International Scholarly Research Notices

International Scholarly Research Notices / 2013 / Article

Research Article | Open Access

Volume 2013 |Article ID 828060 | 18 pages | https://doi.org/10.1155/2013/828060

Proteomics Characterization of the Secretome from Rat Pancreatic Stellate Cells with ATP-Binding Cassette Transporters (ABCG2) and NCAM Phenotype

Academic Editor: A. Hergovich
Received01 Jul 2013
Accepted04 Aug 2013
Published31 Oct 2013

Abstract

We have previously reported the identification of a pancreata mitoxantrone-resistant cell population which expressed the ABCG2 transporter with a pancreatic stellate cells phenotype (PaSC) and ability of secreting insulin after inducing their differentiation. The characterization of the secretome of this cell population by two-dimensional electrophoresis (2D) coupled with mass spectrometry MALDI-TOF was able to identify seventy-six protein spots involved in different cellular processes: development/differentiation, proteases, immune response, and other. Moreover, Ingenuity Pathway Analysis displayed several significant networks and TGFβ1 molecule was identified as a central node of one of them. The effect of this active molecule secreted in the conditioned medium was investigated in ductal cell line (ARIP). The results showed that the conditioned medium inhibited their proliferation without affecting their cell viability. Additionally, they showed an upregulation of PDX1 and downregulation of CK19. The rate of ARIP cell proliferation was recovered, but no effects on the gene expression were observed after using TGFβ1-neutralising antibody. Proteins associated with cell growth, development and differentiation such as PEDF, LIF, and Wnt5b, identified in the secretome, could be involved in the observed transcription changes. These finding may suggest a new paracrine action of PaSCs involved in the proliferation and differentiation pathways not yet identified.

1. Introduction

Pancreatic stellate cells (PaSC) were first described in 1998 and constitute nearly 4% of total pancreatic cells [1]. PaSCs are located in the periacinar space and can also be found in the periductal regions of the pancreas [2]. These cells have long cytoplasmatic processes resulting in a typical “stellate” appearance. They share morphological and functional characteristics with the hepatic stellate cells and can present different phenotypes: quiescent cells, with capacity to storage vitamin A, and active cells, also so-called myofibroblast-like cells. The active phenotype expresses alpha actin (aSMA), desmin, glial fibrillary acidic protein (GFAP), ABCG2, and NCAM. These latter two markers are expressed in rat and human hepatic stellate cells, and several studies demonstrate that NCAM is involved in the transformation of these cells in myofibroblasts and modulates the adhesive property of cell adhesion [3], and ABCG2 transporter is associated with cell viability and/or activation [4]. They can be useful to select PaSC with a myofibroblast phenotype. Moreover, several studies demonstrated that the soluble factors secreted by PaSCs with active phenotype, which are increased in areas of pancreatic injury, play an important role in pancreas physiology, development of pancreatic fibrosis [5], antigen presentation, phagocytosis phenomena [6], and matrix turnover processes [7].

It is known that endocrine pancreatic tissue is able to regenerate in several species of mammals, including humans. Several studies support the hypothesis that this islet neogenesis in the mature pancreas occurs via cells which are located in or which are associated with the ductal epithelium. Ductal cells have the capacity to transdifferentiate into insulin producing cells, both in animal models and humans [811]. The role of surrounding cells may be important in maintaining their cellular niche, giving them the necessary factors to start the transdifferentiation process. Considering that PaSCs are also present in the same niche as ductal cells, for instance, periacinar and periductal regions, it is likely that PaSC secreted factors could have effects on neighbouring cells, as well as on the putative pancreatic progenitors.

The present study was designed to characterize the secretome of mitoxantrone-resistant cells obtained from lactating rats pancreata expressing the ABCG2 transporter and NCAM markers, with a PaSC phenotype (PaSCs-ABCG2(+)) and ability to secrete insulin after differentiation [12].

2. Materials and Methods

2.1. Primary Cell Culture of Mitoxantrone-Resistant Cells Expressing Active Pancreatic Stellate Cells Phenotype Obtained by Drug Section and Enriched by PSA-NCAM Immunopanning Technique

All animal experimental proceeds were approved by the Institutional Animal Care and Use Committee of the IDIBAPS Research Institute, Barcelona, Spain. Fresh pancreata were removed from lactating rats and digested with collagenase to obtain a primary cell culture. This culture was grown in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco-BRL, Gaithersburg, MD, USA) (25 mM of glucose) supplemented with 10% fetal calf serum (FCS), and 100 U/mL of penicillin and mitoxantrone drug at 8 μM (Sigma-Aldrich St. Louis, MO, USA) was added to the medium. This drug acts through multidrug transporter systems and permits the selection of cells which express the ABCG2 transporter, as described by Mato et al. [12]. The culture was maintained at 37°C in a humidified atmosphere containing 5% CO2 and was expanded and the active pancreatic stellate cell phenotype was checked by immunocharacterization (alpha-actin, vimentin, desmin, chromogranin A, GFAP, and NCAM), RT-PCR expression (ABCG2), or oil-red staining as described by Mato et al. [12]. It is known that in mammals, PSA-NCAM is involved in the development of the nervous system and in tissue remodeling [13] and it also can induce proliferation in activated pancreatic stellate cells. In order to enrich active stellate cells fraction in our primary culture, we performed immunopanning as previously described by Ben-Hur et al. [14] using the sialylated-neural adhesion molecule isoform of NCAM (PSA-NCAM). Petridishes (Falcon Optilux) were first coated with secondary antibody IgM (Sigma-Aldrich) at 1 : 128 in 50 mM Tris-HCl buffer, pH 9.5, for 18 hours at 4°C. The plates were then washed three times in PBS and coated with anti-PSA-NCAM antibody (USBiological, Swampscott, MA, USA) at 1 : 250 dilution in PBS with 0.2% BSA at room temperature for at least 1 hour. Cells were plated at cells/100 mm dish coated for PSA-immunopanning and were allowed to bind at 37°C for 30 minutes. Nonadherent cells, so-called negative fraction, were washed off extensively to discard them. The adherent cells corresponded to the positive fraction that expressed that PSA-NCAM were trypsinised, washed three times, and resuspended in fresh DMEM-F12, and a second PSA-NCAM immunopanning was redone. Before using the positive fraction of the cell in different experiments, the pancreatic stellate cell phenotype was confirmed by immunocytochemistry and flow cytometry each time. After the second immunopanning (positive PSA-NCAM fraction) conditioned media from active PaSCs-ABCG2(+) were collected every 48 hours and frozen at −80°C until used for subsequent analysis. For proteome analysis, conditioned media were collected as described: active PaSCs-ABCG2(+) cells were washed 3 times in PBS and cultured in serum-free media for 24 hours. This media was collected and centrifuged at 5000 g for 10 minutes to remove cell debris, after which the supernatant was frozen at −80°C until use.

2.2. Flow Cytometry

One million PBS-washed cells were resuspended in 875 μL of cold PBS. Then, 125 μL of cold 2% formaldehyde solution was added and the mixture was immediately vortexed for a brief period. The suspension was incubated for 1 hour at 4°C and centrifuged for 5 minutes at 250 g, after which the supernatant was removed. The pellet was gently resuspended in 1 mL of cold blocking solution (0.2% BSA in PBS), and the mixture was incubated for 1 hour at 4°C. One mL of buffer was added and the suspension was spun down for 5 minutes at 250 g. The supernatant was removed, and 50 μL of primary antibody PSA-NCAM (USBiological) was added at a dilution 1 : 10 in blocking solution. The sample was incubated overnight at 4°C in the dark, washed twice with 1 mL of PBS by centrifugation at 250 g for 5 minutes, and resuspended in 500 μL of secondary antibody (IgM, Sigma-Aldrich) at a dilution 1 : 128 in blocking solution. After 1 hour of incubation at 4°C, samples were washed twice with 1 mL of PBS by centrifugation at 250 g for 5 minutes and resuspended in 500 μL of PBS. The labelled cells were analysed on a FACS Calibur (BD, San Jose, CA, USA) by acquisition of 10,000 gated events. Data was stored as listmode files and analysed with CellQuest (BD) and Summit Workstation software.

2.3. ARIP Cell Culture and Treatment

ARIP cell line were obtained from ATCC (CRL-1674 clon) and cultured in ARIP media: DMEM 24 mM glucose plus glutamine, nonessential amino acids, 100 U/mL of penicillin, and 10% FCS. Cells were treated with PaSC conditioned media for 24 or 72 hours. DMEM/F12 (8 mM glucose) supplemented with 10% FCS (PaSCs ABCG2(+) media) were used as basal media. All the experiments were performed using low passages from 16 to 19 of the cell culture.

2.4. Proliferation and Viability Assays

ARIP cells were seeded in 96-well tissue culture plates at a density of 50,000 cells/well and incubated for 24 hours until adherence. Cells were then incubated in serum-free DMEM overnight and exposed to 15% FCS for 24 hours. Cells were either treated with pan TGFβ 20 μg/mL (R&D Systems, Minneapolis, MN, USA), TGFβ1 10 ng/mL (R&D Systems), or nonimmune IgG 20 μg/mL (Dako, Glostrup, Denmark), with the final 4 hours in the presence of 10 μM BrdU. BrdU incorporation into ARIP cell DNA was assessed by measuring the absorbance at 450 nm, following cell proliferation ELISA kits instructions (Roche, Penzberg, Germany).

To conduct the viability assays, ARIP cells were seeded in 96-well tissue culture plates at a density of 50,000 cells/well and incubated for 24 hours until adherence. Cells were then incubated in serum-free DMEM overnight and exposed to 15% FCS for 24 hours, with the final 2 hours in the presence of 0.5 mg/mL MTT (Sigma-Aldrich, St. Louis, Missouri). Finally, 115 μL of isopropanol plus 0.04 N HCl was added, samples were mixed well to dissolve crystals, and absorbance was measured at 575 nm.

2.5. RT-PCR

Total RNA was extracted from ARIP cultures using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). To remove genomic DNA contamination, samples were treated with DNase I (Invitrogen), following the manufacturer’s instructions. In addition, DNA-PCR without RT was included as a control. One μg of total RNA was reverse transcribed in a buffer solution containing 25 nmol/L MgCl2, 100 mmol/L Tris (pH 8.3), 500 mmol/L KCl, RNAguard 39 U/mL (Pharmacia, Uppsala, Sweden), M-MLV-RT 200 U/mL (Gibco, Uxbridge, UK), 10 mmol/L deoxynucleotide triphosphate(s), and random hexamer priming d(N6)5′PO4 (Pharmacia). Complementary DNA (cDNA) was stored at −80°C until use. All PCRs were performed using 35 cycles. PCR products were visualised with 1% agarose gel electrophoresis and ethidium bromide staining.

2.6. Real-Time PCR

Real-time PCR was performed using the double stranded DNA binding dye Power SYBR Green PCR Master Mix using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, California, USA). The sequences of primers used in this study are described in Table 1. A standard curve was generated from five serial dilutions of ARIP cDNA for CK19 and INS1E cDNA for PDX1. Samples were analysed in triplicate, negative controls were included, and PCR products were verified using dissociation curve analysis immediately after RT-PCR. Expressions of all target genes were determined by normalising the respective TATA Binding Protein (TBP) levels as a housekeeping gene. Results were analysed using SDS2.1 software (Applied Biosystems).


NameSequencebpF/RT annealingGenBank accession numbers

CalreticulinGGGCCCCTGATACCAAATGTC467FW57°CXM_001067664
CTCTCGCCGCTGCCTTCCRV
Wnt5b GCGCTGCTGGTGTGGTGAATG415FW60°CXM_342747
CCGGGCTGGGCTGGTTGARV
Calumenin AGCTCCGGGGAAAACTCAG501FW60°CNM_022535
CTCCGCTCATCTCTAACCATAATCRV
SPARC AAACCCCTGCCAGAACCATCATTG415FW60°CNM_012656
CTCCAGGCGCTTCTCGTTCTCGTGRV
DIXDC1 GGGCAAATATGGATAAGGATGAGC435FW57°CNM_001037654
GTGACCGCCCCCGAACCRV
Neuromodulin (GAP 43)CTCCCGTTGCTGATGGTGTGG453FW60.5°CNM_017195
GGTCAGCCTCGGGGTCTTCTTTACRV
Synaptotagmin V CAGGGCAGAACACGCACGCACATA524FW59°CBC_092198
CTCCGGCCCAGCTCCTTCACTTCCRV
Transcobalamin 2 TGGGCCAGCGTCTCTTACCTT508FW60.5°CNM_022534
CCGGCCATGGCTTCTGTGTCRV
PEDF (serpin F1)GGAGCCCGTAGTGGAGGAGGATGA417FW60°CBC_078686
ATGCGAGGGTTGCCAGTGAGGATTRV
AHNAK GTCGGCTCCTCAAGTCTCCATACC482FW57°CXR_005457
TCCCCGACACTTTCACACCATCTRV
DHRS4AGGCGGCTCGGTGGTGATT441FW58°CNM_153315
TGGCGGTGGCAAGGAAGGRV
Glypican 1 variant GCTGCTGCTGCCCGATGACTAT489FW61°CNM_030828
CCGCAGCCCTGGATGACCTTARV
RAB15GCCGGGCCGCTTCCTTCT404FW61°CNM_198749
GCGCTCGCTGCTAATGTCGTARV
ARHGEF2AGACCCGGGAAAAGGAGAAGATGA445FW58°CNM_001012079
TGACGCAGCCCCAGAGGAGACRV
Islet cell autoantigen 1-like TCGGTTTGCTCAAGATAAGTCAGT404FW54.5°CNM_030844
TGGCCCGATGTCTAAAAGTCTCTARV
Leukemia inhibitory factorAGGTCTTGGCCGCAGGGATTG508FW58°CNM_022196
TCGGGGACACAGGGCACATRV
ERABPCATGGTGGTCGAGCTGAAAGAGAA448FW55°CNM_024136
GTAGGGAAGGAGAGGCCAGGTAGGRV
RAB14TCGGGGATATGGGAGTAGGAA541FW54.5°CNM_053589
GGGGCTGAGGGTTTGTGTTGTARV
APG16 autophagy 16-like CGGCCACAGCGGGAAAGTT542FW58°CXM_001067061
CCCACGCCACCGCATTGATAGAAGRV
MMP2GCTGATACTGACACTGGTACTG217FW60°CNM_031054
CAATCTTTTCTGGGAGCTCRV
Collagen IGCCACCTCAAGAGAAGTC440FW58.5°CBC133728.1
ATAGCGACATCGGCAGGATCGRV
VimentinGCCAGCAGTATGAAAGTGTG496FW60°CNM_031140
AGTGGGTGTCAACCAGAGGAARV
Desmin AGACTTGACTCAGGCAGCCAAT384FW60°CNM_022531
CGGAAGTTGAGAGCAGAGAAGGRV
GFAPTGGCCACCAGTAACATGCA538FW60°CNM_017009
GACTCCTTAATGACCTCGCCATRV
TBP ACCCTTCACCAATGACTCCTATG190FW60°CNM_001004198
ATGATGACTGCAGCAAATCGCRV
PDX1 GAGCCCAGCCGCGTTCATCT318FW60°CNM_022852
CCCCGCTCGTTGTCCCGCTACTARV
CK19 ACAGCCAGTACTTCAAGACC690FW57°CAY_464140
CTGTGTCAGCACGCACGTTARV
RTGFB I ACCGCGTGCCAAATGAAGAGGAT464FW55°CL26110.1
TGCCGTGGACAGAGCGAGTTTGATRV
RTGFB II TGGCCGCTGCACATCGTCCTG366FW55°CAF474028.1
CTCGCCCGCCCTTTTCTTTTCCTTRV
RTGFB III AGCAGCGCGGCCCACAGCATC531FW55°CNM_017256.1
GAAGGGGGCATCCAGGGCGAGACTRV
TBP real timeTTCGTGCCAGAAATGCTGAAFWNM_001004198
GTTCGTGGCTCTCTTATTCTCATGRV
PDX1 real timeCCGCGTTCATCTCCCTTTCFWNM_022852
CTCCTGCCCACTGGCTTTTRV
CK19 real timeAAGGTCCAGGACCTTGAGATTGFWAY_464140

The oligonucleotide sequences used for PCR and real-time PCR amplification are summarised in Table 1.

2.7. Immunocharacterization of PDX1 and CK19

ARIP cells were plated in 8-well chamber slides (LAB-TEK, Campbell, CA, USA). After treatment with control or conditioned media for 72 hours, cells were fixed in 4% paraformaldehyde. They were then blocked for 10 minutes at room temperature in 1% BSA and then permeabilized with buffer containing 1% BSA and 0.2% saponin for 30 minutes at room temperature. Primary antibodies (PDX1-1 : 100, Santa Cruz, Santa Cruz, CA, USA; CK19-1 : 500, Dako) were diluted in fresh blocking solution, and the slides were then incubated overnight at 4°C following standard protocols. The reaction was visualised with a fluorescent secondary antibody (1 : 1000) under a Leica fluorescence microscope. 1% BSA was used instead of primary antibodies for control slides.

2.8. Characterisation of the Secreted Proteins from the Active PaSC-ABCG2(+) Conditioned Media

Conditioned media and serum-free conditioned media were collected as described before. Culture media alone (basal) were used as a blank and were also incubated without cells during 24 hours and collected. Centricon Amicon (Millipore, MA, USA) centrifugal filters with a 10 KDa molecular weight cutoff were used to concentrate conditioned media from 10 mL to 200 μL, following the manufacturer’s instructions. Proteins were precipitated using the 2D Clean Up Kit (GE Healthcare, United Kingdom) and were resuspended in a solution containing Tris (30 mM), urea (7 M), thiourea (2 M), and CHAPS (4%) compatible with first dimension isoelectric focusing (IEF). Protein content was quantified using the RC DC protein assay kit (BioRad, Hercules, CA, USA) based on the Lowry assay.

Protein extracts (100 μg) were separated using IPG strips of pH 3–10 (17 cm, BioRad). Two-dimensional electrophoresis was carried out [15]. Briefly, isoelectric focusing was performed in Protean IEF Cell (Biorad) at 62 kVh and second dimension SDS-PAGE were run by overlaying the strips on 12% acrylamide home-made gels. Proteins were visualised using a MS compatible silver stain [16]. Gels were calibrated using MW and pI standards (Biorad). Differential expression of proteins from blank, conditioned media and serum-free conditioned media were analysed using Melanie-III software (BioRad). First, conditioned media and serum-free conditioned media were compared to ensure that serum was not affecting the secretome pattern. Proteins present in the conditioned media (both serum and serum-free), but absent in blank media, were considered as PaSC secreted. Secreted proteins were excised from serum-free conditioned media gels ( ), silver destained and in-gel digested with trypsin (Promega, Madison, WI, USA) 37°C overnight. Peptide extraction was performed and Zip-Tip concentrating and desalting was done [17]. Peptides were analysed by MALDI-TOF MS and proteins were identified by peptide mass fingerprinting [18].

2.9. Amino Acid Sequence Search for Features of Secreted Proteins

The amino acid sequence of the identified proteins was analysed with SecretomeP 2.0 Server. SignalP 3.0, which predicts the presence and location of signal peptide cleavage sites in the N-terminal part (first 70 residues), identified proteins secreted via the classical pathway [19]. If no signal peptide was predicted, but the Neural Network score exceeded a value of 0.5, proteins were classified as secreted via the nonclassical pathways. SignalP 3.0 has been used to identify secreted proteins in other secretome studies [20, 21].

2.10. Detection of TGFβ1 in the Conditioned Media

For TGFβ1 detection, conditioned media were collected as for proteome analysis. One hundred μL/well of the capture antibody (R&D Systems, Minneapolis, MN, USA) diluted 2 μg/mL in PBS was transferred to an ELISA plate and incubated overnight at room temperature. Five separate washing were performed. In the first washing of three times with PBS 0.05% Tween 20, the plate was blocked with PBS containing 5% Tween 20 and 5% sucrose for 1 hour. In the second washing of three times with PBS 0.05% Tween 20, 100 μL of samples (conditioned media) and dilutions of standards of recombinant human TGFβ1 (R&D Systems) were added and incubated for 2 hours at room temperature. In the third washing of three times with PBS 0.05% Tween 20, 100 μL of detection antibody biotinylated anti-TGFβ1 (R&D Systems) at 400 ng/mL was added and incubated 2 hours at room temperature. In the fourth washing of three times with PBS 0.05% Tween 20, 100 μL of streptavidin HRP was added for 20 minutes at room temperature. In the final washing of three times with PBS 0.05% Tween 20, 100 μL of substrate solution was added for 30 minutes, avoiding placing the plate in direct light. 50 μL of 1 M H2SO4 was added to each well and absorbance was measured at 450 nm.

2.11. Statistical Analysis

Results are expressed as mean ± SEM; represents the number of individual PaSC-ABCG2+ preparations. The statistical significance of the differences between groups was estimated using Student’s unpaired -test; * indicate statistical significance with .

3. Results

3.1. Immunopanning PSA-NCAM Enrichment from PaSC-ABCG2(+) Primary Culture

Flow cytometry PSA-NCAM analysis of mitoxantrone-resistant cells maintained in the basal cell culture condition described before showed a 36% of positivity for this marker. In order to conduct the secretome analysis, we enriched the cell population for polysialylated isoforms of the neural cell adhesion molecule (PSA-NCAM) by immunopanning technique, showing an increase of 57% of PSA-NCAM positivity in the first immunopaning up to 80% when the second immunopanning was redone. Then we confirm the active pancreatic stellate phenotype by immunocharacterization and ABCG2 expression each time (data not shown).

3.2. Secretome Analysis of PaSC-ABCG2(+)

Conditioned media were prepared from active PaSC-ABCG2(+) cultured in serum-free conditions and subjected to 2-dimensional gel electrophoresis and silver staining. A preliminary study showed no differences in the secretion pattern between conditioned media and serum-free conditioned media. We decided to use serum-free conditioned media in order to eliminate serum-derived proteins from the media and to potentiate the less abundant proteins secreted from this cell population. The conditioned media 2D gels displayed a mean of 112 protein spots, which were selected for trypsin digestion and mass spectrometry MALDI-TOF analysis, and 76 spots were identified. Figure 1(a) is a representative image showing a 2D gel from PaSC-ABCG2(+) conditioned media with all the proteins identified. The majority of spots contained only single proteins, but in some cases MS analyses indicated a protein mixture. On the other hand, multiple spots flagged the same protein identity, thus suggesting posttranslational modifications or different isoforms. Overall, 61 different proteins were identified in the PaSC-ABCG2(+) secretome. Proteins along with Swiss-Prot accession number, annotations regarding prediction of secretion, and information related to peptide mass fingerprinting identification are listed in Table 2. Functional categories of the identified protein were proteolysis and related proteins, structural and cytoskeleton proteins, associated with cell growth, development, and differentiation, chaperones, metabolism, transport proteins, GTPase-related proteins, immune response, extracellular matrix and related proteins, and retinol related proteins. The identified proteins were analysed with SignalP V3 software which has been used to predict potential protein secretion [20, 21]. Sixty-one percent of the proteins were predicted to be secreted, either via classical pathways, that is, endoplasmic reticulum/Golgi-dependent pathway (contained a signal peptide), or via nonclassical pathways (without signal peptide, but with a Neural Network score superior than 0.5) (Table 2). The rest of the proteins were not predicted to be secreted by the current available software. However, we cannot exclude secretion via undescribed nonclassical mechanisms. Overall, we detected 37 soluble factors with a described secretion signature. Further analyses were performed by RT-PCR on a subset of candidate proteins in order to confirm the results obtained from proteomic analysis. For instance, we verified the identity of those factors relevant for their biological function and the ones that were identified as a gender different from rats. The proteins confirmed that the RNA levels are included in Figure 1(b). Among these proteins were some novel findings, including serpin family member PEDF, Wnt5b, and LIF. They were reported for the first time to be secreted by PaSC-ABCG2(+).


Protein numberProtein nameUniProt IDpI (T)MW (T)pI (E)MW (E)n.pep% Cov Secretion

Proteolysis and related proteins
1Procollagen C-endopeptidase enhancer 1O086288,2480007,1557938181
1Procollagen C-endopeptidase enhancer 1O086288,2480007,6557937181
1Procollagen C-endopeptidase enhancer 1O086288,2480006,75650911331
1Procollagen C-endopeptidase enhancer 1O086288,2480006,25710810281
272 kDa type IV collagenase (MMP2)P334365,1620005,06883416261
3Alpha-2 antiplasmin Q80ZA36460005,55239510281
3Alpha-2 antiplasmin Q80ZA36460005,4533739261
4Isoform 4 of ubiquitin carboxyl-terminal hydrolase 15Q8R5H1-45,4260005,3317768382
5Adult male cDNA proteasome regulatory particleQ8C1T24,9280004,9317765223
6Cathepsin B.Q6IN225,5380005,1426296231
7ATPase 3 (Fragment)Q6PW166,2140007,1279887572

Structural and cytoskeleton proteins
8Glial fibrillary acidic protein (fragment) Q866S95,2480004,74434211242
8Glial fibrillary acidic protein (fragment) P039955,4500005,0317769212
9Testis cDNA, similar to human desminQ4R7K65,1240004,72407012382
10VimentinP310005,1540004,52308515222
10VimentinP310005,1540005,12277714232
10VimentinP310005,1540004,62113817282
10VimentinP310005,1540004,62082513222
11Tropomyosin-1Q605274,6330004,64036516513
11Tropomyosin alpha isoformQ923Z24,7330004,6368768243
11Tropomyosin isoform 8 of P04692P04692-84,8290004,9375907243
11Tropomyosin isoform 4 of P04692P04692-44,8290005,44256410383
12Alpha-tropomyosin 3Q636074,7330009,34960511292
13Tropomyosin 3, gammaQ8K0Z54,7330004,82773910323
14Tropomyosin isoform 6Q636104,8290004,73206114463
14Tropomyosin isoform 6Q636104,8290004,8321578363
15Tropomyosin alpha-4 chainP094954,7280004,63247115433
16Lamin-AP486796,5740005,24269413213
16LMNA proteinQ8N5196530005,53852710193
17Lamin-B2P216195,4670005,65979912183
18Transgelin.P312328,9220009,6243607402
19Myosin light polypeptide 6Q641194,5170004,3197355391

Associated with cell growth, development, and differentiation
20NeuromodulinQ6S9D94,7250004,5237149223
21Pigment epithelium-derived factorP972986,5440005,5523958201
21Pigment epithelium-derived factorP972986,5440005,4515216141
22Protein Wnt-5bQ9H1J78,8390005,7234328201
23DIXDC1 protein (fragment)Q8IVY46410006,0333339243
24AHNAK 1 (fragment)Q38PG15,2590005,23862314223
25SPARCQ6GSZ44,8340004,74434215381
26Leukemia inhibitory factorP177779200006,0234324301

Chaperones
27CalreticulinP184184,3460004,35343014381
28Heat shock protein 8Q4FZY75,4710005,46924826513
2978 kDa glucose-regulated proteinP067615700005,06883413251
30Serpinh1 proteinQ5RJR98,9470009,34960517401
31CalumeninO357834,4350004,3492315241

Metabolism
32Phosphoglycerate kinase 1P166177,5440008,04668714413
33Enolase 1, alphaQ5EB496,2470006,05347110282
34Fructose-bisphosphate aldolase AP050658,4390008,84288812293
35Isoform M2 of Pyruvate kinase P11980-27,4580007,46139423523
36Carbonyl reductase [NADPH] 1P477278,2300006,7275739322
37Adult male cDNA, similar to GTPasa Q3UH207430004,62883712203

Transport proteins
38Transcobalamin-2Q9R0D67,8460008,04668711251
39Ferritin light chain 1Q6P7T16210006,0209817533
40Syntaxin-binding protein 3Q607708,3680006,06461316243
41Synaptotagmin 5Q56A289,4430009,1430848201
42AP-4 complex subunit sigma-1Q9Y5875,1170003,7180444363

GTPase-related proteins
43Ras-related protein Rab-14Q91V415,9240006,0234327393
44RAB15, member RAS oncogene familyQ504L65,4240004,4192986291
45Rho/Rac guanine nucleotide exchange factQ929748,71010007,089066683

Immune response
46MHC class I antigenQ9MXM35,5400005,93047510381
47Lysozyme CP616269,3150008,5182347391
48Cutaneous T-cell lymphoma-associated antigenQ8IX954,9180006,0387475482
49Recombination-activating gene 1Q5W9V96,4380004,63787611412
50Islet cell autoantigen 1-like proteinQ6RUG55,2490005,4597998243
51APG16 autophagy 16-like Q3TDQ55,9660007,0613948183

Extracellular matrix and related proteins
52Alpha-1 type I procollagen (fragment)Q607855,7350005,23466011421
53Col1a1 protein (fragment)Q99LL65,9590005,7512467201
53Col1a1 protein (fragment)Q99LL65,9590005,65162612301
54Col1a2 protein (fragment)Q91VL47,1570006,0324317151
55procollagen, type III, alpha 1Q8BJU65,9360005,33360210361
56Collagen alpha-1 (III) chainP139419,4940007,617479215201
57Collagen alpha 1 (V) (fragment)O706034,8220004,4360287521
58Glypican 1 variant (fragment)Q59GI76,5360005,6330856221
59PerlecanQ057935,9178006,2234328111

Retinol-related proteins
60Dehydrogenase/reductase SDR family memberQ9BTZ27,7280008,0368764113
61Epididymal retinoic acid-binding proteinP069115,5180005,3234324371

Secretion is indicated with (1) if the protein had a predicted signal peptide, (2) if it had a score >0,5 in neural network and therefore are nonclassically secreted, or (3) if they are not predicted as secreted. Proteins are listed with the accession number of Swiss-Prot and grouped in clusters of families and functions. (T) MW and pI as determined by UniProt database; (E) experimentally found in our 2D gels. % Cov: % of the sequence coverage by peptide mass fingerprinting using Aldente software, n.pep.: number of peptide masses matched.
3.3. Secretome Network Analysis

To gain further insight into the potential functions of PaSC-ABCG2(+) secretome, we conducted proteomic data mining by Ingenuity Pathway Analysis 3.0 (Ingenuity Systems). Proteins identified in the secretome were submitted as “focus proteins” and were mapped onto the Ingenuity Pathways Knowledge Base, which is a database containing important curated information of interactions between genes, proteins, and other biological molecules. Our analysis rendered three main networks (Figures 2(a), 2(b), and 2(c)). Abbreviations of all the proteins used by the software are summarised in Table 3. The scores for all of the mapped networks were higher than 19, indicating that the networks selected were not due to random chance alone. These networks were associated with the following functions: cellular assembly and organisation (network 1, score 27, 15 focused proteins), tissue development (network 2, score 27, 15 focus proteins), cell-to-cell signalling and interaction, and cellular growth and proliferation (network 3, score 22, 13 focus proteins). The first scored network (Figure 2(a)) highlighted TGFβ1 as a nonfocused protein (included by the software to complete the network), which is located as a central node of the network.


NameDescriptionGenBankNetworksLocationFamily

AHNAKAHNAK nucleoprotein (desmoyokin)DQ2032933NucleusOther
AK2Adenylate kinase 23CytoplasmKinase
ALDOAAldolase A, fructose-bisphosphateM129193CytoplasmEnzyme
ANXA4Annexin A41Plasma membraneOther
ARHGEF2rho/rac guanine nucleotide exchange factor (GEF) 2NM_0010120791CytoplasmOther
BAT1HLA-B associated transcript 11NucleusEnzyme
CALRCalreticulinD783083NucleusTranscription regulator
CALU CalumeninAJ0019291UnknownOther
CBR1Carbonyl reductase 1X843493CytoplasmEnzyme
CD300DCd300D antigen3Plasma membraneTransmembrane receptor
CIAA1CIA autoantibody QTL 12UnknownOther
CIAA2CIA autoantibody QTL 22UnknownOther
CIB2Calcium and integrin binding family member 23UnknownKinase
CNN3Calponin 3, acidic1CytoplasmOther
COL10A1Collagen, type X, alpha 12Extracellular spaceOther
COL11A2Collagen, type XI, alpha 22Extracellular spaceOther
COL14A1Collagen, type XIV, alpha 1 (undulin)2Extracellular spaceOther
COL1A1Collagen, type I, alpha 1XM_2134402Extracellular spaceOther
COL1A2Collagen, type I, alpha 2AF1212172Extracellular spaceOther
COL2A1Collagen, type II, alpha 12Extracellular spaceOther
COL3A1Collagen, type III, alpha 1BC0870392Extracellular spaceOther
COL5A1Collagen, type V, alpha 1AJ0053941Extracellular spaceOther
COL5A3Collagen, type V, alpha 32Extracellular spaceOther
CTSBCathepsin BNM_0225973CytoplasmPeptidase
DDR1Discoidin domain receptor family, member 12Plasma membraneKinase
DDR2 Discoidin domain receptor family, member 22Plasma membraneKinase
DDX18DEAD (Asp-Glu-Ala-Asp) box polypeptide 181NucleusEnzyme
DES DesminNM_0225311UnknownOther
DHRS4Dehydrogenase/reductase (SDR family) member 4NM_1533151UnknownEnzyme
DIXDC1DIX domain containing 1NM_0010376541UnknownOther
ELF3E74-like factor 33NucleusTranscription regulator
ENO1Enolase 1, (alpha)BC0900691CytoplasmTranscription regulator
F2Coagulation factor II (thrombin)3Extracellular spacePeptidase
FCGR1BFc fragment of IgG, high affinity Ib, receptor (CD64)3Plasma membraneTransmembrane receptor
FCGR1CFc fragment of IgG, high affinity Ic, receptor (CD64)3Plasma membraneTransmembrane receptor
FFAR2Free fatty acid receptor 23Plasma membraneG-protein coupled receptor
FOSv-fos FBJ murine oncogene homolog1NucleusTranscription regulator
FTLFerritin, light polypeptideBC0615253CytoplasmOther
GAP43Growth associated protein 43NM_0171952Plasma membraneOther
GFAPGlial fibrillary acidic proteinU037003CytoplasmOther
GSTA4Glutathione s-transferase a43CytoplasmEnzyme
HSPA5Heat shock 70 kda protein 5 M140501CytoplasmOther
HSPA8Heat shock 70 kda protein 8BC0989142CytoplasmEnzyme
HSPH1Heat shock 105 kda/110 kda protein 12CytoplasmOther
IL6Interleukin 6 (interferon, 2)3Extracellular spaceCytokine
IL15Interleukin 151Extracellular spaceCytokine
IL1F6Interleukin 1 family, member 6 (epsilon)3Extracellular spaceCytokine
IL1F9Interleukin 1 family, member 93Extracellular spaceCytokine
KCTD13Potassium channel domain containing 133CytoplasmIon channel
KNG1Kininogen 13Extracellular spaceOther
LARGELike-glycosyltransferase3CytoplasmEnzyme
LIFLeukemia inhibitory factor NM_0221963Extracellular spaceCytokine
LMNALamin A/CNM_0010020162NucleusOther
MAPK8Mitogen-activated protein kinase 81CytoplasmKinase
MMP2Matrix metallopeptidase 2 X714662Extracellular SpacePeptidase
MYCv-myc viral oncogene homolog1NucleusTranscription regulator
MYCNv-myc viral related oncogene3NucleusTranscription regulator
MYL6Myosin, light polypeptide 6XM_0010537893CytoplasmOther
OMGOligodendrocyte myelin glycoprotein1Plasma membraneG-protein coupled receptor
P4HA1Procollagen-proline alpha polypeptide i2CytoplasmEnzyme
P4HBProcollagen-proline, polypeptide2CytoplasmEnzyme
PCOLCEProcollagen c-endopeptidase enhancerU947102Extracellular spaceOther
PDLIM7PDZ and LIM domain 7 (enigma)1CytoplasmOther
PGK1Phosphoglycerate kinase 1BC0631611CytoplasmKinase
PKIGProtein kinase inhibitor gamma1UnknownOther
PKM2Pyruvate kinase, muscleM243593CytoplasmKinase
PLS3Plastin 3 (t isoform)1CytoplasmOther
PLXNB2Plexin b22Plasma membraneOther
PPP1R15A Protein phosphatase 1, subunit 15a2CytoplasmOther
PRLProlactin1Extracellular spaceCytokine
PSMD6Proteasome 26S subunit, non-ATPase, 6NM_1987301CytoplasmOther
RAB14RAB14, member RAS oncogene familyNM_0535892CytoplasmEnzyme
RAG1Recombination activating gene 1XM_0010792423NucleusEnzyme
RPS18Ribosomal protein S181CytoplasmOther
SERPINB8Serpin peptidase inhibitor, clade B member 83CytoplasmOther
SERPINE1Serpin peptidase inhibitor, clade E member 12Extracellular spaceOther
SERPINF1Serpin peptidase inhibitor, clade F (pigment epithelium derived factor)BC0786862Extracellular spaceOther
SERPINH1Serpin peptidase inhibitor, clade H (heat shock protein 47)BC0865292Extracellular SpaceOther
SLC16A5Solute carrier family 16, member 5 (monocarboxylic acid transporter 6)3Plasma membraneTransporter
SLCO1A2Solute carrier organic anion transporter family, member 1A23Plasma membraneTransporter
SMARCB1SWI/SNF related, matrix associated, subfamily b, member 12NucleusOther
SP1Sp1 transcription factor3NucleusTranscription regulator
SPARCSecreted protein, acidic, cysteine-rich (osteonectin)BC0617772Extracellular spaceOther
STXBP3Syntaxin binding protein 3NM_0536373Plasma membraneTransporter
SUMO2 SMT3 suppressor of mif two 3 homolog 2 (yeast)1UnknownOther
TAGLNTransgelinNM_0315493CytoplasmOther
TCN2Transcobalamin II, macrocytic anemiaAF0548102Extracellular spaceTransporter
TGFB1Transforming growth factor, 1 1Extracellular spaceGrowth factor
THBS2Thrombospondin 22Extracellular spaceOther
TNFTumor necrosis factor (TNF superfamily, member 2)3Extracellular spaceCytokine
TOR2ATorsin family 2, member A1Extracellular spaceOther
TP53Tumor protein p53 2NucleusTranscription regulator
TPM1Tropomyosin 1 (alpha)M606671CytoplasmOther
TPM2Tropomyosin 2 ( )BC0900091CytoplasmOther
TPM3Tropomyosin 3NM_0572081CytoplasmOther
TPM4Tropomyosin 4J027801CytoplasmOther
TSPAN7Tetraspanin 71Plasma membraneOther
UBR2Ubiquitin protein ligase E3 component n-recognin 23UnknownEnzyme
UPP1Uridine phosphorylase 12CytoplasmEnzyme
USP15Ubiquitin specific peptidase 15AF106657CytoplasmPeptidase
VIMVimentinX629522CytoplasmOther
WNT5BWingless-type MMTV integration site family, member 5BAF4819442Extracellular spaceOther
YY2YY2 transcription factor1UnknownOther
ZBTB7BZinc finger and BTB domain containing 7B2NucleusTranscription regulator
ZFP161Zinc finger protein 161 homolog (mouse)1NucleusOther

The second and third scored networks obtained from Ingenuity Pathways are represented in Figures 2(b) and 2(c). Most of the factors implicated in development and differentiation processes are located in the extracellular compartment, with capacity to interact with the neighbouring cells. These soluble factors include SPARC, MMP2, PEDF, Wnt5b and collagens in the second network (Figure 2(b)), and LIF, which is also a secreted factor clustered in the third network (Figure 2(c)).

3.4. TGFβ1 Detection and Their Role in Cell Proliferation

TGFβ1 was a central protein highlighted in our secretome network (Figure 2(a)), and thus we decided to explore if this factor was present in our conditioned media. ELISA immunoassay of the conditioned media revealed that PaSC-ABCG2(+) secreted active TGFβ1 at the concentration of  pg/mL ( ) (Figure 3(a)).Our results were in agreement with previous reports [22, 23].

TGFβ1 has a potent growth inhibitor capacity described in most cell types [24, 25] and is also capable of inducing Epithelial to Mesenchymal Transitions (EMT) in a variety of epithelial cells [26]. After detecting TGFβ1 in the PaSC-ABCG2(+) conditioned media, we wanted to explore if this molecule had antiproliferative effects in ductal cell line (ARIP cells). In order to conduct these experiments, first we explore to see whether this cellular model has the capacity to respond to the TFGβ1 signal. The analysis of TGFβ receptors (type I, type II, and type III) in ARIP cells showed that expression of these receptors when cells was cultured with basal medium or with PaSC-ABCG2(+) conditioned medium (Figure 3(b)).

3.5. PaSC-ABCG2(+) Conditioned Media Inhibits Ductal Cell Proliferation without Altering Viability

In order to evaluate the effects of the conditioned medium in ARIP cells, we treated them during 24 hours and analysed the proliferation ratio by BrdU and their viability by MTT. The results showed that the rate of proliferation of ARIP cells treated with PaSC ABCG2(+) conditioned media was significantly reduced ( relative to basal media no conditioned , , Figure 4(a)). In order to test the specificity of conditioned media, we cultured ARIP cells with conditioned media collected from other cell lines, endocrine αTC and ductal mPAC, and we found that proliferation rate was not modified (data not shown). In addition, ARIP cell viability was not affected by PaSC-ABCG2(+) conditioned media (MTT test, data not shown). The conditioned media also significantly reduced proliferation in other cell lines used as controls: AR42J and MIN6 (data not shown). The results indicated that specific soluble factors secreted by these cells had effects on ARIP proliferation without altering cell viability. In order to check if TGFβ1 was implicated in the antiproliferative effects of PaSC-ABCG2(+) secretome on ARIP cells, we blocked TGFβ1 from the conditioned media with a pan TGFβ antibody capable of neutralising its effects (Figure 3(c)). Adding pan-neutralising antibody to the conditioned media returned the rate of proliferation to the basal level. As a positive control, we added exogenous TGFβ1 (10 ng/mL) to the basal media, which significantly reduced the rate of proliferation ( ), mimicking the effects of the stellate conditioned media. Exogenous TGFβ1 can also be blocked by pan TGFβ antibody, which returned the rate of proliferation to basal levels. Nonimmune IgG at 20 μg/mL was used as control of exogenous antibody and its addition caused no modifications on the proliferation rate. Moreover, none of these treatments caused effects on cell viability, evaluated by MTT test (data not shown). These experiments confirmed the implication of TGFβ1 secreted by stellate cells in the inhibition of the proliferation observed.

3.6. PaSC-ABCG2(+) Conditioned Media Modify CK19 and PDX1 Expression on Ductal Cell Line

Given the association between reducing cell proliferation and inducing differentiation, we decided to explore if PaSC-ABCG2(+) conditioned media produced changes in ARIP gene expression. The results showed that treatment with conditioned media during 72 hours caused a decrease of the ductal marker CK19, as detected by immunocytochemistry (Figure 4(b)). Quantitative real-time PCR indicated that conditioned media elicited a -fold decrease in CK19 mRNA expression ( , , Figure 4(c)). These results indicate that PaSC-ABCG2(+) conditioned media are able to induce changes in transcription of endogenous ARIP gene CK19.

One of the most critical genes involved in endocrine differentiation and beta cell phenotype maintenance is the transcription factor PDX1. In order to check if PaSC-ABCG2(+) conditioned media was able to modify PDX1 expression in this cellular model, first we evaluated the basal level of this transcription factor both at the protein and mRNA levels. We observed an increase of PDX1 when we treated them with PaSC-ABCG2(+) conditioned media (Figure 4(b)). Quantitative real-time PCR indicated that conditioned media treatment increased 5.38-fold ± 0.7 PDX1 mRNA basal expression ( , , Figure 4(d)). To determine if TGFβ1 had a role in increasing PDX1 mRNA levels in ARIP cells treated with PaSC-ABCG2(+) conditioned media, we used the pan-neutralising TGFβ in the conditioned media during 72 hours. The blocking antibody did not reduce significantly PDX1 induction caused by the conditioned media. Moreover, the addition of exogenous TGBβ1 (10 ng/mL) to the control media for 72 hours did not induce PDX1 mRNA increased expression in ARIP cells (Figure 3(d)).These results indicate that TGFβ1 is not apparently involved in PDX1 increased expression of ARIP-conditioned cells.

4. Discussion

Hepatic stellate cells (HpSC) are morphologically and functionally similar to PaSC. Thus, most of the previous studies on stellate cells in the liver predict similar effects of stellate cells in the pancreas [27]. These two cell types have been compared at a transcriptional level, exhibiting organ-specific variations of a common transcriptional phenotype [27]. In the liver, activated stellate cells are known to influence the growth and proliferation of other liver cell types, particularly hepatocytes through paracrine effects [28, 29]. HpSC-derived Keratinocyte Growth Factor is thought to enhance liver regeneration and/or hepatocyte survival in patients with chronic liver disease [30]. Other reports indicate that coculture of HpSC with hepatocytes can preserve some aspects of hepatocyte function [31]. Stellate cells’ effects on inducing differentiation have been described previously in liver; for instance, coculture of HpSC with stem cells gives rise to hepatocytes [32]. At present, there is no report of similar effects in the pancreas. Adult stem cells in the pancreas have not been localised yet, but there is some evidence of their ductal residence (transdifferentiation of ductal cells or remanent stem cells of the duct) [9, 33, 34]. Multiple secreted factors from PaSC, which are located in periacinar and periductal, could have a key contribution in maintaining the ductal niche. Our results indicate that soluble factors secreted by PaSC-ABCG2(+) can inhibit ductal proliferation, as they are also able of inducing changes of gene expression in ductal cells (decrease of the endogenous gene CK19 and increase of the endocrine transcription factor PDX1).

The proteomic approach using Ingenuity Pathway Analysis 3.0 conducted in PaSC-ABCG2(+) conditioned media predicted three main networks. One of them shed light on TGFβ1 as a non-focused protein. This factor was not detected in 2D gels due to its low molecular weight (12 kDa), which was too small for the resolution of the gels used in the analysis. Alternatively, TGFβ1 was detected by ELISA immunoassay. Using this technique, the results revealed that the levels of active TGFβ1 secreted to the conditioned media are similar to the ones described by other primary cultures of PaSCs [22, 35]. It is known that the secretion of this protein is involved in the profibrogenic role of PaSC [36, 37]. Moreover, TGFβ1 induces the transformation of PaSC to myofibroblasts (as evidenced by increased αSMA expression) [38], and it also controls PaSC growth in an autocrine manner [39]. Our study demonstrated the capacity of the conditioned media obtained from PaSC culture to inhibit proliferation of the ARIP cell line and other cell lines, such as AR42J and MIN6, which were used as controls (data not shown). We identified TGFβ1 as the main inhibitor of the ARIP proliferation.

Because cell proliferation arrest is generally accompanied by an increase in cell differentiation, we analysed ARIP gene expression. Our results demonstrated changes in CK19 and PDX1 on ARIP-conditioned cells; therefore we tried to identify the molecule involved in PDX1-increased expression (which is a transcription factor involved in endocrine differentiation). Our first goal was to explore TGFβ1, based on previous studies that suggest a role of this factor in some differentiative processes [40, 41], including determination of pancreatic development [42, 43]. However, we were unable to demonstrate the role of TGFβ1 on PDX1-enhanced expression in ARIP cells that have stopped proliferating, thus indicating that other soluble factors in the secretome had the capacity to modify PDX1 expression.

The second network also predicted by Ingenuity included serpinf1 as a focus protein, also known as PEDF. This factor is involved in neurotrophic activity [4446], and it has recently been involved in neural stem cell renewal as a niche signal [47]. It has been detected in the lung, the heart, and the liver, but its expression is nearly undetectable in the pancreas [48]. It was also interesting to find that this network also included a member of the Wingless family (Wnt5b). The WNT genes have been reported to play a pivotal role in embryonic development and oncogenesis; the isoform Wnt5b is expressed in the exocrine pancreas and upregulated in adipocyte differentiation [49, 50]. SPARC (secreted protein acidic and rich in cysteine), an extracellular Ca-binding glycoprotein associated with the morphogenesis and remodelling of various tissues [51], and MMP2 (matrix metalloproteinase-2), important metalloproteinase that has the capacity to activate TGFβ1 [52], were also present as focus proteins in the second network. These proteins from our secretome (focus proteins) act as central nodes of the network, with described interactions between them.

Finally, the last network predicted highlights LIF, which has been described to induce astrocyte differentiation [53, 54] and is capable of generating insulin-producing beta cells from adult exocrine pancreatic cells in combination with EGF [55]. In this secretome we have found proteins associated with cell growth, development, and differentiation, which contain the novel findings PEDF, LIF, and Wnt5b. The data presented in our study provide a significant new protein-level insight into the secretome of active PaSCs-ABCG2(+). Some of these proteins may have potentially great influence on the physiology of the stellate cells themselves and/or of neighbouring cells. Further studies are required to determine a potential role of these factors in the PaSC-ABCG2(+) effects on ductal cells.

The type of secretion of the soluble factors analysed by SecretomeP indicated that 70% had a predicted signal peptide and 30% were secreted via nonclassical pathways which could involve membrane blebbing, exosomes, plasma membrane resident transporters, or lysosomal secretion [56]. Any of the secreted factors could be the potential candidates to exert the effects of the PaSC-ABCG2(+) conditioned media. The most abundant family of secreted factors is the extracellular matrix and related proteins, which coincides with the main function of PaSC (remodellation extracellular matrix remodeling and turnover). This family includes perlecan and collagens, components of the extracellular matrix which contribute to the creation of a microenvironment around PaSC acting as a pool of cytokines and growth factors. It should be noted that not all the proteins identified in our study are known to be secreted. The ones, which have no evidence of secretion, may originate from the minority of cells that die or are otherwise disrupted during the washing and harvesting steps of the procedure and also possibly secreted by unknown mechanisms. This is a common issue in proteomic analysis performed on secretome from primary cell cultures. Most of these proteins were derived from the intracellular compartment characteristic of the stellate phenotype and should be useful for their characterisation. Moreover, some of the proteins identified in the secretome were previously described to be secreted by hepatic stellate cells, such as SPARC, MMP2, cathepsin B, and collagens. The structural ones (calreticulin, α-enolase, and vimentin) were also present in the study of hepatic stellate cells [56], and they were confirmed as the stellate phenotype in our study.

In summary, we have described new soluble factors secreted by PaSC-ABCG2(+) cell population. The characterization of this secretome opens a new field of research involved in paracrine actions, such as inhibition of the proliferation and differentiation promotion in the ductal cell model.

List of Abbreviations

PaSC-ABCG2(+): Pancreatic stellate cells
HpSC: Hepatic stellate cells
RT-PCR: Reverse transcriptase-polymerase chain reaction
BrdU: Bromodeoxyuridine
MTT:3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide
BSA: Bovine serum albumin
FCS: Foetal calf serum
TGF : Transforming growth factor
PSA-NCAM: Polysialic acid-neural cell adhesion molecule
MALDI-TOF: Matrix assisted laser desorption/ionization-time of flight
2D: Two-dimensional electrophoresis.

Conflict of Interests

The authors declare that they have no conflict of interests.

Authors’ Contribution

Maria Lucas and Eugenia Mato contributed equally to this paper.

Acknowledgments

The authors thank Scientific and Technical Services of the Institute of Biomedical Research August Pi i Sunyer (IDIBAPS): Isabel Crespo (Flow Cytometry Unit) and Dr. Susana Kalko (Bioinformatics Unit). The authors thank Dr. Josep M Estanyol for MS analyses from the Proteomic Unit of SSR University of Barcelona and Dr. Eliandre Oliveira from Proteomics Unit of Parc Científic de Barcelona for MALDI-TOF and MS/MS spectra acquisition. Proteomic Units are members of Spanish ProteoRed. They also would like to thank Yaiza Esteban for technical assistance in proteomics studies. This project was funded by grants from SAF2006-07382, RGDMG03/212, PI042553, PI020881, and RETIC RD06/0015/0002 and supported by Sardà Farriol Research Program. CIBER de Diabetes y Enfermedades Metabólicas Asociadas is an ISCIII project.

References

  1. M. V. Apte, P. S. Haber, S. J. Darby et al., “Pancreatic stellate cells are activated by proinflammatory cytokines: implications for pancreatic fibrogenesis,” Gut, vol. 44, no. 4, pp. 534–541, 1999. View at: Google Scholar
  2. M. B. Omary, A. Lugea, A. W. Lowe, and S. J. Pandol, “The pancreatic stellate cell: a star on the rise in pancreatic diseases,” Journal of Clinical Investigation, vol. 117, no. 1, pp. 50–59, 2007. View at: Publisher Site | Google Scholar
  3. T. Knittel, S. Aurisch, K. Neubauer, S. Eichhorst, and G. Ramadori, “Cell-type-specific expression of neural cell adhesion molecule (N-CAM) in Ito cells of rat liver: up-regulation during in vitro activation and in hepatic tissue repair,” American Journal of Pathology, vol. 149, no. 2, pp. 449–462, 1996. View at: Google Scholar
  4. R. A. Hannivoort, S. Dunning, S. V. Borght et al., “Multidrug resistance-associated proteins are crucial for the viability of activated rat hepatic stellate cells,” Hepatology, vol. 48, no. 2, pp. 624–634, 2008. View at: Publisher Site | Google Scholar
  5. E. Schneider, A. Schmid-Kotsas, J. Zhao et al., “Identification of mediators stimulating proliferation and matrix synthesis of rat pancreatic stellate cells,” American Journal of Physiology—Cell Physiology, vol. 281, no. 2, pp. C532–C543, 2001. View at: Google Scholar
  6. K. Shimizu, M. Kobayashi, J. Tahara, and K. Shiratori, “Cytokines and peroxisome proliferator-activated receptor γ ligand regulate phagocytosis by pancreatic stellate cells,” Gastroenterology, vol. 128, no. 7, pp. 2105–2118, 2005. View at: Publisher Site | Google Scholar
  7. P. A. Phillips, J. A. McCarroll, S. Park et al., “Rat pancreatic stellate cells secrete matrix metalloproteinases: implications for extracellular matrix turnover,” Gut, vol. 52, no. 2, pp. 275–282, 2003. View at: Publisher Site | Google Scholar
  8. X. Xu, J. D'Hoker, G. Stangé et al., “β cells can be generated from endogenous progenitors in injured adult mouse pancreas,” Cell, vol. 132, no. 2, pp. 197–207, 2008. View at: Publisher Site | Google Scholar
  9. S. Bonner-Weir, E. Toschi, A. Inada et al., “The pancreatic ductal epithelium serves as a potential pool of progenitor cells,” Pediatric Diabetes, vol. 5, supplement 2, pp. 16–22, 2004. View at: Google Scholar
  10. S. Bonner-Weir, M. Taneja, G. C. Weir et al., “In vitro cultivation of human islets from expanded ductal tissue,” Proceedings of the National Academy of Sciences of the United States of America, vol. 97, no. 14, pp. 7999–8004, 2000. View at: Publisher Site | Google Scholar
  11. L. Bouwens and D. G. Pipeleers, “Extra-insular beta cells associated with ductules are frequent in adult human pancreas,” Diabetologia, vol. 41, no. 6, pp. 629–633, 1998. View at: Publisher Site | Google Scholar
  12. E. Mato, M. Lucas, J. Petriz, R. Gomis, and A. Novials, “Identification of a pancreatic stellate cell population with properties of progenitor cells: new role for stellate cells in the pancreas,” Biochemical Journal, vol. 421, no. 2, pp. 181–191, 2009. View at: Publisher Site | Google Scholar
  13. U. Rutishauser and L. Landmesser, “Polysialic acid in the vertebrate nervous system: a promoter of plasticity in cell-cell interactions,” Trends in Neurosciences, vol. 19, no. 10, pp. 422–427, 1996. View at: Publisher Site | Google Scholar
  14. T. Ben-Hur, B. Register, K. Murray, G. Rougon, and M. Dubois-Dalcq, “Growth and fate of PSA-NCAM+ precursors of the postnatal brain,” Journal of Neuroscience, vol. 18, no. 15, pp. 5777–5788, 1998. View at: Google Scholar
  15. S. Barcelo-Batllori, H. Corominola, M. Claret, I. Canals, J. Guinovart, and R. Gomis, “Target identification of the novel antiobesity agent tungstate in adipose tissue from obese rats,” Proteomics, vol. 5, no. 18, pp. 4927–4935, 2005. View at: Publisher Site | Google Scholar
  16. A. Shevchenko, M. Wilm, O. Vorm, and M. Mann, “Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels,” Analytical Chemistry, vol. 68, no. 5, pp. 850–858, 1996. View at: Publisher Site | Google Scholar
  17. S. Barcelo-Batllori, M. Andre, C. Servis et al., “Proteomic analysis of cytokine induced proteins in human intestinal epithelial cells: implications for inflammatory bowel diseases,” Proteomics, vol. 2, pp. 551–560, 2002. View at: Google Scholar
  18. S. Barceló-Batllori, S. G. Kalko, Y. Esteban, S. Moreno, M. C. Carmona, and R. Gomis, “Integration of DIGE and bioinformatics analyses reveals a role of the antiobesity agent tungstate in redox and energy homeostasis pathways in brown adipose tissue,” Molecular and Cellular Proteomics, vol. 7, no. 2, pp. 378–393, 2008. View at: Publisher Site | Google Scholar
  19. J. D. Bendtsen, L. J. Jensen, N. Blom, G. von Heijne, and S. Brunak, “Feature-based prediction of non-classical and leaderless protein secretion,” Protein Engineering, Design and Selection, vol. 17, no. 4, pp. 349–356, 2004. View at: Publisher Site | Google Scholar
  20. O. Emanuelsson, S. Brunak, G. von Heijne, and H. Nielsen, “Locating proteins in the cell using TargetP, SignalP and related tools,” Nature Protocols, vol. 2, no. 4, pp. 953–971, 2007. View at: Publisher Site | Google Scholar
  21. G. Alvarez-Llamas, E. Szalowska, M. P. de Vries et al., “Characterization of the human visceral adipose tissue secretome,” Molecular and Cellular Proteomics, vol. 6, no. 4, pp. 589–600, 2007. View at: Publisher Site | Google Scholar
  22. F. W.-T. Shek, R. C. Benyon, F. M. Walker et al., “Expression of transforming growth factor-β1 by pancreatic stellate cells and its implications for matrix secretion and turnover in chronic pancreatitis,” American Journal of Pathology, vol. 160, no. 5, pp. 1787–1798, 2002. View at: Google Scholar
  23. H. Ohnishi, T. Miyata, H. Yasuda et al., “Distinct roles of smad2-, smad3-, and ERK-dependent pathways in transforming growth factor-β1 regulation of pancreatic stellate cellular functions,” Journal of Biological Chemistry, vol. 279, no. 10, pp. 8873–8878, 2004. View at: Publisher Site | Google Scholar
  24. J. Massague, S. Cheifetz, M. Laiho, D. A. Ralph, F. M. B. Weis, and A. Zentella, “Transforming growth factor-β,” Cancer Surveys, vol. 12, pp. 81–103, 1992. View at: Google Scholar
  25. S. S. Huang and J. S. Huang, “TGF-β control of cell proliferation,” Journal of Cellular Biochemistry, vol. 96, no. 3, pp. 447–462, 2005. View at: Publisher Site | Google Scholar
  26. M. Kondo, E. Cubillo, K. Tobiume et al., “A role for Id in the regulation of TGF-β-induced epithelial-mesenchymal transdifferentiation,” Cell Death and Differentiation, vol. 11, no. 10, pp. 1092–1101, 2004. View at: Publisher Site | Google Scholar
  27. M. Buchholz, H. A. Kestler, K. Holzmann et al., “Transcriptome analysis of human hepatic and pancreatic stellate cells: organ-specific variations of a common transcriptional phenotype,” Journal of Molecular Medicine, vol. 83, no. 10, pp. 795–805, 2005. View at: Publisher Site | Google Scholar
  28. A. M. Gressner, “The cell biology of liver fibrogenesis—an imbalance of proliferation, growth arrest and apoptosis of myofibroblasts,” Cell and Tissue Research, vol. 292, no. 3, pp. 447–452, 1998. View at: Publisher Site | Google Scholar
  29. H. Steiling, M. Muhlbauer, F. Bataille, J. Schölmerich, S. Werner, and C. Hellerbrand, “Activated hepatic stellate cells express keratinocyte growth factor in chronic liver disease,” The American Journal of Pathology, vol. 165, pp. 1233–1241, 2004. View at: Publisher Site | Google Scholar
  30. R. J. Thomas, R. Bhandari, D. A. Barrett et al., “The effect of three-dimensional co-culture of hepatocytes and hepatic stellate cells on key hepatocyte functions in vitro,” Cells Tissues Organs, vol. 181, no. 2, pp. 67–79, 2006. View at: Publisher Site | Google Scholar
  31. H. Nagai, K. Terada, G. Watanabe et al., “Differentiation of liver epithelial (stem-like) cells into hepatocytes induced by coculture with hepatic stellate cells,” Biochemical and Biophysical Research Communications, vol. 293, no. 5, pp. 1420–1425, 2002. View at: Publisher Site | Google Scholar
  32. K. Si-Tayeb, F. K. Noto, M. Nagaoka et al., “Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells,” Hepatology, vol. 51, pp. 297–305, 2010. View at: Google Scholar
  33. S. Yatoh, R. Dodge, T. Akashi et al., “Differentiation of affinity-purified human pancreatic duct cells to β-cells,” Diabetes, vol. 56, no. 7, pp. 1802–1809, 2007. View at: Publisher Site | Google Scholar
  34. H. Aoki, H. Ohnishi, K. Hama et al., “Existence of autocrine loop between interleukin-6 and transforming growth factor-β1 in activated rat pancreatic stellate cells,” Journal of Cellular Biochemistry, vol. 99, no. 1, pp. 221–228, 2006. View at: Publisher Site | Google Scholar
  35. S. G. Rane, J.-H. Lee, and H.-M. Lin, “Transforming growth factor-β pathway: role in pancreas development and pancreatic disease,” Cytokine and Growth Factor Reviews, vol. 17, no. 1-2, pp. 107–119, 2006. View at: Publisher Site | Google Scholar
  36. C. Kordes, S. Brookmann, D. Häussinger, and H. Klonowski-Stumpe, “Differential and synergistic effects of platelet-derived growth factor-BB and transforming growth factor-β1 on activated pancreatic stellate cells,” Pancreas, vol. 31, no. 2, pp. 156–167, 2005. View at: Publisher Site | Google Scholar
  37. M. V. Apte, P. S. Haber, T. L. Applegate et al., “Periacinar stellate shaped cells in rat pancreas: identification, isolation, and culture,” Gut, vol. 43, no. 1, pp. 128–133, 1998. View at: Google Scholar
  38. M.-L. Kruse, P. B. Hildebrand, C. Timke, U. R. Fölsch, and W. E. Schmidt, “TGFβ1 autocrine growth control in isolated pancreatic fibroblastoid cells/stellate cells in vitro,” Regulatory Peptides, vol. 90, no. 1–3, pp. 47–52, 2000. View at: Publisher Site | Google Scholar
  39. C. Zhu, D. Ying, D. Zhou et al., “Expression of TGF-beta1 in smooth muscle cells regulates endothelial progenitor cells migration and differentiation,” Journal of Surgical Research, vol. 125, no. 2, pp. 151–156, 2005. View at: Publisher Site | Google Scholar
  40. F. Han, C. S. Adams, Z. Tao et al., “Transforming growth factor-β1 (TGF-β1) regulates ATDC5 chondrogenic differentiation and fibronectin isoform expression,” Journal of Cellular Biochemistry, vol. 95, no. 4, pp. 750–762, 2005. View at: Publisher Site | Google Scholar
  41. F. Sanvito, P.-L. Herrera, J. Huarte et al., “TGF-β1 influences the relative development of the exocrine and endocrine pancreas in vitro,” Development, vol. 120, no. 12, pp. 3451–3462, 1994. View at: Google Scholar
  42. E. Tei, S. Mehta, S. S. Tulachan et al., “Synergistic endocrine induction by GLP-1 and TGF-β in the developing pancreas,” Pancreas, vol. 31, no. 2, pp. 138–141, 2005. View at: Publisher Site | Google Scholar
  43. S. P. Becerra, “Structure-function studies on PEDF: a noninhibitory serpin with neurotrophic activity,” Advances in Experimental Medicine and Biology, vol. 425, pp. 223–237, 1997. View at: Google Scholar
  44. J. Tombran-Tink, G. G. Chader, and L. V. Johnson, “PEDF: a pigment epithelium-derived factor with potent neuronal differentiative activity,” Experimental Eye Research, vol. 53, no. 3, pp. 411–414, 1991. View at: Publisher Site | Google Scholar
  45. F. R. Steele, G. J. Chader, L. V. Johnson, and J. Tombran-Tink, “Pigment epithelium-derived factor: neurotrophic activity and identification as a member of the serine protease inhibitor gene family,” Proceedings of the National Academy of Sciences of the United States of America, vol. 90, no. 4, pp. 1526–1530, 1993. View at: Publisher Site | Google Scholar
  46. C. Ramírez-Castillejo, F. Sánchez-Sánchez, C. Andreu-Agulló et al., “Pigment epithelium-derived factor is a niche signal for neural stem cell renewal,” Nature Neuroscience, vol. 9, no. 3, pp. 331–339, 2006. View at: Publisher Site | Google Scholar
  47. J. Tombran-Tink, K. Mazuruk, I. R. Rodriguez et al., “Organization, evolutionary conservation, expression and unusual Alu density of the human gene for pigment epithelium-derived factor, a unique neurotrophic serpin,” Molecular Vision, vol. 2, p. 11, 1996. View at: Google Scholar
  48. R. S. Heller, T. Klein, Z. Ling et al., “Expression of Wnt, frizzled, sFRP, and DKK genes in adult human pancreas,” Gene Expression, vol. 11, no. 3-4, pp. 141–147, 2003. View at: Google Scholar
  49. A. Kanazawa, S. Tsukada, A. Sekine et al., “Association of the gene encoding wingless-type mammary tumor virus integration-site family member 5B (WNT5B) with type 2 diabetes,” American Journal of Human Genetics, vol. 75, no. 5, pp. 832–843, 2004. View at: Publisher Site | Google Scholar
  50. W. J. Cho, E. J. Kim, S. J. Lee, H. D. Kim, H. J. Shin, and W. K. Lim, “Involvement of SPARC in in vitro differentiation of skeletal myoblasts,” Biochemical and Biophysical Research Communications, vol. 271, no. 3, pp. 630–634, 2000. View at: Publisher Site | Google Scholar
  51. J. D. Mott and Z. Werb, “Regulation of matrix biology by matrix metalloproteinases,” Current Opinion in Cell Biology, vol. 16, no. 5, pp. 558–564, 2004. View at: Publisher Site | Google Scholar
  52. L. Bugga, R. A. Gadient, K. Kwan, C. L. Stewart, and P. H. Patterson, “Analysis of neuronal and glial phenotypes in brains of mice deficient in leukemia inhibitory factor,” Journal of Neurobiology, vol. 36, pp. 509–524, 1998. View at: Google Scholar
  53. M. Nakanishi, T. Niidome, S. Matsuda, A. Akaike, T. Kihara, and H. Sugimoto, “Microglia-derived interleukin-6 and leukaemia inhibitory factor promote astrocytic differentiation of neural stem/progenitor cells,” European Journal of Neuroscience, vol. 25, no. 3, pp. 649–658, 2007. View at: Publisher Site | Google Scholar
  54. L. Baeyens, S. de Breuck, J. Lardon, J. K. Mfopou, I. Rooman, and L. Bouwens, “In vitro generation of insulin-producing beta cells from adult exocrine pancreatic cells,” Diabetologia, vol. 48, no. 1, pp. 49–57, 2005. View at: Publisher Site | Google Scholar
  55. W. Nickel, “Unconventional secretory routes: direct protein export across the plasma membrane of mammalian cells,” Traffic, vol. 6, no. 8, pp. 607–614, 2005. View at: Publisher Site | Google Scholar
  56. D. Bach Kristensen, N. Kawada, K. Imamura et al., “Proteome analysis of rat hepatic stellate cells,” Hepatology, vol. 32, no. 2, pp. 268–277, 2000. View at: Google Scholar

Copyright © 2013 Maria Lucas et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1256 Views | 549 Downloads | 0 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder