Journal of Food Quality

Journal of Food Quality / 2021 / Article

Research Article | Open Access

Volume 2021 |Article ID 8876926 | https://doi.org/10.1155/2021/8876926

Solomon H. Mariam, "Isolation and Characterization of Gram-Negative Bacterial Species from Pasteurized Dairy Products: Potential Risk to Consumer Health", Journal of Food Quality, vol. 2021, Article ID 8876926, 10 pages, 2021. https://doi.org/10.1155/2021/8876926

Isolation and Characterization of Gram-Negative Bacterial Species from Pasteurized Dairy Products: Potential Risk to Consumer Health

Academic Editor: Alejandro Hernández
Received24 Sep 2020
Revised10 Dec 2020
Accepted30 Jan 2021
Published18 Feb 2021

Abstract

Pathogenic bacterial contaminants of dairy products cause economic and human life losses if not destroyed by pasteurization. Gram-negative bacteria are among such major contaminants. Contamination persists because of faulty pasteurization or occurs during postpasteurization processing. Many factors, including presence of asymptomatic healthy carriers, existence of broad-range host pathogens, and resistance of pathogens to ordinary disinfectants, hamper the control of such pathogens. Here, samples of pasteurized dairy products were subjected to enrichment/selective cultures to test for possible Salmonella contamination, followed by growth on/in various media to test for phenotypic properties and some virulence characteristics of isolates (catalase, urease, oxidase, gelatinase, etc.). Isolates were characterized by phenotypic and genotypic tests for identification and resistance to clinically relevant antibiotics, including disk diffusion and for β-lactamase production. All milk samples harbored Gram-negative bacilli, which constitute a public health hazard. All of the isolates exhibited intermediate-level or higher resistance to ≥2 clinically relevant antibiotics, while some were susceptible. None tested positive for phenotypic gelatin hydrolysis but exhibited alpha- or beta-hemolysis. Sequence alignments of 16S rRNA gene partial sequences suggested up to 99% sequence similarities to subspecies of Salmonella enterica. Most isolates were also β-lactamase producers, especially blaTEM. In conclusion, high contamination rates were found in all Ethiopian pasteurized milk samples. The reasons for this burden of contamination need to be elucidated for meaningful and targeted control. Larger studies are needed, specifically to reveal points of entry of potential pathogens into dairy products. Information from this work will help to address and control previously unrecognized health hazards associated with consumption of pasteurized dairy products.

1. Introduction

Members of the family Enterobacteriaceae are major causes of foodborne infections worldwide. The Enterobacteriaceae are Gram-negative, non-spore-forming, facultatively anaerobic, catalase-positive, oxidase-negative, and generally capable of growth on medium containing simple nutritional substrates as they can ferment a wide range of carbohydrates. This family includes Escherichia coli, Shigella spp., and Salmonellae, among others. While many are part of the normal flora of humans and animals, others such as Salmonella typhi are always associated with disease. Others can be occasionally pathogenic—either opportunistically or following acquisition of virulence factors [1]. The Enterobacteriaceae possess complex antigenic structures and produce a variety of toxins and other virulence factors. Humans acquire these bacteria after consumption of contaminated foods, from contact with animals, or directly via human-to-human transmission (e.g., the human-host-specific pathogens such as S. typhi) [2]. Contaminated foods of dairy origin account for a large share (14%) of the burden of foodborne illnesses [3]. A current review identified prevalence rates of 6, 9, and 10% of Salmonella, L. monocytogenes, and E. coli O157:H7, respectively, in raw cow milk in Ethiopia [4].

The epidemiology of foodborne infections is changing, including its several manifestations: emergence of new and more virulent pathogenic bacterial clades, regional or global spread, and dissemination of antibiotic resistance [5, 6]. Among the foremost virulence factors of Enterobacteriaceae are harborage of plasmid- and/or chromosome-encoded multiple antibiotic resistance traits that can confer difficult-to-treat infectious diseases and/or pose risk of transfer of these traits to other members of the microbiota. Enterobacteriaceae are notorious for their expression of several antibiotic resistances, such as the extended-spectrum β-lactamases.

Nontyphoidal Salmonella (NTS), such as Salmonella typhimurium and Salmonella enteritidis, may be characterized by genomic evolution within the host or during host-to-host transmission, driven primarily by prevailing conditions (e.g., changes in host immunity and presence of antimicrobials) [7]. Several reviews indicated that about 30% of invasive nonmalarial blood stream infections in both adults and children (primarily in the immune-compromised and malnourished) presenting with fever in sub-Saharan Africa are caused by Salmonella species, and most of these salmonellosis infections are due to NTS, with case fatality rates of 20–25% [810]. The latter study also showed that NTS infections in Ethiopia account for up to 10% of blood stream infections.

Elsewhere, reports indicate infectious diseases due to enteric bacterial pathogens from pasteurized dairy products, e.g., [3, 11, 12]. However, information or research findings from one region may not be directly extrapolated to other areas. Technically, it can be challenging to conduct such studies, and an especially daunting task is tracing the cause-effect connections of foods implicated in such infections, which require conducting controlled, resource- and technology-intensive investigations. These scenarios make prevention of the more feasible approach (both technically and economically) to control the infections, but some data are needed on which actions can be based. Information on foodborne infections of dairy origin in Ethiopia from the points of view of antibiotic resistance and virulence traits is either lacking or scarce. Moreover, there is widespread misunderstanding that pasteurized dairy products are safe for consumption. This small-scale study was undertaken to test for the presence of Gram-negative bacteria in pasteurized milk that can provide some information on the possible health risks from consumption of local pasteurized dairy products by the general public. Herein is reported the isolation and partial characterization of Gram-negative bacteria which were tested for the presence of some virulence and antibiotic resistance traits.

2. Materials and Methods

2.1. The Study Site

Addis Ababa is the capital of Ethiopia. The city’s milk supplies come from private dairy industries and dairy cooperatives. Milk pooling is the rule. The same brands of dairy products from the major milk suppliers, all of which have been sampled here, are distributed for sale at all supermarkets of the city. The population size is estimated at 3-4 million. Moreover, it is an international place, hosting more than 125 country embassies and being the seat of many continental and global organizations.

2.2. Samples and Culture Media

Samples of eleven milk products, produced by different private dairies, were purchased from food supermarkets. All samples analyzed in this study were declared to have been pasteurized, or derived from pasteurized products, by the producers. The products were kept refrigerated in the supermarkets. The samples were at ≥3 days before their expiration dates (according to package labels) at the time of purchase. All samples were subjected to preenrichment cultures within one hr of purchase. All broth and agar media, materials, and reagents are from Becton Dickinson (Belgium), unless stated otherwise.

2.3. Culture and Isolation

Samples were inoculated into buffered peptone water (BPW) (HiMedia, India) (10 mL or gram of sample in 90 mL BPW) and incubated for 24 hrs at 37°C. Then, 1 mL of each was inoculated into 9 mL selenite broth and Rappaport-Vassiliadis broth and incubated for 24 hrs at 37°C and 42°C, respectively. Following this, successive 10-fold dilutions were made for each sample and 30 μL was inoculated onto Salmonella-Shigella (SS) and xylose lysine deoxycholate (XLD) agars and incubated at 37°C for 24 hrs. Single colonies were picked, restreaked on fresh agar, and incubated at 37°C for 24 hrs. Samples were also inoculated onto MacConkey agar. Then, single colonies were randomly picked and inoculated into Luria-Bertani (LB) broth and grown aerobically at 37°C for 24 hrs. Finally, broth cultures were pelleted, and the pellets were stored in LB broth containing 15% glycerol in multiple aliquots to serve as stocks for subsequent studies. The bacterial loads of randomly selected milk samples were estimated by the most probable number (MPN) method.

2.4. Identification

A combination of cultural, biochemical, and molecular tests was used for identification. Each stored sample was grown on LB agar and Gram-stained. The cultural and biochemical tests were conducted three independent times.

Catalase test was conducted by placing colonies grown on LB agar for 24 hrs on slides and adding 1-2 drops of 30% hydrogen peroxide (H2O2).

For motility test, screw-cap tubes (13 by 100 mm) containing 5 mL of sterilized motility test medium were inoculated in the center to a depth of 0.5 inches with a colony grown for 24 hrs. The tubes were then incubated at 35oC or at room temperature for 24 hrs.

For urease test, urea broth was prepared and filter-sterilized through 0.45 μm pore size filters. Three mL volumes were then dispensed into 13 by 100 mm sterile screw-cap tubes. Each isolate was inoculated into the broth using a sterile loop and incubated in water bath set to 35°C, or stored at room temperature, with observations made after 1 hr, 2 hrs, and 24 hrs.

To conduct citrate utilization test, Simon’s citrate agar (Oxoid, London, England) was freshly prepared in glass tubes, sterilized, and placed at an angle to form a butt and slant. Each tube of medium was inoculated with 20 hr-grown colony of the dairy isolates and the tubes were loosely capped and incubated at 35°C for 24 hrs or longer, with daily observation of changes in color of the media.

Indole production was tested by inoculating 5 mL of tryptose broth (Oxoid) with a pure colony, incubating at 37°C for 24 hrs, and adding 2-3 drops of indole reagent.

Gelatin hydrolysis test was conducted by stab-inoculating a colony of each isolate into 4 mL of 3% sterile nutrient gelatin in screw cap glass tubes and incubating at 37°C for 5 days. Then, the tubes were placed in refrigerator for 4 hrs before viewing for gelatinase activity. Uninoculated nutrient gelatin served as negative control.

Hemolysis test was performed by streaking a colony of each isolate on blood agar (Oxoid) containing 5% defibrinated sheep blood and incubating at 37°C for 48 hrs. Streptococcus pyogenes served as positive control whereas E. coli served as negative control for hemolytic activity.

Additional biochemical tests conducted included the oxidase test, conducted using oxidase test strips (Oxoid, Australia); triple sugar iron agar (TSI) test, conducted using TSI agar (HiMedia, India); and growth pattern on eosin methylene blue (EMB) agar. All tests were conducted following standard procedures.

2.5. DNA Extraction, Polymerase Chain Reaction (PCR), and Sequence Comparisons

DNA was extracted from the isolates. The DNA concentrations were measured using Nanodrop 2000 (Thermo Scientific, Wilmington, DE, USA) and were in the range of 540–1200 ng/nL. The DNA were used for amplification and then sequencing of the partial 16S rRNA gene. Primer sequences are listed in Table 1. Each isolate sequence was pairwise blasted with different bacterial 16S rRNA gene partial sequences obtained from the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) database, and multiple sequence alignments (MSA) were made with the MSA tool T-Coffee (EMBL-EBI, Hinxton, Cambridge).


Target genePrimer sequence (5′⟶3′)Product size (bp)Reference (s)

Variable regions of 16S rRNA gene (V1–V9)
27FAGA GTT TGA TCC TGG CTC AG1500Universal primers
1492RGGT TAC CTT GTT ACG ACT T
Coliform/Salmonella
phoPATGCAAAGCCCGACCATGACG GTATCGACCACCACGATGGTT29913
HinCTAGTGCAAATT-GTGACCGCA CCCCATCGCGCTACTGGTATC23613
β-Lactamases
blaTEMTCGCCGCATACACTATTCTCAGAATGAC42215
CAGCAATAAACCAGCCAGCCGGAAG
blaCTX-MATGTGCAGYACCAGTAARGTKATGGC59015
GGTRAARTARGTSACCAGAAYCAGCGG
blaSHVTGTATTATCTC(C/T)CTGTTAGCC(A/G)CCCTG73915
GTCCTGCTTTGTTATTCGGGCCAAGC

PCR was also run using phoP and Hin primers (Table 1) (phoP regulates the expression of genes involved in virulence and macrophage survival of Salmonella species and is present in several enteric bacteria including Salmonella while Hin controls phase variation and is present only in Salmonella). These primers and cycling conditions were adopted from Way et al. [13]. The products were run on 1.6% agarose gel, and images were taken using a Bio-Rad Gel Doc UV Trans-Illuminator (Bio-Rad Laboratories, Bio-Rad, USA).

2.6. Antibiotic Sensitivity Tests (ASTs)

ASTs to several clinically relevant and available antibiotics were conducted by disk diffusion, and guidelines of the Clinical Laboratory Standards Institute (CLSI, MD, USA) [14] were used. Briefly, broth cultures of the isolates were grown until culture turbidity matched the McFarland 0.5 standard. Sterilized Mueller–Hinton agar was poured into 100 mm plates (20 mL/plate) and when firmly solidified were heavily streaked over the entire agar surface with sterile cotton swab that had been dipped into the bacterial broth culture. Antibiotic disks (Abtek, England), 4 per 13 × 100 mm plate, were dispensed onto the agar surface after the agar surface has dried (∼15 minutes after the streaking). The plates were incubated at 35°C for 24 hrs. The following antibiotic disks were used: chloramphenicol (Chl), 30 μg; tetracycline (Tet), 30 μg; gentamycin (G), 10 μg; ciprofloxacin (Cip), 5 μg; nitrofurantoin (N), 300 μg; ampicillin (Amp), 10 μg; erythromycin (E), 15 μg; trimethoprim-sulfamethoxazole (TMS), 25 μg; amoxicillin/clavulanate (A/C), 20/10; and ceftriaxone (Cef), 30 μg. Inhibition zone diameters were measured in millimeters. Tests were also conducted for β-lactamase production by the isolates using multiplex PCR with primers for extended-spectrum β-lactamases (TEM, CTX-M, and SHV) (Table 1) [15].

3. Quality Control

Escherichia coli (American-type culture collection [ATCC] 25922), Staphylococcus aureus ATCC 25923, Proteus mirabilis ATCC 29906, Klebsiella pneumonia ATCC700603, Salmonella enteritidis ATCC 13076, Pseudomonas aeruginosa ATCC 27853, Streptococcus pyogenes ATCC19615, and uninoculated medium were used as positive or negative controls as appropriate in the cultural, biochemical, and AST tests. Each experiment was repeated 3 times, except the disk diffusion AST, which was tested once.

4. Ethics Statement

This work did not use any human or animal subjects and ethical approval was not required.

5. Results

All pasteurized milk samples from all producers gave growth. All isolates were Gram-negative rods. The milk samples randomly chosen and analyzed for bacterial load contained variable estimated numbers of bacteria. Most were contaminated to very high levels, but milk samples 1 and 9 contained much fewer numbers, indicating product-to-product differences in bacterial loads (Table 2).


Sample/isolate0.10.010.001MPN95% confidence rangeEstimated number (mL−1)

1000<30–9.5∼3 × 102
332221040–4302.1 × 106
4333>1100420–4000>1.1 × 1011
900130.15–9.63 × 103
1533146090–20004.6 × 106
20333>1100420–4000>1.1 × 108

Cultural and biochemical test results are shown in Table 3. Colonies did not show blackening on SS or XLD agars, but were rather yellowish. Most of the isolates were hydrogen sulfide negative, but all of the isolates were catalase-positive and oxidase-negative. On EMB agar, all isolates exhibited purple-colored colonies. The control strains and negative control cultures (uninoculated) all showed the typical results for the respective biochemical tests.


TestIsolate
134567912152024

Gram stain
Catalase+++++++++++
Motility
 37°Cmmnmmmnmmmmmnm
 RTmmnmmmnmmmmmnm
Urease++++
Citrate+++++++++++
Indole production
Triple sugar iron agar
 ButtYYDYYYYYYYY
 SlantYYDYYYYYYYY
 Gas+++++++++
 H2S+
EMB agarPPPPPPPPPPP
MacConkeyYsYsYsYsYsYsYsYsYsYsYs
Oxidase
Gelatin hydrolysis
BAαβββαβααααβ

RT: room temperature, −: negative, +: positive, m: motile, nm: nonmotile, Y: yellow, D: dark, P: purple, Ys: yellowish, EMB: eosin methylene blue, and BA: blood agar (hemolysis).

The results of the phoP/Hin duplex PCR reactions showed that most isolates of this study do not belong to the Salmonella genus. However, two isolates (6 and 7) were found to be in the coliform group as they tested positive only for the phoP gene amplification product (299 bp) (Figure 1, lanes 7 and 5, upper and lower panels, respectively). Isolates 3 and 12 were also in the coliform group as they showed bands on the gel (both with the 299 bp band) (data not shown). Isolate 1 exhibited both the 299 and 236 bp bands, confirming it is Salmonella (Figure 1, lane 8, lower panel). The remaining isolates did not give amplification products with the primers. S. enteritidis ATCC 13076, used as positive control in the test for presence of both genes, exhibited both the 299 and 236 bp bands (Figure 1, lane 2 in upper and lower panels).

In the disk diffusion test, almost all isolates were found to be susceptible to both Tet and Chl. The exception is isolate 3, found to be resistant to five major antibiotics: Tet, Chl, Cip, Amp, and Cef. Isolate 3 is especially notorious, with no zone of inhibition at all by Tet and Chl. It was also resistant to Cip, Cef, and Amp. The Amp resistance seems to be in line with this isolate’s displaying both the 422 and 739 TEM and SHV bands in the ESBL detection test (Figure 2). All of the rest of the isolates were intermediate-resistant to Cip, and all isolates were resistant to Amp (Table 4). All isolates were resistant to E. This is an intrinsic property of members of the Enterobacteriaceae, and this test was carried out to check this resistance case. Five of the isolates were multiple drug-resistant to two or more antibiotics.


IsolateAntibiotic
ETetGChlCipNAmpA/CTMSCef

E. coli®RSS#RSSRSI
S. aureus®®RSS#SSSRSSI
1RSRSISRNDNDND
3RRS#RRSRSSR
4RNDNDNDNDNDNDNDSR
5RSRSISRRSI
6RSS#SISRRRR
7RSISISRRSI
9RSS#SISRNDNDND
12RSISISRISS
14RSRSISRRIR
15RSS#SISRISR
20RSISISRNDNDND
24RSS#SISRNDNDND

E: erythromycin, Tet: tetracycline, G: gentamycin, Chl: chloramphenicol, Cip: ciprofloxacin, N: nitrofurantoin, Amp: ampicillin, A/C: amoxicillin/clavulanate, TMS: trimethoprim-sulfamethoxazole, Cef: ceftriaxone, ND: not determined, R: resistant, S: susceptible, and I: intermediate. Inhibition zone diameters were measured in millimeters. ®(ATCC 25922); ®®(ATCC 25923). Isolate 14 is from the same source as isolate 1. Highly resistant, no inhibition zone (0.00 mm). #The CLSI guideline states in vitro activity does not correlate with in vivo activity.

With respect to β-lactamase, isolate 1 (upper lane 3, Figure 2) was positive for both CTX-M and TEM with 590 and 422 bp bands. Isolate 3 (upper lane 4, Figure 2) was positive for the 422 bp TEM band. Isolate 4 (upper lane 5, Figure 2) was positive for both SHV and TEM bands, indicating the presence of β-lactamases SHV and TEM. Isolates 5, 6, 7, 9, and 12 (upper lanes 6–10) and 15, 20, and 24 (lower lanes 3–5) in Figure 2 were all positive for 422 bp TEM band. Thus, all 11 isolates exhibited the TEM band.

The results of pairwise alignment of partial 16S rRNA gene sequences of the isolates with sequences of subspecies of S. enterica showed that the similarities were mostly in the 95 to 99% range (Table 5). Overall, isolate 1 showed the highest nucleotide similarity to the different S. enterica subspecies (98-99%). Conversely, the similarities with most of the non-Salmonella sequences were found to be much lower (77–85%) (Table 5). Sequence alignments of the isolates to Cronobacter sakazakii ATCC 29544 showed them to be in the lower 90s in percent similarity, while similarities to Aeromonas ATCC 7966 were in the upper 80s only. The dairy isolates had no more (or less) nucleotide similarity to each other than they had to the S. enterica species, with percent similarities ranging between 91 and 98 (data not shown). A phylogenetic tree is shown in Figure 3.


ComparatorIsolates
134567912152024

Salmonella enterica 133119897939894989590969696
S. enterica ATCC 170589998949995989593999798
S. enterica ATCC 130769896909592959390959595
S.enterica 148479897929794979490989598
S. enterica 93869897919593959490959594
S. enterica ATCC 133149897919593969490969594
S. enterica LT298969297939794969596
Enterobacter cloaca9998919694969491979796
Citrobacter freundii9596919594969591979696
Shigella dysenteriae 133139796909393949488949594
Escherichia coli ATCC 259229795909392939388949593
Serratia marcesens9395919594949588959594
Yersinia sp. A125 KOH29294909495939687949493
Proteus mirabilis 299069090938991899287909089
Coxiella burnetii82838481828382NSH818383
Haemophilus influenzae 333918583848485848479848483
Pseudomonas aeruginosa 50071T84858684858585NSH858484
Brucella abortus 00910584849582838484NSH848383
Campylobacter helveticus 512098080797879808076818679
Mycobacterium avium 2529180788079798179NSH817980
Clostridium botulinum 1939781818286808181NSH828680
Listeria monocytogenes 1911280808178808080NSH80NSH79
Enterococcus faecium 19434NSH7980NSH787979NSH80NSH78
Enterococcus faeca1is 9433NSH7778NSH787779NSH78NSH77
Staphylococcus aureus 2592379807779788079NSH807979
Bacillus cereus 1070280808178798080NSH80NSH80
Bacillus subtilis797981NSHNSH7979NSH80NSH79
Lactococcus lactis AcCh35NSH7879NSH77787778NSH77
Lactococcus lactis AcCh67NSH7879NSH77787778NSH77

NSH: no substantial similarity.

Though the isolates in this study are all Gram-negatives, the sequences of the isolates were also aligned to several Gram-positive sequences such as S. aureus, Lactococcus lactis, Clostridium perfringens, Listeria monocytogenes, etc., mainly because most of these bacteria can also be found as contaminants in milk and to show that the isolates of this study are unrelated and to the Gram-positives since this study aimed at analyzing Gram-negative contamination only.

6. Discussion

Dairy products, including some pasteurized ones that still harbor pathogens, can be sources of infections in humans that can result in illnesses, hospitalizations, and even death. This work found Gram-negative bacteria as food contaminants in all of the analyzed dairy products, with potential virulence properties. What makes these findings important is also the fact that the products were labeled as having been pasteurized, which sends the wrong signal to consumers that these products are safe to consume, and it is a common scene that many consumers purchase these products from shops and consume directly from the sachet. Thus, from the findings of this study, it is reasonable to expect that these isolates constitute hazard to the health of consumers. These isolates may have potential for interspecies transfer of the resistance traits they harbor to other commensals or members of the human host gut microbiota [1620]. Thus, the antibiotic resistance property alone is enough to pose such hazard—whether or not these isolates turn out to be virulent by other mechanisms. Knowledge of virulence and antibiotic resistance factors harbored in microflora of food items, when adequately supported with subsequent appropriate authoritative control measures, is critically important from a public health point of view.

The extent of disease in humans due to milk-borne pathogens is not clearly defined in Ethiopia. The situation in sub-Saharan Africa appears to be serious, as there is frequent exposure to microbe-laden foods. As in other cases, misdiagnosis of cause-effect relationships in disease outcomes is a possibility here. Let alone pasteurized milk, there is also resistance among the public to recommendations to not consume unpasteurized dairy products because of the misconception about the health benefits of raw milk [21, 22]. Meanwhile, the infections (and the probable ensuing diseases) continue to spread, which can be even more disabling when antibiotic resistance is added to the equation.

From the outset, it is possible to surmise a primary reason for the fact that all tested milk samples contained Gram-negative bacteria may be due to the milk pooling practice, where even a single contaminated sample can render the whole pooled milk adulterated. Another likely explanation for the finding of Gram-negative bacteria in pasteurized dairy products is defective pasteurization. Other alternative explanations also exist, such as contamination of the products during postpasteurization handling, or storage at inappropriate temperatures [23, 24]. Psychrotolerant Gram-negative organisms (coliforms or other) can contaminate milk after pasteurization, and though their initial numbers may be low, they grow to predominance during storage at refrigeration temperatures [23, 24]. At this point in this study, it is difficult to say whether the pasteurization processes were less than optimal, or which of these possibilities could be explanation(s) for the present findings; thus, this calls for authoritative investigations.

The cultural and some of the biochemical tests turned out results compatible with those for Salmonella. However, the TSI test results were difficult to interpret for some isolates—not fitting entirely into known descriptions of Salmonella TSI metabolism, as was the absence of hydrogen sulfide (H2S) production by most of the isolates. It is possible that the isolates are truly H2S-negative, considering the yellowish nature of the slants or butts. H2S-negative Salmonellae have been reported, e.g., in [2527]. Variations in their biochemical properties are not to be unexpected, considering variations in both the diversity and sources of the isolates. Similarly, motility-defective strains are known to exist. For example, aflagellate or flagellar mutants of Salmonella occur, with reduced ability in vivo to invade deeper tissue or invade other organs such as the liver and spleen [28, 29].

The MacConkey cultures showed that the isolates were non-lactose fermenters, but that they grew on it (and on SS agar) also showed that they were bile resistant. This can be an important virulence mechanism. The underlying mechanism(s) for this bile resistance capacity was not examined here. However, enteric pathogens can both resist bile and use it as a signal mechanism to induce gene expression to enhance virulence, infection, and biofilm formation [3032]. Other virulence properties can be envisaged to occur from the information obtained in this work. For example, hemolysis due to hemolysins can damage membranes and erythrocytes [33, 34]; catalase activity endows pathogenic bacteria with resistance to oxidative stress due to hydrogen peroxide that can be encountered in vivo [35]. Thus, these isolates themselves may turn out to be virulent by these and other mechanisms. The resistance of the isolates to several clinically relevant antibiotics is also a serious concern.

The 16S rRNA gene, which is about 1500 bp long, is known to be conserved, with variable sequences interspersed in between. These features make it ideal target for amplification and sequence comparisons for species-level identification of clinically important bacteria [36, 37]. However, there is no consensus on the use of this sequence in phylogenetic analyses. On the other hand, it has been suggested that even the first 500 bp sequences of the 16S rRNA gene can give similar species-level discriminatory power as the entire 1500 bp sequence in more than 90% of comparisons in a given sequence; and the entire 1500 bp sequence can give similar phylogeny as the whole genome [38, 39]. For comparisons involving the 16S rRNA gene, sequence similarity scores of ≥99% and ≥97% were suggested to give species- and genus-level distinctions, respectively [4042]. Similar levels of sequence identity were obtained in this work to Salmonella species for several of the isolates of this study, although as indicated, these cannot be definitive by themselves. A primary factor appears to be the size of the 16S rRNA gene sequence employed in the analysis. Sequences of some of the different subregions of the full-length variable region (V1–V9) provide good results for classifying different bacteria [43, 44], and a few of the variable regions, or short reads, may also provide species-level or genus-level identification [44, 45]. However, the full-length sequence of the 16S rRNA gene with ≥99% sequence identity could better provide species-level resolution [44]. Conversely, the lower the similarity between any two sequences, the more far apart (or unrelated) they should be evolutionally.

This study has some limitations. It will be necessary to investigate the full virulence potentials of the isolates, which was not fully addressed in this work. The isolation and growth conditions in this work were tilted to promote growth of Gram-negative microbes, specifically Salmonella, and the possible presence of other microbes cannot be excluded. Definitive identification of the isolates was not achieved in this work; however, this does not diminish the significance of the findings, i.e., the imminent risk from the antibiotic resistance, including transferability, and virulence properties.

7. Conclusions

This study found high levels of possibly pathogenic bacteria possessing antibiotic resistance properties and with also possibility of transfer of antibiotic and virulence properties to gut microflora. With studies on milk-borne pathogens and possible associated health hazards to consumers being scarce in Ethiopia, this study’s findings have significance from public health point of view; and importantly, these call for evaluation of both the effectiveness of the pasteurization processes in the dairy plants and inspection of the manners of postpasteurization handling of the products; defects in either one or both of which may explain the reasons for these findings.

Data Availability

Data generated for this study are available from the corresponding author upon request.

Conflicts of Interest

The author declares that there are no conflicts of interest regarding the publication of this paper.

Authors’ Contributions

SHM designed and conducted the experiments, analyzed the data, and wrote the manuscript.

Acknowledgments

The author thanks the staff of the Bacteriology Laboratory at AHRI for technical assistance and Daniel Beshah for material assistance. The availability of AHRI facilities for this work is also gratefully acknowledged. Part of the expenses were covered from AAU’s and AHRI general fund and part of the expenses by the author.

References

  1. S. P. Brown, D. M. Cornforth, and N. Mideo, “Evolution of virulence in opportunistic pathogens: generalism, plasticity, and control,” Trends in Microbiology, vol. 20, no. 7, pp. 336–342, 2012. View at: Publisher Site | Google Scholar
  2. A. Bäumler and F. C. Fang, “Host specificity of bacterial pathogens,” Cold Spring Harbor Perspectives Medicine, vol. 3, no. 12, Article ID a010041, 2013. View at: Publisher Site | Google Scholar
  3. J. A. Painter, R. M. Hoekstra, T. Ayers et al., “Attribution of foodborne illnesses, hospitalizations, and deaths to food commodities by using outbreak data, United States, 1998-2008,” Emerging Infectious Diseases, vol. 19, no. 3, pp. 407–415, 2013. View at: Publisher Site | Google Scholar
  4. A. Keba, M. L. Rolon, A. Tamene et al., “Review of the prevalence of foodborne pathogens in milk and dairy products in Ethiopia,” International Dairy Journal, vol. 109, Article ID 104762, 2020. View at: Publisher Site | Google Scholar
  5. R. A. Kingsley, C. L. Msefula, N. R. Thomson et al., “Epidemic multiple drug resistant Salmonella Typhimurium causing invasive disease in sub-Saharan Africa have a distinct genotype,” Genome Research, vol. 19, no. 12, pp. 2279–2287, 2009. View at: Publisher Site | Google Scholar
  6. E. J. Klemm, V. K. Wong, and G. Dougan, “Emergence of an extensively drug-resistant Salmonella enterica serovar Typhi clone harboring a promiscuous plasmid encoding resistance to fluoroquinolones and third-generation cephalosporins,” mBio, vol. 9, Article ID e00105, 18 pages, 2018. View at: Publisher Site | Google Scholar
  7. J. R. Tanner and R. A. Kingsley, “Evolution of Salmonella within hosts,” Trends in Microbiology, vol. 26, no. 12, pp. 986–998, 2018. View at: Publisher Site | Google Scholar
  8. E. A. Reddy, A. V. Shaw, and J. A. Crump, “Community-acquired bloodstream infections in Africa: a systematic review and meta-analysis,” Lancet Infectious Diseases, vol. 10, pp. 417–432, 2010. View at: Publisher Site | Google Scholar
  9. N. A. Feasey, G. Dougan, R. A. Kingsley, R. S. Heyderman, and M. A. Gordon, “Invasive non-typhoidal Salmonella disease: an emerging and neglected tropical disease in Africa,” Lancet, vol. 379, pp. 2489–2499, 2012. View at: Publisher Site | Google Scholar
  10. I. V. Uche, C. A. MacLennan, and A. Saul, “A systematic review of the incidence, risk factors and case fatality rates of invasive nontyphoidal Salmonella (iNTS) disease in Africa (1966 to 2014),” PLoS Neglected Tropical Diseases, vol. 11, no. 1, Article ID e0005118, 2017. View at: Publisher Site | Google Scholar
  11. C. A. Ryan, M. K. Nickels, N. Hargrett-Bean et al., “Massive outbreak of antimicrobial-resistant salmonellosis traced to pasteurized milk,” JAMA: The Journal of the American Medical Association, vol. 258, no. 22, pp. 3269–3274, 1987. View at: Publisher Site | Google Scholar
  12. S. J. Olsen, M. Ying, M. F. Davis et al., “Multidrug-resistantSalmonellaTyphimurium infection from milk contaminated after pasteurization,” Emerging Infectious Diseases, vol. 10, no. 5, pp. 932–935, 2004. View at: Publisher Site | Google Scholar
  13. J. S. Way, K. L. Josephson, S. D. Pillai, M. Abbaszadegan, C. P. Gerba, and I. L. Pepper, “Specific detection of Salmonella spp. by multiplex polymerase chain reaction,” Applied and Environmental Microbiology, vol. 59, no. 5, pp. 1473–1479, 1993. View at: Publisher Site | Google Scholar
  14. Clinical Laboratory Standards Institute (CLSI), Performance Standards for Antimicrobial Susceptibility Testing Twenty Second Informational Supplement, Document M100-S22, Clinical Laboratory Standards Institute, Wayne, PA, USA, 27th edition, 2017.
  15. N. T. Trung, T. T. T. Hien, T. T. T. Huyen et al., “Simple multiplex PCR assays to detect common pathogens and associated genes encoding for acquired extended spectrum betalactamases (ESBL) or carbapenemases from surgical site specimens in Vietnam,” Annals of Clinical Microbiology and Antimicrobials, vol. 14, no. 1, p. 23, 2015. View at: Publisher Site | Google Scholar
  16. C. Meyer, S. Van Boxstael, E. Van Meervenne et al., “Antimicrobial resistance in the food chain: a review,” International Journal of Environmental Research and Public Health, vol. 10, no. 7, pp. 2643–2669, 2013. View at: Publisher Site | Google Scholar
  17. G. de Schaetzen, G. Rahav, and O. Gal-Mor, “Horizontal transfer of the Salmonella enterica serovar infantis resistance and virulence plasmid pESI to the gut microbiota of warm-blooded hosts,” MBio, vol. 7, no. 5, pp. e01395–16, 2016. View at: Publisher Site | Google Scholar
  18. S. Pornsukarom and S. Thakur, “Horizontal dissemination of antimicrobial resistance determinants in multiple salmonella serotypes following isolation from the commercial swine operation environment after manure application,” Applied and Environmental Microbiology, vol. 83, no. 20, Article ID e01503, 17 pages, 2017. View at: Publisher Site | Google Scholar
  19. M. Conwell, V. Daniels, P. J. Naughton, and J. S. G. Dooley, “Interspecies transfer of vancomycin, erythromycin and tetracycline resistance among Enterococcus species recovered from agrarian sources,” BMC Microbiology, vol. 17, no. 1, p. 19, 2017. View at: Publisher Site | Google Scholar
  20. N. A. Lerminiaux and A. D. S. Cameron, “Horizontal transfer of antibiotic resistance genes in clinical environments,” Canadian Journal of Microbiology, vol. 65, no. 1, pp. 34–44, 2019. View at: Publisher Site | Google Scholar
  21. S. Rosenbaum, “Law and the public’s health,” Public Health Reports, vol. 129, pp. 455–457, 2014. View at: Google Scholar
  22. K. Amenu, B. Wieland, B. Szonyi, and D. Grace, “Milk handling practices and consumption behavior among Borana pastoralists in southern Ethiopia,” Journal of Health Population & Nutrition, vol. 38, p. 6, 2019. View at: Publisher Site | Google Scholar
  23. S. N. Masiello, N. H. Martin, A. Trmčić, M. Wiedmann, and K. J. Boor, “Identification and characterization of psychrotolerant coliform bacteria isolated from pasteurized fluid milk,” Journal of Dairy Science, vol. 99, no. 1, pp. 130–140, 2016. View at: Publisher Site | Google Scholar
  24. N. H. Martin, K. J. Boor, and M. Wiedmann, “Symposium review: effect of post-pasteurization contamination on fluid milk quality,” Journal of Dairy Science, vol. 101, no. 1, pp. 861–870, 2018. View at: Publisher Site | Google Scholar
  25. J. Kovac, K. J. Cummings, L. D. Rodriguez-Rivera, L. M. Carroll, A. Thachil, and M. Wiedmann, “Temporal genomic phylogeny reconstruction indicates a geospatial transmission path of Salmonella Cerro in the United States and a clade-specific loss of hydrogen sulfide production,” Frontiers in Microbiology, vol. 8, p. 737, 2017. View at: Publisher Site | Google Scholar
  26. C. Sakano, M. Kuroda, T. Sekizuka et al., “Genetic analysis of non-hydrogen sulfide-producing Salmonella enterica serovar Typhimurium and S. enterica serovar infantis isolates in Japan,” Journal of Clinical Microbiology, vol. 51, no. 1, pp. 328–330, 2013. View at: Publisher Site | Google Scholar
  27. J. Xie, F. Wu, X. Xu et al., “Antibiotic resistance and molecular characterization of the hydrogen sulfide-negative phenotype among diverse Salmonella serovars in China,” BMC Infectious Diseases, vol. 18, no. 1, p. 292, 2018. View at: Publisher Site | Google Scholar
  28. J. M. C. Li, N. H. McKenzie, M. Duncan et al., “Lack of flagella disadvantages Salmonella enterica serovar Enteritidis during the early stages of infection in the rat,” Journal of Medical Microbiology, vol. 52, no. 1, pp. 91–99, 2003. View at: Publisher Site | Google Scholar
  29. L. Flint, L. Betancor, A. Martínez, C. Bryant, D. Maskell, and J. A. Chabalgoity, “Naturally occurring motility-defective mutants of salmonella enterica serovar enteritidis isolated preferentially from nonhuman rather than human sources,” Applied and Environmental Microbiology, vol. 77, no. 21, pp. 7740–7748, 2011. View at: Publisher Site | Google Scholar
  30. R. W. Crawford, D. L. Gibson, W. W. Kay, and J. S. Gunn, “Identification of a bile-induced exopolysaccharide required for Salmonella biofilm formation on gallstone surfaces,” Infection and Immunity, vol. 76, no. 11, pp. 5341–5349, 2008. View at: Publisher Site | Google Scholar
  31. J. R. Sistrunk, K. P. Nickerson, R. B. Chanin, D. A. Rasko, and C. S. Faherty, “Survival of the fittest: how bacterial pathogens utilize bile to enhance infection,” Clinical Microbiology Reviews, vol. 29, no. 4, pp. 819–836, 2016. View at: Publisher Site | Google Scholar
  32. K. P. Nickerson and C. S. Faherty, “Bile salt-induced biofilm formation in enteric pathogens: techniques for identification and quantification,” Journal of Visualized Experiments, vol. 135, Article ID e57322, 2018. View at: Publisher Site | Google Scholar
  33. R. A. Welch, “Pore-forming cytolysins of Gram-negative bacteria,” Molecular Microbiology, vol. 5, no. 3, pp. 521–528, 1991. View at: Publisher Site | Google Scholar
  34. F. C. O. Los, T. M. Randis, R. V. Aroian, and A. J. Ratner, “Role of pore-forming toxins in bacterial infectious diseases,” Microbiology and Molecular Biology Reviews, vol. 77, no. 2, pp. 173–207, 2013. View at: Publisher Site | Google Scholar
  35. S. M. Chiang and H. E. Schellhorn, “Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria,” Archives of Biochemistry and Biophysics, vol. 525, no. 2, pp. 161–169, 2012. View at: Publisher Site | Google Scholar
  36. D. N. Fredericks and D. A. Relman, “Sequence-based identification of microbial pathogens: a reconsideration of Koch’s postulates,” Clinical Microbiology Reviews, vol. 9, no. 1, pp. 18–33, 1996. View at: Publisher Site | Google Scholar
  37. G. S. Watts, K. Youens‐Clark, M. J. Slepian et al., “16S rRNA gene sequencing on a benchtop sequencer: accuracy for identification of clinically important bacteria,” Journal of Applied Microbiology, vol. 123, no. 6, pp. 1584–1596, 2017. View at: Publisher Site | Google Scholar
  38. J. E. Clarridge, “Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases,” Clinical Microbiology Reviews, vol. 17, no. 4, pp. 840–862, 2004. View at: Publisher Site | Google Scholar
  39. S. Hong and C. E. Farrance, “Is it essential to sequence the entire 16S rRNA gene for bacterial identification?” American Pharmaceutical Review, pp. 1–7, 2015. View at: Google Scholar
  40. M. Drancourt, C. Bollet, A. Carlioz, R. Martelin, J.-P. Gayral, and D. Raoult, “16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates,” Journal of Clinical Microbiology, vol. 38, no. 10, pp. 3623–3630, 2000. View at: Publisher Site | Google Scholar
  41. J. M. Janda and S. L. Abbott, “16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils, and pitfalls,” Journal of Clinical Microbiology, vol. 45, no. 9, pp. 2761–2764, 2007. View at: Publisher Site | Google Scholar
  42. Y.-L. Chen, C.-C. Lee, Y.-L. Lin, K.-M. Yin, C.-L. Ho, and T. Liu, “Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples,” BMC Bioinformatics, vol. 16, no. Suppl 18, p. S13, 2015. View at: Publisher Site | Google Scholar
  43. P. S. Kumar, M. R. Brooker, S. E. Dowd, and T. Camerlengo, “Target region selection is a critical determinant of community fingerprints generated by 16S pyrosequencing,” PLoS One, vol. 6, no. 6, Article ID e20956, 2011. View at: Publisher Site | Google Scholar
  44. J. S. Johnson, D. J. Spakowicz, B.-Y. Hong et al., “Evaluation of 16S rRNA gene sequencing for species and strain-level microbiome analysis,” Nature Communications, vol. 10, p. 5029, 2019. View at: Publisher Site | Google Scholar
  45. J. P. Earl, N. D. Adappa, J. Krol et al., “Species-level bacterial community profiling of the healthy sinonasal microbiome using Pacific Biosciences sequencing of full-length 16S rRNA genes,” Microbiome, vol. 6, p. 190, 2018. View at: Publisher Site | Google Scholar

Copyright © 2021 Solomon H. Mariam. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views114
Downloads147
Citations

Related articles