BioMed Research International

BioMed Research International / 2015 / Article

Research Article | Open Access

Volume 2015 |Article ID 935903 | https://doi.org/10.1155/2015/935903

Qin Pan, Yu-Qin Wang, Guang-Ming Li, Xiao-Yan Duan, Jian-Gao Fan, "Fuzheng Huayu Recipe Ameliorates Liver Fibrosis by Restoring Balance between Epithelial-to-Mesenchymal Transition and Mesenchymal-to-Epithelial Transition in Hepatic Stellate Cells", BioMed Research International, vol. 2015, Article ID 935903, 11 pages, 2015. https://doi.org/10.1155/2015/935903

Fuzheng Huayu Recipe Ameliorates Liver Fibrosis by Restoring Balance between Epithelial-to-Mesenchymal Transition and Mesenchymal-to-Epithelial Transition in Hepatic Stellate Cells

Academic Editor: Martin Sebastian Staege
Received22 Sep 2015
Accepted16 Dec 2015
Published31 Dec 2015

Abstract

Activation of hepatic stellate cells (HSCs) depending on epithelial-to-mesenchymal transition (EMT) reflects the key event of liver fibrosis. Contrastively, mesenchymal-to-epithelial transition (MET) of HSCs facilitates the fibrosis resolution. Here we investigated the effect of Fuzheng Huayu (FZHY) recipe, a Chinese herbal decoction made of Radix Salviae Miltiorrhizae, Semen Persicae, Cordyceps sinensis, Pollen Pini, and Gynostemma pentaphyllum, on liver fibrosis concerning the balance of EMT and MET in HSCs. In contrast to the increased TGF-/BMP-7 ratio in activated HSCs, FZHY administration induced significant upregulation of BMP-7 and downregulation of TGF- at both transcription and translation levels. Restoration of TGF-/BMP-7 ratio inhibited the expression of p38 MAPK and phosphorylated p38 MAPK, resulting in the reversal of epithelial-to-mesenchymal transition (EMT) to mesenchymal-to-epithelial transition (MET) as characterized by the abolishment of EMT markers (α-SMA and desmin) and reoccurrence of MET marker (E-cadherin). In vivo treatment of FZHY recipe also demonstrated the statistical reduction of activated HSCs with EMT phenotype, which attenuated the carbon tetrachloride- (CCl4-) induced liver fibrosis in a dose-dependent manner. These findings may highlight a novel antifibrotic role of FZHY recipe on the basis of rebalancing EMT and MET in HSCs.

1. Introduction

Hepatic fibrosis represents the common outcome of chronic liver diseases, such as chronic viral infections, alcoholism, fatty liver diseases, and cholestasis, and associates with both hepatocellular carcinoma (HCC) and hepatic failure. Activation of hepatic stellate cells (HSCs) has been well established to contribute to most fibrosis-related characteristics [1].

Nowadays, Fuzheng Huayu (FZHY) recipe, a decoction of Radix Salviae Miltiorrhizae, Semen Persicae, Cordyceps sinensis, Pollen Pini, and Gynostemma pentaphyllum, is reported to exert antifibrosis actions in several clinical trials [25]. Three-month treatment of FZHY recipe gives rise to the decreased serum levels of procollagen peptides and laminin in 63 patients with chronic hepatitis B (CHB). Liver biopsy uncovers the remarkable amelioration of fibrosis grade in most of them [2]. Similar results are detected in another multicentral clinical trial for 180 patients with CHB. Significant improvements in serum level of collagen type IV and fibrosis scoring confirm the therapeutic role of FZHY recipe in hepatic fibrosis [3]. Although FZHY recipe exhibits the prospect for fibrosis prevention, mechanisms underlying its actions still remain to be clarified.

Recent studies uncover that TGF-, the key mediators of liver fibrosis, induces typical characteristics of epithelial-to-mesenchymal transition (EMT), also known as activation, in HSCs [6, 7]. Accompanied by the loss of epithelial markers and gain of mesenchymal markers, HSCs undergoing EMT demonstrate collagen overproduction and formation of fibrous tissue, which further initiates and perpetuates the liver fibrosis [6]. In contrast, reverse process of EMT, namely, mesenchymal-to-epithelial transition (MET), has recently been proved to counteract TGF--induced fibrotic response in different organs [8, 9]. BMP-7, one of the members of TGF-β surperfamily, acts as the critical mediator of MET [10]. Therefore, balance between EMT and MET of HSCs is suggested to determine the liver fibrosis on a basis of, at least to a large extent, TGF-/BMP-7 ratio. Surprisingly, there are growing evidences that FZHY recipe exerts intensive impact on the TGF-/BMP-7 ratio, and also the downstream signaling. The FZHY recipe has already been identified to downregulate the hepatic expression of TGF- [11] and strongly inhibits the EMT-specific signal in renal interstitial cells [4]. Thus FZHY recipe is hypothesized to effect a pattern of EMT/MET rebalancing by modulating the TGF-/BMP-7 ratio.

To verify the role of FZHY recipe in the balance between EMT and MET, primary rat HSCs were activated and incubated with FZHY-containing serum. The expression of both TGF- and BMP-7 in HSCs was evaluated according to their transcription and translation levels. Analysis of p38 MAPK, with and without phosphorylation, reflected the downstream signaling depending on TGF-/BMP-7 ratio. Markers specific to epithelial and mesenchymal cells further characterized the status of EMT and MET. Finally, experimental liver fibrosis was subjected to FZHY treatment so as to reveal the consequence of EMT/MET rebalancing.

2. Materials and Methods

2.1. Cell Preparation

HSCs were separated from adult male Sprague-Dawley (SD) rats (400–500 g, Experimental Animal Center of Chinese Academy of Science, Shanghai, China) by in situ serial infusion with D-Hanks’ and perfusion medium (Hanks’ medium containing 0.05% collagenase IV and 0.1% Pronase E), redigestion with collagenase IV and DNase, and single-step density gradient centrifugation with 18% Nycodenz (W/V) [4]. Their living percentage was up to 95% as defined by staining of trypan blue, while their purity was over 90% when assessed by Oil Red O staining and real-time PCR for α-smooth muscle actin (α-SMA), desmin, albumin (ALB), CK19, CD31, and CD68, respectively [1] (Figures 1(a)1(d), 1(g)). Immunocytochemical staining of α-SMA (Santa Cruz, USA) denoted the spontaneous activation of nearly all HSCs on the 10th day (Figures 1(e) and 1(f)).

The rats received humane care in accordance with the Declaration of Helsinki (1964). The study was approved by the ethical committee of Shanghai Jiaotong University School of Medicine.

2.2. FZHY Administration

Adult male SD rats were treated by FZHY recipe (Pearl Ocean Pharmaceutical Holdings Limited, Beijing, China) intragastrically (10-fold of the maximum daily human dosage of 65 kg, every 2 hours for 3 times). Blood was collected from inferior vena cava 2 hours after the last administration. FZHY-containing serum was then obtained by centrifugation (3000 g for 10 minutes) and inactivation (56°C for 30 min) [12].

Activated HSCs in logarithmic growth phase were randomized into groups of model, 5% FZHY treatment, 10% FZHY treatment, and 20% FZHY treatment. Quiescent HSCs were used as the control group. All FZHY-treated groups were incubated with FZHY-containing serum for 48 h, while saline at the same volume was added into the control and model groups.

2.3. Real-Time PCR

Total RNA, being extracted from HSCs, was subjected to RT reaction by ExScript RT reagent kit (TAKARA, Kusatsu, Japan). Real-time PCR was then performed using SYBR Premix Ex Taq (TAKARA, Kusatsu, Japan) on a Light Cycler (Roche Diagnostics GmbH, Penzberg, Germany) according to the manufacturer’s instructions. Primer sequences and endogenous control for these reactions were exhibited in Table 1. Relative gene expression levels were calculated by the method [13].


GenePrimer sequence (5′-3′)Annealing temperature (°C)Product length (bp)

ALBForward primer:
GACTGCCCTGTGTGGAAGAC
Reverse primer:
CGAAGTCACCCATCACCGTC
56321

-SMAForward primer:
GCGGGGATCCATGAGACCACCTAC
Reverse primer:
GAGCCGCCGATCCACACTGA
60218

CK19Forward primer:
CACTACGCAGATCCAGATAAACA
Reverse primer:
GAAGTCGCACTGGTAGCAAG
56388

CD31Forward primer:
CTTCACCATCCAGAAGGAAGAGAC
Reverse primer:
CACTGGTATTCCATGTCTCTGGTG
56360

CD68Forward primer:
TCATGGGAATGCCACAGTTTC
Reverse primer:
GAGGGCCAACAGTGGAGAA
5662

DesminForward primer:
GGCCGACGCAGTGAACCAG
Reverse primer:
CGCCGCAGCTCTCGCATCT
60213

E-cadherinForward primer:
TGAAGCCCCCATTTTTGTGC
Reverse primer:
GCTCCGAATCTTCTCTGTCCATCT
58 221

TGF-β1Forward primer:
GCGCCTGCAGAGATTCAAGTCA
Reverse primer:
AAAGCCCTGTATTCCGTCTCCT
56 187

GAPDHForward primer:
CACGGCAAGTTCAACGGCACAGT
Reverse primer:
AGCGGAAGGGGCGGAGATGAT
60 222

2.4. Western Blot

Total protein of each sample was prepared by standard procedures and quantified by the bicinchoninic acid method (Pierce, Rockford, USA). These protein samples were loaded on 10% polyacrylamide gels and electrophoretically separated. Subsequently, the protein was transferred to polyvinilidene difluoride membranes (Millipore, USA), blocked with 0.1% Tween 20 (TBST) in 5% nonfat dry milk (NFDM) based on Tris-buffered saline (TBS), reacted with primary antibodies (anti-TGF (1 : 500), anti-BMP-7 (1 : 1000), anti-p38 MAPK (1 : 1500), anti-phosphorylated-p38 MAPK (anti-p-p38 MAPK, 1 : 1000), anti-E-cadherin (1 : 500), anti-α-SMA (1 : 1000), and anti-desmin (1 : 600), Santa Cruz, USA) overnight at 4°C and then HRP-conjugated goat anti-mouse IgG (1 : 3000; Jackson ImmunoResearch Laboratories, Inc., USA) for 2 h at room temperature. After washing, the membrane was processed using Super-Signal West Pico Chemiluminescent Substrate (Pierce), and antibody against GAPDH (Santa Cruz, USA) (1 : 1000) as an internal control [14].

2.5. Animals and Grouping

Adult male SD rats were randomly divided into normal control (), model (), and FZHY-treated group (). Except for those in the normal control group, all rats were subcutaneously injected with 40% CCl4 (0.3 mL/100 g) every 3 days for 6 weeks. Rats of the normal control group received same volume of olive oil in the same way [15]. During the exposure to CCl4, FZHY recipe dilution (75 mg/mL of FZHY recipe) was intragastrically administered to the low-dose (2.5 mL/kg/d), medium-dose (5 mL/kg/d), and high-dose (10 mL/kg/d) FZHY-treated rats for 4 weeks, while saline was administered to rats in the model group [16].

2.6. Immunohistochemistry

Liver specimens of all groups were prepared and subjected to the following procedure: (1) inhibition of endogenous peroxidase activity by 3% H2O2 for 15 minutes; (2) digestion by 0.01% trypsin for 10 minutes; (3) blocking nonspecific binder by bovine albumin for 10 minutes; (4) incubation with anti-α-SMA (1 : 100, Santa Cruz, USA) overnight at 4°C, (5) reaction with biotin-conjugated secondary antibody (1 : 200; Jackson ImmunoResearch Laboratories, Inc., USA) for 30 minutes; (6) visualization by DAB kit [17].

2.7. Hydroxyproline Assay

Liver samples were hydrolyzed in HCl (6 mol/L) at 120°C for 16 h. After being neutralized with NaOH (6 mol/L), the supernatant was oxidized with Chloramine T (Sigma-Aldrich Corp., USA) in acetate/citrate buffer and mixed with Ehrlich’s solution. The mixture was then incubated at 60°C for 30 min, and its absorbance was determined at 560 nm [18].

2.8. Histology Assay

Histological characteristics, including hepatocyte steatosis, inflammation, and fibrosis, of liver tissue were investigated by both hematoxylin-eosin (H&E) and Van Gieson (VG) staining. Liver fibrosis was evaluated according to Metavir stage [19]. Obtained results were independently interpreted by 2 pathologists, who were not aware of the study.

2.9. Statistical Analysis

Data are expressed as means ± standard deviation (SD). All groups were compared statistically by one-way ANOVA using SPSS 16.0 statistical package. Differences with were considered statistically significant.

3. Results

3.1. FZHY Recipe Recovered the TGF-/BMP-7 Ratio in Activated HSCs

When compared to those of quiescent HSCs (control group), significant increase in the mRNA and protein levels of TGF- was detected in activated HSCs (model group) (, Figures 2(a)2(c)). Meanwhile, the mRNA and protein levels of BMP-7 were dramatically downregulated in activated HSCs (control group versus model group, ). In contrast, treatment of FZHY-containing serum dose-dependently reduced the mRNA level of TGF-, whereas it restored the mRNA level of BMP-7 (Figure 2(a)). Western blot further confirmed that the changes in TGF- and BMP-7 transcription were paralleled by 3.29-fold decrease in TGF- protein expression (model group versus 20% FZHY-treated group, ) and 7.71-fold increase in BMP-7 protein expression (model group versus 20% FZHY-treated group, ) after the treatment of FZHY recipe (Figures 2(b) and 2(c)).

According to the expression of TGF- and BMP-7, there was statistical upregulation of TGF-/BMP-7 ratio in activated HSCs at both transcriptional and translational levels (control group versus model group, , Figure 2(d)). However, administration of FZHY recipe, no matter the 5% FZHY-, 10% FZHY-, and 20% FZHY-treated groups, resulted in the normalization of TGF-/BMP-7 ratio (Figure 2(d)), suggesting a regulatory role in the balance of EMT and MET.

3.2. Restoration of TGF-/BMP-7 Ratio Attenuated EMT and Induced MET of HSCs via p38 MAPK Signaling

To assess the effect of TGF-/BMP-7 ratio on EMT/MET balance, we evaluated the downstream signaling of p38 MAPK, and then epithelial marker (E-cadherin) and mesenchymal markers (α-SMA and desmin) in quiescent, activated, and FZHY-treated HSCs, respectively. In contrast to the greatly upregulated transcription of p38 MAPK, α-SMA, and desmin in activated HSCs (control group versus model group, ), their mRNA levels reduced after FZHY administration in a dose-dependent manner (Figures 2(a), 3(a)). On the contrary, the E-cadherin expression of activated HSCs was over 64.51% lower than the normal level (control group versus model group, ), while treatment of FZHY recipe led to about 6.48-fold upregulation in its mRNA level (model group versus 20% FZHY-treated group, ) (Figure 3(a)). Similarly to the changes in transcription, declined protein level of E-cadherin and increased protein levels of p38 MAPK, p-p38 MAPK, α-SMA, and desmin characterized the activation of HSCs (control group versus model group, ) (Figures 2(b) and 2(c), 3(b) and 3(c)). However, FZHY-treated HSCs, with exposure to 10% and 20% FZHY-containing serum for 48 hours, demonstrated p38 MAPK, p-p38 MAPK, E-cadherin, α-SMA, and desmin levels comparable with those of quiescent HSCs (Figures 2(b) and 2(c), 3(b) and 3(c)). Thus the p38-dependent recovery from EMT to MET was indicated in FZHY-treated HSCs.

3.3. Rebalance of EMT and MET by FZHY Administration Abolished HSCs with Activated Phenotype In Vivo

No α-SMA positive cell was found in hepatic lobules of normal control group, indicating no activated HSC existed. However, numerous α-SMA positive cells with spindle or asteroid shape, most of which located in sinusoidal space, central vein, and fibrous tissue, were observed in rats exposure to CCl4 for 6 weeks (model group, Figure 4). At higher magnification of microscopy, the number of α-SMA positive cells rised up to 36.7 ± 11.4 per field (control group versus model group, ). Dramatically, only 16.9 ± 8.9  α-SMA positive cells per field could be detected in the high-dose FZHY-treated group, which was significantly lower than that in the model group (, Figure 4).

3.4. Treatment of FZHY Recipe Inhibited CCl4-Induced Liver Fibrosis

When compared with the normal control group, hepatic micro- and macrovesicular steatosis characterized the model group after CCl4 exposure. Other pathological disorders, including ballooning degeneration of hepatocytes, infiltration of inflammatory cells in lobules, and active proliferation of myofibroblast, were also visualized (Figure 5). Contrastively, most of these alternations were attenuated after different dosage of FZHY treatment (Figure 5).

The VG staining uncovered similar phenomenon that little fibrosis existed in the liver of normal control rats, while excessive collagen deposition and well-delineated fibrosis septa emerged in the model group. Fibrous tissue is widely distributed in sinusoidal space and lobule, sometimes even bridging central vein and portal regions (Figure 6). After the treatment of FZHY recipe for 4 weeks, Metavir scores revealed the great improvement of liver fibrosis from 2.49 ± 0.61 (model group) to 1.57 ± 0.49 (medium-dose FZHY-treated group, ), and 1.08 ± 0.33 (high-dose FZHY-treated group, ) (Figure 6).

4. Discussion

Recently, increased studies have revealed the potential of FZHY recipe in prevention and treatment of organic fibrosis, such as hepatic, renal interstitial, and myocardial fibrosis [25, 11]. Similar to other traditional Chinese prescriptions, a variety of mechanisms are now recognized to underlie the effect of FZHY recipe, which includes (1) preventing HSCs from activation, as well as promoting their apoptosis; (2) inhibiting the proliferation of HSCs; (3) downregulating the expression and secretion of collagen; (4) inducing the activation of matrix metalloproteases; (5) protecting hepatocytes from apoptosis and facilitating their proliferation; (6) improving the liver function test; and (7) normalizing the proteome of liver tissue [2, 3, 5, 11]. However, these complicated mechanisms make it a difficult task to identify the comprehensive effect of FZHY recipe.

Balance of EMT and MET takes a central place in the activation of HSCs. HSCs which underwent EMT demonstrate most fibrosis-inducing characteristics, including migration towards the lesions, secretion of cytokines (TGF-, PDGF, etc.), and synthesis of ECM (collagen, laminine, hyaluronic acid, etc.) [20, 21]. MET represents the counteracting process against EMT-related fibrotic response [9]. Nowadays, transdifferentiation between EMT and MET is indicated to be tightly controlled by cytokines, especially TGF- and BMP-7 [6]. After being incubated with FZHY-containing serum for 48 hours, HSCs showed dose-dependent reduction of TGF- expression in the 10% and 20% FZHY-treated groups. On the other hand, both the mRNA and protein levels of BMP-7, which experienced expression loss during EMT, upregulated significantly in the HSCs of 5%, 10%, and 20% FZHY-treated groups. TGF-/BMP-7 ratio was finally normalized in the groups of FZHY administration, mimicking that of the control group. Therefore, FZHY recipe may exert its effects via regulating TGF-/BMP-7 ratio in a dose-dependent manner.

MAPK signaling acts as the common pathway downstream to TGF- and BMP-7 stimulation [22]. p38 MAPK among MAPK family has been proved to mediate the TGF--induced synthesis of procollagen I in murine glomerular mesangial cells and seems to be indispensible for the glomerular sclerosis [23, 24]. Moreover, activation of p38 MAPK plays an essential role in the TGF--induced expression of mesenchymal marker (α-SMA) in human vascular smooth muscle cells [25]. Thus activation of p38 MAPK signaling, partially in the form of phosphorylated p38 MAPK, may reflect the key step from high TGF-/BMP-7 ratio to EMT/MET unbalance. In contrast to their limited expression in the control group, elevated p38 MAPK and p-p38 MAPK in the model group indeed characterized the activation of p38 MAPK signaling during EMT of HSCs in our experiments. Dramatically, treatment of 10% and 20% FZHY-containing serum effectively inactivated p38 MAPK signaling by downregulating the expression and phosphorylation of p38 MAPK.

To shed light on the p38-mediated effect on phenotypic regulation, markers specific to mesenchymal and epithelial cells were subjected to investigation. E-cadherin, an epithelial cell specific transmembrane glycoprotein, forms complex with α-catenin, β-catenin, and catenin p120, which maintains the polarity of quiescent HSCs by binding to skeleton proteins. Significant decrease of E-cadherin contributes to the cytoskeleton rearrangement and polarity loss, and then EMT of HSCs [26]. In the present study, both the mRNA and protein levels of E-cadherin were significantly higher in the 10% and 20% FZHY-treated groups rather than those in the model group. Opposite to its promotional action on E-cadherin, treatment of FZHY-containing serum led to the inhibition of mesenchymal markers in HSC [27]. When determined with QPCR and Western blot, the expression levels of α-SMA and desmin were significantly lowered in the 5%, 10%, and 20% FZHY-treated groups than the controls. Moreover, the level of α-SMA and desmin proteins in the 10% and 20% FZHY-treated groups were in parallel to the normal control group, while the mRNA of α-SMA and desmin in these two groups were even lower than those in the normal control group. These observations qualify FZHY for a potential recipe to abrogate EMT and induce MET in HSCs.

Facilitating the transdifferentiation from EMT to MET, FZHY recipe is likely to ameliorate liver fibrosis by means of removing HSCs with EMT characteristics. In vivo treatment of FZHY recipe was then performed in the rodent model of CCL4-induced liver fibrosis. When compared to that of the control group, there were much more α-SMA-positive HSCs in the fibrous septum and sinusoid of the model group. FZHY therapy, however, statistically reduced these EMT signals specific to fibrosis-inducing HSCs. Being consistent with previous reports [2, 3, 11], attenuation of liver fibrosis was resultantly achieved by FZHY recipe. The Metavir score in high-dose FZHY-treated group was only 1.08 ± 0.33, which was significantly lower than that in the model group (2.49 ± 0.61, ).

5. Conclusions

FZHY recipe may downregulate the TGF-/BMP-7 ratio and, subsequently, result in the reversal of EMT to MET in activated HSCs via the inhibition of p38 MAPK signaling pathway. The rebalance of EMT and MET by FZHY recipe serves as a novel resolution of liver fibrosis on the basis of reducing HSCs with EMT characteristics.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Authors’ Contribution

Qin Pan and Yu-Qin Wang contributed equally to this paper.

Acknowledgments

The work is supported by State Key Development Program for Basic Research of China (2012CB517501), “Bai Yang” Basic Research Program for Liver Fibrosis, National Natural Science Foundation of China (81270491, 81470840, 81070322, 81270492, and 81070344), 100 Talents Program (Shanghai Board of Health, XBR2011007), Science Foundation of Shanghai Jiaotong University (YZ1064, YG2012NS37), and Program of the Shanghai Committee of Science and Technology (13ZR1426700).

References

  1. C.-J. Guo, Q. Pan, D.-G. Li, H. Sun, and B.-W. Liu, “miR-15b and miR-16 are implicated in activation of the rat hepatic stellate cell: an essential role for apoptosis,” Journal of Hepatology, vol. 50, no. 4, pp. 766–778, 2009. View at: Publisher Site | Google Scholar
  2. Y.-N. Song, J.-J. Sun, Y.-Y. Lu et al., “Therapeutic efficacy of fuzheng-huayu tablet based traditional Chinese medicine syndrome differentiation on hepatitis-B-caused cirrhosis: a multicenter double-blind randomized controlled trail,” Evidence-Based Complementary and Alternative Medicine, vol. 2013, Article ID 709305, 8 pages, 2013. View at: Publisher Site | Google Scholar
  3. P. Liu, Y.-Y. Hu, C. Liu et al., “Multicenter clinical study on Fuzhenghuayu capsule against liver fibrosis due to chronic hepatitis B,” World Journal of Gastroenterology, vol. 11, no. 19, pp. 2892–2899, 2005. View at: Publisher Site | Google Scholar
  4. Q.-L. Wang, J.-L. Yuan, Y.-Y. Tao, Y. Zhang, P. Liu, and C.-H. Liu, “Fuzheng Huayu recipe and vitamin E reverse renal interstitial fibrosis through counteracting TGF-β1-induced epithelial-to-mesenchymal transition,” Journal of Ethnopharmacology, vol. 127, no. 3, pp. 631–640, 2010. View at: Publisher Site | Google Scholar
  5. C. Liu, P. Liu, C.-H. Liu, X.-Q. Zhu, and G. Ji, “Effects of Fuzhenghuayu decoction on collagen synthesis of cultured hepatic stellate cells, hepatocytes and fibroblasts in rats,” World Journal of Gastroenterology, vol. 4, no. 6, pp. 548–549, 1998. View at: Google Scholar
  6. D. Firrincieli, M. Boissan, and N. Chignard, “Epithelial-mesenchymal transition in the liver,” Gastroenterologie Clinique et Biologique, vol. 34, no. 10, pp. 523–528, 2010. View at: Publisher Site | Google Scholar
  7. W.-R. Bi, C.-Q. Yang, and Q. Shi, “Transforming growth factor-β1 induced epithelial-mesenchymal transition in hepatic fibrosis,” Hepato-Gastroenterology, vol. 59, no. 118, pp. 1960–1963, 2012. View at: Publisher Site | Google Scholar
  8. R. Vargha, M. Endemann, K. Kratochwill et al., “Ex vivo reversal of in vivo transdifferentiation in mesothelial cells grown from peritoneal dialysate effluents,” Nephrology Dialysis Transplantation, vol. 21, no. 10, pp. 2943–2947, 2006. View at: Publisher Site | Google Scholar
  9. G. Xie and A. M. Diehl, “Evidence for and against epithelial-to-mesenchymal transition in the liver,” American Journal of Physiology—Gastrointestinal and Liver Physiology, vol. 305, no. 12, pp. G881–G890, 2013. View at: Publisher Site | Google Scholar
  10. G. Yang, Z. Zhu, Y. Wang, A. Gao, P. Niu, and L. Tian, “Bone morphogenetic protein-7 inhibits silica-induced pulmonary fibrosis in rats,” Toxicology Letters, vol. 220, no. 2, pp. 103–108, 2013. View at: Publisher Site | Google Scholar
  11. P. Liu, “Fuzheng huayu capsule in the treatment of liver fibrosis: clinical evidence and mechanism of action,” Chinese Journal of Integrative Medicine, vol. 18, no. 5, pp. 398–400, 2012. View at: Publisher Site | Google Scholar
  12. H. Iwama, S. Amagaya, and Y. Ogihara, “Effect of shosaikoto, a Japanese and Chinese traditional herbal medicinal mixture, on the mitogenic activity of lipopolysaccharide: a new pharmacological testing method,” Journal of Ethnopharmacology, vol. 21, no. 1, pp. 45–53, 1987. View at: Publisher Site | Google Scholar
  13. K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. View at: Publisher Site | Google Scholar
  14. D. C. Lee, C. J. Stenland, R. C. Hartwell et al., “Monitoring plasma processing steps with a sensitive Western blot assay for the detection of the prion protein,” Journal of Virological Methods, vol. 84, no. 1, pp. 77–89, 2000. View at: Publisher Site | Google Scholar
  15. C.-J. Guo, Q. Pan, T. Cheng, B. Jiang, G.-Y. Chen, and D.-G. Li, “Changes in microRNAs associated with hepatic stellate cell activation status identify signaling pathways,” FEBS Journal, vol. 276, no. 18, pp. 5163–5176, 2009. View at: Publisher Site | Google Scholar
  16. Y. Liu, P. Liu, Y.-Y. Hu et al., “Dynamic change of metabolism related protein in liver tissue of rats' model of hepatic fibrosis and regulatory effect of fuzheng huayu decoction on it,” Zhongguo Zhong Xi Yi Jie He Za Zhi, vol. 26, no. 3, pp. 224–227, 2006. View at: Google Scholar
  17. D. Cassiman, C. Denef, V. J. Desmet, and T. Roskams, “Human and rat hepatic stellate cells express neurotrophins and neurotrophin receptors,” Hepatology, vol. 33, no. 1, pp. 148–158, 2001. View at: Publisher Site | Google Scholar
  18. H.-S. Lee, C.-T. Shun, L.-L. Chiou, C.-H. Chen, G.-T. Huang, and J.-C. Sheu, “Hydroxyproline content of needle biopsies as an objective measure of liver fibrosis: emphasis on sampling variability,” Journal of Gastroenterology and Hepatology, vol. 20, no. 7, pp. 1109–1114, 2005. View at: Publisher Site | Google Scholar
  19. A. Shlomai, P. Halfon, I. Goldiner et al., “Serum bile acid levels as a predictor for the severity of liver fibrosis in patients with chronic hepatitis C,” Journal of Viral Hepatitis, vol. 20, no. 2, pp. 95–102, 2013. View at: Publisher Site | Google Scholar
  20. I. J. Cho, Y. W. Kim, C. Y. Han et al., “E-cadherin antagonizes transforming growth factor β1 gene induction in hepatic stellate cells by inhibiting RhoA-dependent Smad3 phosphorylation,” Hepatology, vol. 52, no. 6, pp. 2053–2064, 2010. View at: Publisher Site | Google Scholar
  21. Y. Chen, Q. Luo, Z. Xiong, W. Liang, L. Chen, and Z. Xiong, “Telmisartan counteracts TGF-β1 induced epithelial-to-mesenchymal transition via PPAR-γ in human proximal tubule epithelial cells,” International Journal of Clinical and Experimental Pathology, vol. 5, no. 6, pp. 522–529, 2012. View at: Google Scholar
  22. M. Yoshikawa, K. Hishikawa, T. Marumo, and T. Fujita, “Inhibition of histone deacetylase activity suppresses epithelial-to-mesenchymal transition induced by TGF-β1 in human renal epithelial cells,” Journal of the American Society of Nephrology, vol. 18, no. 1, pp. 58–65, 2007. View at: Publisher Site | Google Scholar
  23. B. Y. Chin, A. Mohsenin, S. X. Li, A. M. K. Choi, and M. E. Choi, “Stimulation of pro-α(1)(I) collagen by TGF-β1 in mesangial cells: role of the p38 MAPK pathway,” The American Journal of Physiology—Renal Physiology, vol. 280, no. 3, pp. F495–F504, 2001. View at: Google Scholar
  24. J. Yang and Y. Liu, “Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis,” American Journal of Pathology, vol. 159, no. 4, pp. 1465–1475, 2001. View at: Publisher Site | Google Scholar
  25. A. Martin-Garrido, D. I. Brown, A. N. Lyle et al., “NADPH oxidase 4 mediates TGF-β-induced smooth muscle α-actin via p38MAPK and serum response factor,” Free Radical Biology and Medicine, vol. 50, no. 2, pp. 354–362, 2011. View at: Publisher Site | Google Scholar
  26. M. Izumiya, A. Kabashima, H. Higuchi et al., “Chemoresistance is associated with cancer stem cell-like properties and epithelial-to-mesenchymal transition in pancreatic cancer cells,” Anticancer Research, vol. 32, no. 9, pp. 3847–3853, 2012. View at: Google Scholar
  27. C. H. Österreicher, M. Penz-Österreicher, S. I. Grivennikov et al., “Fibroblast-specific protein 1 identifies an inflammatory subpopulation of macrophages in the liver,” Proceedings of the National Academy of Sciences of the United States of America, vol. 108, no. 1, pp. 308–313, 2011. View at: Publisher Site | Google Scholar

Copyright © 2015 Qin Pan et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views1522
Downloads1108
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.