Journal of Food Quality / 2021 / Article / Tab 1

Research Article

Isolation and Characterization of Gram-Negative Bacterial Species from Pasteurized Dairy Products: Potential Risk to Consumer Health

Table 1

PCR primer sequences and their targets used in this work.

Target genePrimer sequence (5′⟶3′)Product size (bp)Reference (s)

Variable regions of 16S rRNA gene (V1–V9)
27FAGA GTT TGA TCC TGG CTC AG1500Universal primers
1492RGGT TAC CTT GTT ACG ACT T
Coliform/Salmonella
phoPATGCAAAGCCCGACCATGACG GTATCGACCACCACGATGGTT29913
HinCTAGTGCAAATT-GTGACCGCA CCCCATCGCGCTACTGGTATC23613
β-Lactamases
blaTEMTCGCCGCATACACTATTCTCAGAATGAC42215
CAGCAATAAACCAGCCAGCCGGAAG
blaCTX-MATGTGCAGYACCAGTAARGTKATGGC59015
GGTRAARTARGTSACCAGAAYCAGCGG
blaSHVTGTATTATCTC(C/T)CTGTTAGCC(A/G)CCCTG73915
GTCCTGCTTTGTTATTCGGGCCAAGC