International Journal of Endocrinology

International Journal of Endocrinology / 2014 / Article

Research Article | Open Access

Volume 2014 |Article ID 185974 | https://doi.org/10.1155/2014/185974

Katja Dumic, Tony Yuen, Zorana Grubic, Vesna Kusec, Ingeborg Barisic, Maria I. New, "Two Novel CYP11B1 Gene Mutations in Patients from Two Croatian Families with 11β-Hydroxylase Deficiency", International Journal of Endocrinology, vol. 2014, Article ID 185974, 6 pages, 2014. https://doi.org/10.1155/2014/185974

Two Novel CYP11B1 Gene Mutations in Patients from Two Croatian Families with 11β-Hydroxylase Deficiency

Academic Editor: Małgorzata Kotula-Balak
Received09 Feb 2014
Revised01 May 2014
Accepted05 May 2014
Published02 Jun 2014

Abstract

Steroid 11β-hydroxylase deficiency (11β-OHD) is the second most common cause of congenital adrenal hyperplasia. Mutations in the CYP11B1 gene, which encodes steroid 11β-hydroxylase, are responsible for this autosomal recessive disorder. Here, we describe the molecular genetics of two previously reported male siblings in whom diagnosis of 11β-OHD has been established based on their hormonal profiles displaying high levels of 11-deoxycortisol and hyperandrogenism. Both patients are compound heterozygous for a novel p.E67fs (c.199delG) mutation in exon 1 and a p.R448H (c.1343G>A) mutation in exon 8. We also report the biochemical and molecular genetics data of one new 11β-OHD patient. Sequencing of the CYP11B1 gene reveals that this patient is compound heterozygous for a novel, previously undescribed p.R141Q (c.422G>A) mutation in exon 3 and a p.T318R (c.953C>G) mutation in exon 5. All three patients are of Croatian (Slavic) origin and there is no self-reported consanguinity in these two families. Results of our investigation confirm that most of the CYP11B1 mutations are private. In order to elucidate the molecular basis for 11β-OHD in the Croatian/Slavic population, it is imperative to perform CYP11B1 genetic analysis in more patients from this region, since so far only four patients from three unrelated Croatian families have been analyzed.

1. Introduction

Congenital adrenal hyperplasia (CAH) is a group of autosomal recessive disorders caused by the loss of one of five steroidogenic enzymes involved in cortisol synthesis. Approximately 90–95% of all cases are due to steroid 21-hydroxylase deficiency, and about 3–8% are caused by steroid 11β-hydroxylase deficiency (11β-OHD) [13]. The deficiency of 11β-OH leads to reduced cortisol biosynthesis, increased ACTH secretion, and overproduction of steroid precursors. These precursors are shunted toward androgen synthesis, resulting in hyperandrogenism. Phenotypical expression of classic 11β-OHD leads to virilization of external genitalia in newborn females. The overproduction of reactive androgen also causes precocious pseudopuberty, accelerated somatic growth, and premature epiphyseal closure in both sexes. The accumulation of 11-deoxycorticosterone and its metabolites causes hypertension in about two-thirds of these patients.

The gene for steroid 11β-hydroxylase is encoded by CYP11B1. It is located on chromosome 8q22, approximately 40 kb apart from the highly homologous CYP11B2 gene that encodes the aldosterone synthase. To date, over 90 disease-causing CYP11B1 mutations have been identified [1, 4, 5]. Notably, a high incidence of 11β-OHD has been reported, with a disease frequency of about 1 in 5,000–7,000 live births, in Israel among Jewish immigrants from Morocco, a relatively inbred population. Almost all alleles in this patient group carry the same p.R448H (c.1343G>A, rs28934586) missense mutation in exon 8 [68]. Recently, we described one 11β-OHD patient of the Slavic origin who was compound heterozygous for this p.R448H mutation and a novel intron 7 (c.1200+4A>G) splice site mutation [9]. It was the first report of CYP11B1 genetic analysis in a Croatian patient with 11β-OHD.

Here, we further report two novel CYP11B1 mutations from three more patients of the Croatian descent, which include two previously reported brothers [10] and one new patient.

2. Subjects and Methods

2.1. Subjects
2.1.1. Family A

Patient 1 is the older of two sons of healthy nonconsanguineous parents of the Croatian descent. He was diagnosed at 2.5 years of age due to accelerated growth, skeletal maturation, pseudoprecocious puberty, elevated serum levels of 11-deoxycortisol, 17-hydroxyprogesterone (17-OHP), and androgens, and suppressed levels of cortisol, aldosterone, and plasma renin activity (PRA). His blood pressure was high normal. Patient 2 is the younger brother of Patient 1. He was diagnosed at 3 months of age, with clinical presentation almost identical to his older brother, except for a normal blood pressure. Hydrocortisone treatments for both patients were introduced immediately after diagnosis.

Patients 1 and 2, now 30 and 28 years old, respectively, have not been under our pediatric care or taking medication on a regular basis for the past 15 years. They came to us recently for genetic counseling. During this visit, blood was drawn for CYP11B1 gene analysis.

2.1.2. Family B

Patient 3, the first child of healthy nonconsanguineous parents of the Croatian descent, was born spontaneously at term after an uneventful pregnancy. At 2 years of age, he was presented for the first time with growth acceleration and pseudoprecocious puberty. His height was 100 cm (+4.27 SD) and his weight was 19.5 kg (+3.9 SD). He had deep voice, acne, and large phallus (length 7 cm, circumference 4.5 cm). His testes were 2-3 cc, and his pubic hair was Tanner II. Blood pressure was normal (90/45 mmHg). Bone age according to Greulich and Pyle was 5 years. Plasma electrolytes were normal. Biochemical results confirmed diagnosis of 11β-OHD (Table 1) and hydrocortisone treatment (12 mg/m2/day) was subsequently started.


HormonesResultsNormal range

11-deoxycortisol (nmol/L)1860.1–2.0
17-hydroxyprogesterone (nmol/L)361.5–7.0
Androstenedione (nmol/L)50.3–1.5
Testosterone (nmol/L)2.20.1–0.3
Cortisol (nmol/L)102140–690
Aldosterone (pmol/L)160200–800
PRA (μgL−1h−1)1.12.0–5.2

His younger brother was admitted at 6 months of age. He had no signs of accelerated growth and sexual development, and his plasma levels of 11-deoxycortisol, 17-OHP, androgens, aldosterone, and PRA were within normal range for age, suggesting that he was not affected with CAH.

2.2. Hormonal Assays

Blood for biochemical analyses was drawn after an overnight fast. Serum/plasma was either assayed immediately or frozen for later use. Standard recommended biochemical methods for measured parameters were employed.

2.3. DNA Amplification and Sequence Analysis

Genomic DNA was isolated from peripheral leukocytes. Three DNA fragments (exons 1-2, 3–5, and 6–9) of the CYP11B1 gene were amplified by polymerase chain reaction (PCR). Reactions were carried out in 50 μL volume, which contained 100 ng genomic DNA, 10 mM Tris-HCl, pH 8.3, 50 mM potassium chloride, 1.5 mM magnesium chloride, 200 μM deoxynucleotide triphosphates, 2.5 units JumpStart Taq DNA Polymerase (Sigma, St. Louis, MI, USA), and 200 nM each of CYP11B1-specific sense and antisense primers (Table 2). Thermocycling was performed in a Mastercycler (Eppendorf, Hauppauge, NY, USA) with an initial 3-minute denaturation step at 94°C followed by 35 cycles of 94°C for 45 seconds, 58°C for 30 seconds, and 72°C for 3 minutes. The expected amplicon sizes were 0.9 kb, 1.4 kb, and 1.5 kb for the exon 1-2, 3–5, and 6–9 fragments, respectively, and were confirmed by agarose gel electrophoresis. After purification with a QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA), direct sequencing of the amplicons was performed using primers listed in Table 2. The sequencing results were compared to the 7.46 kb human CYP11B1 reference sequence at chromosome 8 (GenBank gi|224589820:c143961236-143953773).


Primer sequenceLocationOrientationPurpose

TCGAAGGCAAGGCACCAGPromotersenseExons 1-2 amplification
TGCTCCCAGCTCTCAGCTIntron 2antisenseExons 1-2 amplification and Exon 1 sequencing
AGAAAATCCCTCCCCCCTAIntron 2senseExons 3–5 amplification
GACACGTGGGCGCCGTGTGAIntron 5antisenseExons 3–5 amplification
TGACCCTGCAGCTGTGTCTIntron 5senseExons 6–9 amplification
GAGACGTGATTAGTTGATGGCExon 9, 3′ UTRantisenseExons 6–9 amplification
CACCAGGCAAGATAAAAGPromotersenseExon 1 sequencing
AGACACTTTGGATTGGGACIntron 1senseExon 2 sequencing
AGGATGCACTGCTGAGCACIntron 3antisenseExon 3 sequencing
GTGGAGAGGGAGAAATTGGGIntron 4antisenseExon 4 sequencing
AGGATGTTTCCCAGCACCAAAGIntron 4senseExon 5 sequencing
ATTCCAGAGGAAGAAGAGCIntron 6antisenseExon 6 sequencing
CATGGATCTGGGACCTCTGIntron 6senseExon 7 sequencing
AGGCCAGTCCCACATTGCTCIntron 8antisenseExon 8 sequencing
CCCCCTTCAGCATAATCTCIntron 8senseExon 9 sequencing

(Footnote) 3′ UTR: 3′ untranslated region.

3. Results

More than two decades ago, at a time before modern molecular diagnostic tools were available, we described two brothers (Patients 1 and 2) with 11β-OHD [9]. These two patients recently visited our clinic for genetic counseling. This gave us an opportunity to perform genetic analysis of their CYP11B1 gene. DNA sequencing results showed that both patients carried a novel p.E67fs (p.E67Kfs9, c.199delG) frameshift mutation in exon 1 and a previously reported p.R448H (c.1343G>A) missense mutation in exon 8 (Figures 1 and 3). The p.E67fs mutation causes a reading frame shift, resulting in premature translation termination at codon 75.

For Patient 3, deficiency of 11β-OH was suspected on the basis of his clinical presentation. This is confirmed by hormonal analyses, which showed elevated serum levels of 11-deoxycortisol, androstenedione, testosterone, and 17-OHP and suppressed levels of cortisol, aldosterone, and plasma renin activity (Table 1). Genetic analysis of the CYP11B1 gene revealed that Patient 3 carried a novel, previously undescribed p.R141Q (c.422G>A, rs26701810) missense mutation in exon 3 and a previously reported p.T318R (c.953C>G) missense mutation in exon 5 (Figures 2 and 3) [11].

In both families, DNA of the parents was not available for genetic analysis. Since all three patients have clear clinical and biochemical characteristics of 11β-OHD, we assume that the patients are compound heterozygotes, and that the mutations are located on different alleles.

4. Discussion

Patients 1, 2, and 3 were presented at the age of 2.5 years, 3 months, and 2 years, respectively, with characteristic features for boys with 11β-OHD. Accelerated somatic growth and skeletal maturation and pseudoprecocious puberty were found in all three patients. Although their blood pressure was normal, their hormonal profile was distinctive of 11β-OHD, with elevated serum levels of 11-deoxycortisol, 17-OHP, and androgens and suppressed levels of cortisol, aldosterone, and PRA.

At present, over 90 different CYP11B1 gene mutations have been described. Whereas the majority of these are missense and nonsense mutations, other mutations have also been reported, which include splice site mutations, small and large deletions/insertions, and complex rearrangements. These mutations are distributed over the entire coding region but tend to cluster in exons 2, 6, 7, and 8 [1, 2].

There is no consistent correlation between a specific CYP11B1 gene mutation and the clinical phenotype of 11β-OHD. Distinctive phenotypic variability exists in patients with the same mutation regarding the onset of symptoms, the age of diagnosis, the degree of virilization, or the severity of hypertension [1, 2]. Nonetheless, based on in vitro expression data, the p.R448H mutation completely abolished 11β-hydroxylase enzymatic activity [12]. The c.199delG frameshift mutation should result in premature translational termination and production of a nonfunctional protein. The compound heterozygous c.199delG/p.R448H mutation therefore predicts a severe classic CAH phenotype in Patients 1 and 2. Similarly, the T318 residue is completely conserved in all known P450 enzymes. Any changes in this position, for example, either a p.T318 M or a p.T318R mutation, causes loss of 11β-hydroxylase activity [1]. Although the consequence of the p.R141Q mutation is unknown, based on the severe clinical phenotype observed in Patient 3, we predict that the p.R141Q mutation causes major loss of 11β-hydroxylase activity. The mutation of a positively charged arginine to an uncharged glutamine residue could break a salt bridge necessary for maintaining conformational stability of the enzyme. In silico mutation analyses were performed using PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/), SIFT (http://sift.jcvi.org/), and Provean (http://provean.jcvi.org/) software. All three software predicted a damaging effect of the p.R141Q mutation on CYP11B1 function (Table 3). That p.R141 is conserved in the mammalian CYP11B1 protein further suggests an important role of this residue at this position (Figure 4).


Prediction softwareScorePrediction of Effects of Mutation

PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2)1.000Probably Damaging
SIFT (http://sift.jcvi.org)0.000Damaging
Provean (http://provean.jcvi.org)−3.769Deleterious

Most of the reported mutations are private, family-specific mutations. However, in some ethnic groups, particularly in families with high rate of consanguinity, ethnic-specific CYP11B1 mutations in homozygous forms have been described. These include the p.R448H mutation identified among Jewish immigrants from Morocco [5, 6, 13, 14]. The p.Q356X (c.1066C>T, rs146124466) and p.G379V (c.1136G>T) mutations are associated mostly with 11β-OHD patients from Tunisia, although some patients with p.Q356X mutation have also been described in patients originating from Africa [12, 15].

Our families with 11β-OHD patients are all of the Croatian (Slavic) origin, and there is no self-reported consanguinity. Mutation analysis of the CYP11B1 gene revealed that the p.R448H mutation was present not only in one previously reported Croatian patient [9], but also in Patients 1 and 2. Thus, three patients from two Croatian families carry this mutation, which is otherwise rarely reported in Caucasians [16, 17]. Also, similar to this previously reported patient, all three patients in this study carry novel CYP11B1 mutations in the heterozygous form. This is consistent with former reports that most of the CYP11B1 mutations are private because they can only be found within the same family [13].

To the best of our knowledge, there are no other patients with 11β-OHD in the Slavic population in whom CYP11B1 gene analysis has been performed. Therefore, it is imperative to perform CYP11B1 genetic analysis in more patients from this region. Our investigation should benefit from genetic counseling, prenatal and postnatal diagnosis, and treatment of 11β-OHD in Croatia.

Conflict of Interests

All authors declare that there is no conflict of interests regarding the publication of this paper.

References

  1. S. Nimkarn and M. I. New, “Steroid 11β- hydroxylase deficiency congenital adrenal hyperplasia,” Trends in Endocrinology and Metabolism, vol. 19, no. 3, pp. 96–99, 2008. View at: Publisher Site | Google Scholar
  2. P. W. Speiser and P. C. White, “Congenital adrenal hyperplasia,” New England Journal of Medicine, vol. 349, no. 8, pp. 776–788, 2003. View at: Publisher Site | Google Scholar
  3. V. Tonetto-Fernandes, S. H. V. Lemos-Marini, H. Kuperman, L. M. Ribeiro-Neto, I. T. N. Verreschi, and C. E. Kater, “Serum 21-deoxycortisol, 17-hydroxyprogesterone, and 11-deoxycortisol in classic congenital adrenal hyperplasia: clinical and hormonal correlations and identification of patients with 11β-hydroxylase deficiency among a large group with alleged 21-hydroxylase deficiency,” Journal of Clinical Endocrinology and Metabolism, vol. 91, no. 6, pp. 2179–2184, 2006. View at: Publisher Site | Google Scholar
  4. S. Parajes, L. Loidi, N. Reisch et al., “Functional consequences of seven novel mutations in the CYP11B1 gene: four mutations associated with nonclassic and three mutations causing classic 11β-hydroxylase deficiency,” Journal of Clinical Endocrinology and Metabolism, vol. 95, no. 2, pp. 779–788, 2010. View at: Publisher Site | Google Scholar
  5. C. J. Peters, T. Nugent, L. A. Perry et al., “Cosegregation of a novel homozygous CYP11B1 mutation with the phenotype of non-classical congenital adrenal hyperplasia in a consanguineous family,” Hormone Research, vol. 67, no. 4, pp. 189–193, 2007. View at: Publisher Site | Google Scholar
  6. T. Paperna, R. Gershoni-Baruch, K. Badarneh, L. Kasinetz, and Z. Hochberg, “Mutations in CYP11B1 and congenital adrenal hyperplasia in Moroccan Jews,” Journal of Clinical Endocrinology and Metabolism, vol. 90, no. 9, pp. 5463–5465, 2005. View at: Publisher Site | Google Scholar
  7. A. Rosler and H. Cohen, “Absence of steroid biosynthetic defects in heterozygote individuals for classic 11β-hydroxylase deficiency due to a R448H mutation in the CYP11B1 gene,” Journal of Clinical Endocrinology and Metabolism, vol. 80, no. 12, pp. 3771–3773, 1995. View at: Google Scholar
  8. P. C. White, J. Dupont, M. I. New, E. Leiberman, Z. Hochberg, and A. Rosler, “A mutation in CYP11B1 (Arg-448—His) associated with steroid 11β-hydroxylase deficiency in Jews of Moroccan origin,” Journal of Clinical Investigation, vol. 87, no. 5, pp. 1664–1667, 1991. View at: Google Scholar
  9. K. Dumic, R. Wilson, P. Thanasawat et al., “Steroid 11-beta hydroxylase deficiency caused by compound heterozygosity for a novel mutation in intron 7 (IVS 7 DS + 4A to G) in one CYP11B1 allele and R448H in exon 8 in the other,” European Journal of Pediatrics, vol. 169, no. 7, pp. 891–894, 2010. View at: Publisher Site | Google Scholar
  10. M. Dumić, V. Plavsić, L. Brkljacić et al., “Congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency—different HLA genotypes in 2 brothers,” Lijecnicki Vjesnik, vol. 105, no. 4, pp. 145–149, 1983. View at: Google Scholar
  11. D. P. Merke, T. Tajima, A. Chhabra et al., “Novel CYP11B1 mutations in congenital adrenal hyperplasia due to steroid 11β-hydroxylase deficiency,” Journal of Clinical Endocrinology and Metabolism, vol. 83, no. 1, pp. 270–273, 1998. View at: Publisher Site | Google Scholar
  12. K. M. Curnow, L. Slutsker, J. Vitek et al., “Mutations in the CYP11B1 gene causing congenital adrenal hyperplasia and hypertension cluster in exons 6, 7, and 8,” Proceedings of the National Academy of Sciences of the United States of America, vol. 90, no. 10, pp. 4552–4556, 1993. View at: Google Scholar
  13. A. Bhangoo, R. Wilson, M. I. New, and S. Ten, “Donor splice mutation in the 11β-hydroxylase (CYP11B1) gene resulting in sex reversal: a case report and review of the literature,” Journal of Pediatric Endocrinology and Metabolism, vol. 19, no. 10, pp. 1267–1282, 2006. View at: Google Scholar
  14. F. C. Soardi, J. Y. Penachioni, G. Z. Justo et al., “Novel mutations in CYP11B1 gene leading to 11β-hydroxylase deficiency in Brazilian patients,” Journal of Clinical Endocrinology and Metabolism, vol. 94, no. 9, pp. 3481–3485, 2009. View at: Publisher Site | Google Scholar
  15. M. Kharrat, S. Trabelsi, M. Chaabouni et al., “Only two mutations detected in 15 Tunisian patients with 11β-hydroxylase deficiency: the p.Q356X and the novel p.G379V,” Clinical Genetics, vol. 78, no. 4, pp. 398–401, 2010. View at: Publisher Site | Google Scholar
  16. S. Geley, K. Kapelari, K. Jöhrer et al., “CYP11B1 mutations causing congenital adrenal hyperplasia due to 11β-hydroxylase deficiency,” Journal of Clinical Endocrinology and Metabolism, vol. 81, no. 8, pp. 2896–2901, 1996. View at: Publisher Site | Google Scholar
  17. A. G. Sido, M. M. Weber, P. G. Sido, S. Clausmeyer, U. Heinrich, and E. Schulze, “21-Hydroxylase and 11β-hydroxylase mutations in Romanian patients with classic congenital adrenal hyperplasia,” Journal of Clinical Endocrinology and Metabolism, vol. 90, no. 10, pp. 5769–5773, 2005. View at: Publisher Site | Google Scholar

Copyright © 2014 Katja Dumic et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views1562
Downloads648
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.