site-specific chromosomal integration was verified by PCR using vector- and corresponding gene-specific primer pairs.

GenePrimer nameNucleotide sequence (5′ to 3′)Purpose

M2033RCACGTTTCTCGGATAGAGCMutant confirmation
C2033FCTAGAGCGCGGCCTCGCGComplementation of BPSL2033::Km

C2784FCCTTCGCGCTGATTTGGTComplementation of BP1026B_I2784::Km
C2784RCTACTTCGTAGCTTGATGCGCCComplementation of BP1026B_I2784::Km

C2780FAGGCTCGGAGTAGTAACACTTComplementation of BP1026B_I2780::Km
C2780RCTACTGCCTATGCTGGGGTATComplementation of BP1026B_I2780::Km

C94FTTCTACCAGCGACTTGGCComplementation of BURPS1106A_A0094::Km
C94RTCAATCTCCAGCGAGCTTComplementation of BURPS1106A_A0094::Km

C1131FGTGGTTCAGCCAGGCACGComplementation of BURPS1106A_1131::Km
C1131RGTATGTGTCGTCCGCATTTGComplementation of BURPS1106A_1131::Km

C1419FTGCACAAGCTGTTCAAATGComplementation of BURPS1710A_1419::Km
C1419RTTAAGGCTTGGGTGCAAGComplementation of BURPS1710A_1419::Km

M3147RCTCTTCCGGCATCTCGTAMutant confirmation
C3147FTTCAGGGTTACGAAGCGAAGComplementation of BPSL3147::Km
C3147RTCAGTGCAGCCGGATGCTCGComplementation of BPSL3147::Km

2.3. Construction of Complemented Plasmids

Intact genes BURPS1710A_1419, BPSL2033, BP1026B_I2784, BP1026B_I2780, BURPS1106A_A0094, BURPS1106A_1131, and BPSL3147 and their promoters were amplified by PCR and cloned into a pGEM-T-CAT plasmid. These complemented plasmids were then reintroduced into the corresponding insertion mutants by transformation. The resulting complemented strains were selected using LB agar containing chloramphenicol.

2.4. Bacterial Growth Curve

The growth of B. pseudomallei strains in LB broth was monitored over 8 h by taking 1 mL of culture broth every hour to perform OD600 readings. The wild-type Bp-CMS was used as a positive control for growth in LB.

2.5. Bacterial Replication Assays

Intracellular bacterial survival and replication was assayed in the mouse macrophage-like cell line RAW 264.7. Cells were seeded at a density of cells/well into 24-well culture plates (Corning, USA) and incubated overnight at 37°C in 5% CO2. An overnight culture of B. pseudomallei strain was diluted 1 : 100 and grown at 37°C for 3 h with shaking to reach mid-log phase. Cell monolayers were then washed twice with PBS and incubated in fresh DMEM without antibiotic for 1 h prior to infection with bacteria. The bacterial suspension was added at a MOI of 100 : 1 and the coculture was immediately centrifuged at room temperature at 170 ×g for 5 min to bring the bacteria in direct contact with the host cells. After 1 h, the cells were washed twice with PBS and incubated in fresh DMEM containing 300 μg/mL of tetracycline to suppress the growth of residual extracellular bacteria. Tetracycline was used instead of gentamicin, as Bp-CMS is resistant to gentamicin. At 2, 4, and 8 h after infection, infected monolayers were washed twice with PBS and lysed with 0.1% (v/v) Triton X-100 for 15 min. Serial dilutions of the released bacteria (expressed as colony forming units CFU) were plated on tryptic soy agar (TSA) plates to enumerate bacterial loads by direct colony counts. The number of internalized bacteria obtained at 2 h after infection represented the initial entry of bacteria, whereas at 4 and 8 h after infection represented intracellular bacterial replication. Bacterial survival was normalized to counts obtained at 2 h after infection and the relative survival rate presented as a percentage.

2.6. Virulence Testing with C. elegans

The wild-type C. elegans N2 was obtained from Carolina Biological Supply Company (USA). The nematode was propagated on nematode growth medium (NGM) plate and fed on the normal food source E. coli OP50-1, which was a kind gift from Prof. Dr. Sheila Nathan (National University of Malaysia, Malaysia). Killing assays were performed as previously described by Tan et al. [17] with minor modifications. All nematodes were age-synchronized by a bleaching procedure prior to the killing assay [18]. All B. pseudomallei derived strains (wild-type Bp-CMS, 7 insertion mutants, and 7 complemented strains) and E. coli OP50-1 were grown overnight at 37°C and 40 μL of each culture was spread on NGM plates containing 50 μg/mL 5-fluorodeoxyuridine (Merck, USA) to inhibit the eggs of C. elegans from hatching. Plates were incubated at 37°C for 24 h and then allowed to equilibrate for 24 h at room temperature before coculturing with the host worms. Thirty age-matched hermaphrodites were individually transferred to freshly lawned plates by using the flattened tip of a worm pick (platinum wire). The plates were incubated at room temperature and virulence was tracked by counting the number of live and dead worms every 24 h for 3 days. Three independent experiments were carried out for each strain and each test was performed in triplicate (with a total of 270 worms). A worm was considered dead on failure to respond to gentle touch by the worm pick. E. coli OP50-1 was used as a negative control. The resulting data was analyzed with GraphPad Prism 5 software and plotted using the Kaplan-Meier survival plot.

3. Results

3.1. Insertion Mutant Construction and Growth

Positive chromosomal integration mutants were successfully constructed for the 7 candidate genes, on the first or second attempt, and a representative of construct is shown in Figure 1. All 7 mutant strains demonstrated similar growth rates to the parental strain in liquid media over 8 h.

3.2. Bacterial Replication and Survival Assay

Overall, wild-type bacteria were able to survive and replicate in macrophage cells over the course of the experiments. In contrast, the 5 mutant strains BPSL2033::Km, BP1026B_I2780::Km, BURPS1106A_A0094::Km, BURPS1710A_1419::Km, and BPSL3147::Km showed reduced intracellular survival inside RAW264.7 cells at 4 and 8 h post infection, but only BPSL2033::Km reached statistical significance () at 8 h post infection. Another 2 mutant strains BP1026B_I2784::Km and BURPS1106A_1131::Km demonstrated no difference in survival in RAW264.7 cells at 4 and 8 h post infection.

Most of these plasmid-complemented strains partially restored intracellular survival and replication except for BP1026B_I2780::Km, BURPS1106A_A0094::Km, and BURPS1106A_1131::Km. The results suggest that 3 genes, BPSL2033::Km (), BURPS1710A_1419::Km (), and BPSL3147::Km (), individually had little effect on the intracellular survival of B. pseudomallei in phagocytic cells (Figures 2(a) to 2(c)).

3.3. Caenorhabditis elegans Killing Assay

The 6 mutants (BPSL2033::Km, BP1026B_I2784::Km, BP1026B_I2780::Km, BURPS1106A_1131::Km, BURPS1710A_1419::Km, and BPSL3147::Km) exhibited low levels of attenuated virulence in C. elegans, where survival rates of worms were only 2-fold higher than that of the wild type (data not shown). Among them, the most attenuation of virulence was observed in BURPS1710A_1419::Km as 51% worms were able to survive, followed by BPSL2033::Km (47%) compared to the wild-type parental strain (23%) after 3 days (Figures 3(a) and 3(b)). The complemented strains of both mutants, BURPS1710A_1419::Km and BPSL2033::Km, showed at least partial restoration of virulence, thus suggesting a minor role in the nematode infection model.

4. Discussion

There was no difference in the growth rates of all 7 mutants compared to that of the wild type when assayed in rich media (data not shown), ruling out the possibility that these genes are not affecting the growth but involved in other aspects such as pathogenicity. The infection assay on phagocytic cells showed that, without the presence of gene BPSL2033 (putative transport-related membrane protein), the mutants demonstrated reduced ability to replicate and survive over 8 h. This result was supported by a plasmid-encoded complemented strain, which demonstrated partial restoration of intracellular survival when compared to wild-type Bp-CMS. Similar outcomes were seen with BURPS1710A_1419 (putative lipoprotein) and BPSL3147 (lipoprotein).

At 8 h post infection, loss of gene BPSL2033 showed a 5-fold reduction in survival time in RAW264.7 cells while both BURPS1710A_1419 and BPSL3147 resulted in a 3-fold reduction in survival, indicating that these genes may be involved in intracellular survival. There was a weak but still significant difference () exhibited by BPSL2033::Km compared to Bp-CMS. Thus, BPSL2033 may act in concert with other genes and play an essential role in virulence. Subtractive hybridization, as reported in our earlier study, demonstrated that Bp-CMS contained 6 DNA sequences that were not found in the attenuated strain, indicating that maximal virulence probably requires multiple genes acting together in concert [13]. This hypothesis is further supported by the present study in which B. pseudomallei virulence in the phagocytic cell line model was not critically dependent on any single putative gene tested.

Several studies have suggested that a double mutant and not a single mutant of B. pseudomallei contributed significantly to the growth inside murine macrophage [19, 20]. Future experiments involving the use of double mutants (i.e., BPSL2033 and BURPS1710A_1419) may prove this possibility. In the context of BPSL3147, there may have been other unidentified gene(s) acting together for full virulence in B. pseudomallei infections. It is unclear why these genes BPSL2033, BURPS1710A_1419, and BPSL3147 with their corresponding complemented plasmids only restored intracellular survival and replication to approximately 50% of the wild-type level. One possible explanation for this may be due to the gene being present on multiple copies of the plasmid.

C. elegans has been used as a simple surrogate host for modeling bacterial diseases [21]. It has been shown that on a low nutrient nematode growth medium (NGM) B. pseudomallei killed C. elegans strain N2 within 3 days and this type of killing is referred to as “slow killing” [2224]. In our study, wild-type strain Bp-CMS killed 74% of the nematode population at 72 h time point in NGM. Our results are in agreement with published reports that differences in killing efficiency of C. elegans occur among wild-type strains of B. pseudomallei [23, 25, 26]. For instance, the percentage of killing of worms by various B. pseudomallei strains, that is, ATCC23343, EY4, number #40, and KHW, was approximately 50, 60, 75, and 90%, respectively, at 72 h time points [23]. Virulence of B. pseudomallei for the nematode is likely to be variable due to the different genetic determinants in the strains.

In the present study, all the constructed mutants were less effective in killing C. elegans under slow-killing conditions; that is, twice as many worms survived when fed on mutant strains compared to worms fed on wild-type Bp-CMS after 72 h of coculture. However, there was no significant difference of C. elegans killing between the mutants and wild type. Two complemented strains of BPSL2033::Km and BURPS1710A_1419::Km achieved at least partial restoration of virulence at 72 h coculture, thus suggesting that both genes are most probably involved in bacterial virulence.

The low level attenuation of virulence in the mutants, compared to the wild type, may possibly be due to the following.(i)A single gene was insufficient to mediate full killing in the animal model. At least 2 genes are probably required to act together for achieving virulence in B. pseudomallei. A double mutant ΔrelAΔspoT was reported to exhibit significant and severe attenuation in larva of the wax moth Galleria mellonella and C57BL/6 in mice models, which was not seen with the single mutant [20].(ii)C. elegans possesses mechanisms to avoid or move away from pathogenic bacteria like B. pseudomallei. It has a simple nervous system that consists of 302 neurons that facilitate the identification of molecules, neurons, and circuits involved in their behavior [27]. It uses chemotaxis to find food on the plate and is able to discriminate food both physically based on size and chemically based on taste and olfaction [28]. Worms can modify their olfactory preference via the neurotransmitter serotonin to avoid odours from pathogens and this learning occurs with exposure as short as 4 h [29]. In our study, C. elegans was cultivated on E. coli OP50-1 that best supports growth, so the worms had already experienced good food, which might have increased their exploratory bahaviour when switching to very bad food such as B. pseudomallei, especially in leaving bahaviours. Nonetheless, it is impossible to raise worms on B. pseudomallei alone because of the virulence of the organism.

BPSL2033 is a 428-amino-acid protein with a molecular mass of 46 kDa as a transport-related membrane protein; BURPS1710A_1419 is a 74-amino-acid protein with a calculated molecular mass of 8 kDa which is a putative lipoprotein. Further bioinformatics analysis suggests that amino acids 23-324 of BPSL2033 encode a domain belonging to major facilitator superfamily (MFS). MFS transporters are ubiquitous and found in all classes of organisms and in several pathogens such as Francisella tularensis [30] and Legionella pneumophila [31]. Chatfiled and colleagues [32] have shown that MFS protein plays a role in virulence by promoting bacterial iron-siderophore import.

The Phyre 2 model [33] predicts that BPSL2033 forms a major facilitator superfamily fold and shares very low sequence identity (16%) to glycerol-3-phosphate transporter protein from E. coli with known three-dimensional structure (PDB template: 1pw4A). The results imply that BPSL2033 might exhibit new structural and/or functional characteristics and further X-ray crystallography analysis may provide valuable information. At present, we postulate that BPSL2033 transports nutrients (probably glycerol-3-phosphate) that are essential for the replication of B. pseudomallei. Database searches with the NCBI blastp tool identified BURPS1710A_1419, as a putative lipoprotein within genus level, is diverged from 37 to 82% with no conserved domain identified, as well as a lack of three-dimensional structural information, possibly suggesting that BURPS1710A_1419 gene product has new or different functional characteristics.

In conclusion, our results suggest that BPSL2033 and BURPS1710A_1419 individually are likely to contribute to a minor role in virulence and provide a basis for further characterization of their role in pathogenesis. We hypothesize that the combination effect of both genes can provide a clear virulence role in B. pseudomallei.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.


The authors would like to thank all members from Lab R739 especially Dr. Tzu-Lung Lin, Dr. Pei-Fang Hsieh, Dr. Chun-Ru Hsu, and Dr. Meng-Chuan Wu (Department of Microbiology, National Taiwan University College of Medicine, Taipei) for their guidance in the construction of the mutants and Prof. Dr. Sheila Nathan from National University of Malaysia for the E. coli OP50-1. This work was supported by University of Malaya Research Grant (RG409-12HTM), FRGS FP037-2013A, and High Impact Research MoE Grant UM.C/625/1/HIR/MoE/E000044-20001.


  1. W. J. Wiersinga, B. J. Currie, and S. J. Peacock, “Melioidosis,” The New England Journal of Medicine, vol. 367, no. 11, pp. 1035–1044, 2012. View at: Publisher Site | Google Scholar
  2. A. C. Cheng and B. J. Currie, “Melioidosis: epidemiology, pathophysiology, and management,” Clinical Microbiology Reviews, vol. 18, no. 2, pp. 383–416, 2005. View at: Publisher Site | Google Scholar
  3. M. T. Holden, R. W. Titball, S. J. Peacock et al., “Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei,” Proceedings of the National Academy of Sciences of the United States of America, vol. 101, pp. 14240–14245, 2004. View at: Google Scholar
  4. A. Tuanyok, B. R. Leadem, R. K. Auerbach et al., “Genomic islands from five strains of Burkholderia pseudomallei,” BMC Genomics, vol. 9, article 566, 2008. View at: Publisher Site | Google Scholar
  5. S. L. Reckseidler, D. DeShazer, P. A. Sokol, and D. E. Woods, “Detection of bacterial virulence genes by subtractive hybridization: Identification of capsular polysaccharide of Burkholderia pseudomallei as a major virulence determinant,” Infection and Immunity, vol. 69, no. 1, pp. 34–44, 2001. View at: Publisher Site | Google Scholar
  6. Y. Yu, H. S. Kim, H. C. Hui et al., “Genomic patterns of pathogen evolution revealed by comparison of Burkholderia pseudomallei, the causative agent of melioidosis, to avirulent Burkholderia thailandensis,” BMC Microbiology, vol. 6, article 46, 2006. View at: Publisher Site | Google Scholar
  7. J. Cuccui, A. Easton, K. K. Chu et al., “Development of signature-tagged mutagenesis in Burkholderia pseudomallei to identify genes important in survival and pathogenesis,” Infection and Immunity, vol. 75, no. 3, pp. 1186–1195, 2007. View at: Publisher Site | Google Scholar
  8. D. A. Rholl, L. A. Trunck, and H. P. Schweizer, “In vivo Himar1 transposon mutagenesis of Burkholderia pseudomallei,” Applied and Environmental Microbiology, vol. 74, no. 24, pp. 7529–7535, 2008. View at: Publisher Site | Google Scholar
  9. G. Shalom, J. G. Shaw, and M. S. Thomas, “In vivo expression technology identifies a type VI secretion system locus in Burkholderia pseudomallei that is induced upon invasion of macrophages,” Microbiology, vol. 153, no. 8, pp. 2689–2699, 2007. View at: Publisher Site | Google Scholar
  10. S. Chieng, L. Carreto, and S. Nathan, “Burkholderia pseudomallei transcriptional adaptation in macrophages,” BMC Genomics, vol. 13, article 328, 2012. View at: Publisher Site | Google Scholar
  11. S. H. Yoon, C.-G. Hur, H.-Y. Kang, Y. H. Kim, T. K. Oh, and J. F. Kim, “A computational approach for identifying pathogenicity islands in prokaryotic genomes,” BMC Bioinformatics, vol. 6, article 184, 2005. View at: Publisher Site | Google Scholar
  12. L. Zheng, Y. Li, J. Ding et al., “A comparison of computational methods for identifying virulence factors,” PLoS ONE, vol. 7, no. 8, Article ID e42517, 2012. View at: Publisher Site | Google Scholar
  13. S. D. Puthucheary, S. M. Puah, H. C. Chai, K. L. Thong, and K. H. Chua, “Molecular investigation of virulence determinants between a virulent clinical strain and an attenuated strain of Burkholderia pseudomallei,” Journal of Molecular Microbiology and Biotechnology, vol. 22, no. 3, pp. 198–204, 2012. View at: Publisher Site | Google Scholar
  14. T. Suzuki, T. Murai, I. Fukuda, T. Tobe, M. Yoshikawa, and C. Sasakawa, “Identification and characterization of a chromosomal virulence gene, vacJ, required for intercellular spreading of Shigella flexneri,” Molecular Microbiology, vol. 11, no. 1, pp. 31–41, 1994. View at: Publisher Site | Google Scholar
  15. Y. P. Chuang, C. T. Fang, S. Y. Lai, S. C. Chaing, and J. T. Wang, “Genetic determinants of capsular serotype K1 of Klebsiella pneumoniae causing primary pyogenic liver abscess,” Journal of Infectious Diseases, vol. 193, no. 5, pp. 645–654, 2006. View at: Publisher Site | Google Scholar
  16. T.-L. Lin, C.-Z. Lee, P.-F. Hsieh, S.-F. Tsai, and J.-T. Wang, “Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess,” Journal of Bacteriology, vol. 190, no. 2, pp. 515–526, 2008. View at: Publisher Site | Google Scholar
  17. M. W. Tan, S. Mahajan-Miklos, and F. M. Ausubel, “Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis,” Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 2, pp. 715–720, 1999. View at: Publisher Site | Google Scholar
  18. T. Stiernagle, Maintenance of C. elegans, Oxford University Press, New York, NY, USA, 1999.
  19. R. Balder, S. Lipski, J. J. Lazarus et al., “Identification of Burkholderia mallei and Burkholderia pseudomallei adhesins for human respiratory epithelial cells,” BMC Microbiology, vol. 10, article 250, 2010. View at: Publisher Site | Google Scholar
  20. C. M. Müller, L. Conejero, N. Spink, M. E. Wand, G. J. Bancroft, and R. W. Titball, “Role of RelA and SpoT in Burkholderia pseudomallei virulence and immunity,” Infection and Immunity, vol. 80, no. 9, pp. 3247–3255, 2012. View at: Publisher Site | Google Scholar
  21. M. J. Gravato-Nobre and J. Hodgkin, “Caenorhabditis elegans as a model for innate immunity to pathogens,” Cellular Microbiology, vol. 7, no. 6, pp. 741–751, 2005. View at: Publisher Site | Google Scholar
  22. K. L. Chua, Y. Y. Chan, and Y. H. Gan, “Flagella are virulence determinants of Burkholderia pseudomallei,” Infection and Immunity, vol. 71, no. 4, pp. 1622–1629, 2003. View at: Publisher Site | Google Scholar
  23. Y.-H. Gan, K. L. Chua, H. H. Chua et al., “Characterization of Burkholderia pseudomallei infection and identification of novel virulence factors using a Caenorhabditis elegans host system,” Molecular Microbiology, vol. 44, no. 5, pp. 1185–1197, 2002. View at: Publisher Site | Google Scholar
  24. Y. Song, C. Xie, Y. M. Ong, Y. H. Gan, and K. L. Chua, “The BpsIR quorum-sensing system of Burkholderia pseudomallei,” Journal of Bacteriology, vol. 187, no. 2, pp. 785–790, 2005. View at: Publisher Site | Google Scholar
  25. S. H. Lee, S. K. Ooi, N. M. Mahadi, M. W. Tan, and S. Nathan, “Complete killing of Caenorhabditis elegans by Burkholderia pseudomallei is dependent on prolonged direct association with the viable pathogen,” PLoS ONE, vol. 6, no. 3, Article ID e16707, 2011. View at: Publisher Site | Google Scholar
  26. A. L. O'Quinn, E. M. Wiegand, and J. A. Jeddeloh, “Burkholderia pseudomallei kills the nematode Caenorhabditis elegans using an endotoxin-mediated paralysis,” Cellular Microbiology, vol. 3, no. 6, pp. 381–393, 2001. View at: Publisher Site | Google Scholar
  27. J. G. White, E. Southgate, J. N. Thomson, and S. Brenner, “The structure of the nervous system of the nematode Caenorhabditis elegans,” Philosophical Transactions of the Royal Society B: Biological Sciences, vol. 314, no. 1165, pp. 1–340, 1986. View at: Google Scholar
  28. Y. Kiyama, K. Miyahara, and Y. Ohshima, “Active uptake of artificial particles in the nematode Caenorhabditis elegans,” The Journal of Experimental Biology, vol. 215, no. 7, pp. 1178–1183, 2012. View at: Publisher Site | Google Scholar
  29. Y. Zhang, H. Lu, and C. I. Bargmann, “Pathogenic bacteria induce aversive olfactory learning in Caenorhabditis elegans,” Nature, vol. 438, no. 7065, pp. 179–184, 2005. View at: Publisher Site | Google Scholar
  30. M. E. Marohn, A. E. Santiago, K. A. Shirey, M. Lipsky, S. N. Vogel, and E. M. Barry, “Members of the Francisella tularensis phagosomal transporter: subfamily of major facilitator superfamily transporters are critical for pathogenesis,” Infection and Immunity, vol. 80, no. 7, pp. 2390–2401, 2012. View at: Publisher Site | Google Scholar
  31. J. Sauer, M. A. Bachman, and M. S. Swanson, “The phagosomal transporter A couples threonine acquisition to differentiation and replication of Legionella pneumophila in macrophages,” Proceedings of the National Academy of Sciences of the United States of America, vol. 102, no. 28, pp. 9924–9929, 2005. View at: Publisher Site | Google Scholar
  32. C. H. Chatfield, B. J. Mulhern, D. M. Burnside, and N. P. Cianciotto, “Legionella pneumophila LbtU acts as a novel, TonB-independent receptor for the legiobactin siderophore,” Journal of Bacteriology, vol. 193, no. 7, pp. 1563–1575, 2011. View at: Publisher Site | Google Scholar
  33. L. A. Kelley and M. J. E. Sternberg, “Protein structure prediction on the Web: a case study using the Phyre server,” Nature protocols, vol. 4, no. 3, pp. 363–371, 2009. View at: Publisher Site | Google Scholar

Copyright © 2014 Suat Moi Puah et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.