Journal of Parasitology Research

Journal of Parasitology Research / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 8885070 | https://doi.org/10.1155/2020/8885070

Tayná C. de Goes, Rayana C. S. de Morais, Maria G. N. de Melo, Rômulo P. e Silva, Antônio M. Rezende, Milena de Paiva-Cavalcanti, "Analysis of the IGS rRNA Region and Applicability for Leishmania (V.) braziliensis Characterization", Journal of Parasitology Research, vol. 2020, Article ID 8885070, 9 pages, 2020. https://doi.org/10.1155/2020/8885070

Analysis of the IGS rRNA Region and Applicability for Leishmania (V.) braziliensis Characterization

Academic Editor: Bernard Marchand
Received27 May 2020
Revised08 Sep 2020
Accepted16 Sep 2020
Published06 Oct 2020

Abstract

The causative species is an important factor influencing the evolution of American cutaneous leishmaniasis (ACL). Due to its wide distribution in endemic areas, Leishmania (V.) braziliensis is considered one of the most important species in circulation in Brazil. Molecular targets derived from ribosomal RNA (rRNA) were used in studies to identify Leishmania spp.; however, the Intergenic Spacer (IGS) region has not yet been explored in parasite species differentiation. Besides, there is a shortage of sequences deposited in public repositories for this region. Thus, it was proposed to analyze and provide sequences of the IGS rRNA region from different Leishmania spp. and to evaluate their potential as biomarkers to characterize L. braziliensis. A set of primers was designed for complete amplification of the IGS rRNA region of Leishmania spp. PCR products were submitted to Sanger sequencing. The sequences obtained were aligned and analyzed for size and similarity, as well as deposited in GenBank. Characteristics of the repetitive elements (IGSRE) present in the IGS rRNA were also verified. In addition, a set of primers for L. braziliensis identification for qPCR was developed and optimized. Sensitivity (), specificity (), and efficiency () tests were applied. It was found that the mean size for the IGS rRNA region is 3 kb, and the similarity analysis of the sequences obtained demonstrated high conservation among the species. It was observed that the size for the IGSRE repetitive region varies between 61 and 71 bp, and there is a high identity between some species. Fifteen sequences generated for the IGS rRNA partial region of nine different species were deposited in GenBank so far. The specific primer system for L. braziliensis showed , , and for Leishmania naiffi; for Leishmania guyanensis; and for Leishmania shawi. This protocol system can be used for diagnosis, identification, and quantification of a patient’s parasite load, aiding in the direction of a more appropriate therapeutic management to the cases of infection by this etiological agent. Besides that, the unpublished sequences deposited in databases can be used for multiple analyses in different contexts.

1. Introduction

American cutaneous leishmaniasis (ACL) is a zoonosis caused by multiple species of protozoa, which belong to the genus Leishmania and family Trypanosomatidae [1]. So far, 11 dermotropic species of those parasites were identified in the new world: eight of them belong to the Viannia subgenus and three belong to the Leishmania subgenus. The evolution of this disease may range from spontaneous remission of lesions to progression of clinical manifestations, which may be diverse, and it depends on several factors, including the host immune condition and protozoan species involved [2].

In Brazil, due to its wide distribution over all areas where ACL is endemic, Leishmania (Viannia) braziliensis is considered the species that has the most clinical-epidemiological significance. The infection caused by this species tends to progress to a simpler form of the disease, the localized cutaneous leishmaniasis (LCL); however, when the immune system is particularly stimulated, the mucocutaneous (ML) form may occur. The ML disease induces a CD4 cellular response profile, predominantly of the Th1 type, which increases hypersensitivity. This feature makes ML a difficult disease to treat, sometimes leading to extreme tissue damage [3].

Early diagnosis combined with species identification is an important feature to support disease control programs. It can help in indicating the most efficient treatment, which may also vary according to a patient’s clinical manifestations [4]. In view of the difficulties in carrying out Multilocus Enzyme Electrophoresis (MLEE), the gold standard technique for species identification, many studies have demonstrated the efficacy of the quantitative Real-Time PCR (qPCR) in identifying the species of parasites due to its high accuracy and sensitivity [57].

The most used targets to perform PCR assays that are aimed at diagnosis and/or species identification are those which are derived from genes that encode ribosomal RNAs (rRNA). These genes have interspersed sequences, which are divergent, in general, among and within species, such as the region known as the Internal Transcribed Spacer (ITS) [8, 9], and they also have conserved coding sequences such as the Small Subunit (SSU rRNA) [10].

Other targets already described for species characterization are the kinetoplast DNA (kDNA) minicircles [11], glycoprotein 63 (GP63) [12], cytochrome b (Cyt b) [13], the heat shock protein (HSP) [14], and the glucose-6-phosphate-dehydrogenase (G6PD) [15] genes.

Nevertheless, in accordance with some studies involving the targets described above, there is difficulty in differentiating the species belonging to the subgenus Viannia due to the genetic similarity among them [16, 17].

The rRNA Intergenic Spacer (IGS rRNA) region was not investigated so far regarding identification of the Leishmania species, although it has already been used in other organisms [1823]. This region has a size that varies between 4 and 12 kb due to one repeated element named as the IGSRE region (IGS rRNA repeated region), which has between 16 and 275 copies; each one of them is around 62 bp, and this is where the highest amount of the regulatory elements can be found, which are crucial for rRNA gene transcription [2426].

The existing studies regarding to the IGS rRNA were conducted especially for Leishmania subgenus, demonstrating a high variability related to the size, sequence, and number of repetitions [25, 26]. However, there are no studies related to the characterization of such region regarding the species of the subgenus Viannia. Moreover, just a few sequences are available in genomic databases.

In view of this, the present work is aimed at analyzing and providing sequences of the IGS rRNA region from different Leishmania spp., and also evaluating their potential as biomarkers to characterize L. braziliensis, through qPCR.

2. Materials and Methods

2.1. Primer Design for Leishmania Spp. IGS rRNA Region Amplification

Based on Leishmania major sequences that encode the 18S (LmjF.27.rRNA.03) and the 28S rRNA (LmjF.27.rRNA.46), which are available in the TriTrypdb [27], a pair of primers was designed: a reverse primer at the beginning of 18S, and a forward primer at the end of 28S (LSUε). This pair of primers was used for the complete amplification of the IGS rRNA region (see Figure 1) of different Leishmania species. The primers were designed using the Primer Express Software (Applied Biosystems, version 2.0). Through the distance between the reference sequences (LmjF.27.rRNA.03 and LmjF.27.rRNA.46), the product size of the amplicon was estimated. The designed primers were also submitted to the BLASTn platform [28] to search the sequences isolated from the IGS rRNA region within sequences of the Chromosome 27 of Leishmania spp., and to determine the sizes and sequences for each species, which were used as references for in silico alignment.

2.2. PCR of IGS rRNA Region for Different Leishmania Species

Using the designed set of primers and genomic DNA samples from reference strains of 11 Leishmania species (see Table 1) obtained from the Leishmaniose Reference Services of the Aggeu Magalhães Institute, a conventional PCR was performed using the following cycling and reaction conditions: Taq DNA polymerase recombinant enzyme (Invitrogen™, CA, USA), with both primers at a concentration of 10 μM; 10x PCR buffer; 2 mM of dNTPs; 25 mM of MgCl2; 2 μL of DNA template at a concentration of 10 ng; and type I water. Thus, the complete final volume is 25 μL. Cycling conditions were 94°C/2 minutes (initial denaturation); 10 cycles of 94°C/30 seconds (denaturation), 64°C/30 seconds (primer hybridization), and 68°C/2 minutes and 30 seconds (DNA extension); and followed by 35 cycles of 94°C/30 seconds (denaturation), 54°C/30 seconds (primer hybridization), and 72°C/2 minutes and 30 seconds (DNA extension).


SpeciesStrain code

Leishmania braziliensisMHOM/BR/1975/M2903
Leishmania guyanensisMHOM/BR/1975/M4147
Leishmania shawiIWHI/BR/1999/M17904
Leishmania naiffiMDAS/BR/1990/M5533
Leishmania lainsoniMHOM/BR/1981/M6426
Leishmania amazonensesIFLA/BR/1967/PH8
Leishmania mexicanaMHOM/BZ/1982/BEL 21
Leishmania tropicaMHOM/SU/1958/strain OD
Leishmania majorMRHO/SU/1959/P-strain
Leishmania donovaniMHOM/ET/1967/HU3
Leishmania infantum/chagasiMHOM/TN/1980/IPT1
Trypanosoma cruziY strain

The reagent mix without the DNA sample was used as a negative control. Temperature cycling was performed using the Eppendorf Mastercycler gradient equipment.

The PCR products were analyzed through agarose gel electrophoresis. The amplicons with the closest sizes to those estimated through in silico analysis were excised from the gel and submitted to purification and sequencing.

2.3. Sequencing of PCR Products

The specific amplified fragments extracted from the agarose gel obtained after the PCR reaction were purified through the PureLink Quick Gel Extraction and PCR Purification Combo kit (Invitrogen, Life Technologies™, CA, USA) and submitted to Sanger sequencing using the designed primers (Section 2.1) and the BigDye Terminator Cycle Sequencing Kit (version 3.1) (Applied Biosystems, CA, USA), in an automatic sequencer (ABI 3500xL Genetic Analyzer). The sequences were determined in two directions for each species. Each fragment was sequenced twice on average.

2.4. In Silico Sequence Analysis and Alignment

Using the Chromas software (version 2.6.6), the Phred score [29] was verified for sequences obtained by the Sanger sequencing assay. Afterwards, these sequences were analyzed by BLASTn to verify the coverage and identity with Leishmania spp. Chromosome 27 sequences available on GenBank. Using the MAFFT (Multiple Alignment using Fast Fourier Transform) algorithm, through the softwares AliView (version 1.18.1) and BioEdit (version 7.2.6), alignments between the studied and the reference sequences were performed (Section 2.1). Through the alignments, similarities and conservation level between the IGS rRNA region and species were verified.

Moreover, it was possible to localize, by visual identification, the IGSRE region for some species. Afterwards, a comparison between species and subgenus, related to size and quantity of repetitions, was performed in this region.

The sequences obtained in this work were deposited in the GenBank database through the BankIt/NCBI platform [30].

2.5. Development and Optimization of Primer System for L. braziliensis Identification

From the performed alignment, a primer system that was able to identify only the L. braziliensis species was designed. The system design was performed using the software Primer Express (Applied Biosystems, version 2.0).

To define the detection limit, serial dilutions (factor 10) of genomic DNA from Leishmania spp. reference strains in quantities of 1 fg to 1 ng were prepared, and as negative control, a sample without DNA was used. Detection limits were defined in order to be applied in SYBR® Green-based qPCR, using QuantStudio™ (Applied Biosystems®, CA, USA) equipment. All samples were performed in duplicate, and the following conditions were employed for the experiments: 95°C/15 s (denaturation) and 60°C/1 min (primer hybridization), at 40 cycles.

The sensitivity () of the assay was defined as the lowest DNA concentration which promoted amplification of the target. The efficiency () was determined by the following formula: . In order to evaluate the specificity () for L. braziliensis, five other Leishmania spp. (L. naiffi, L. guyanensis, L. shawi, L. infantum, and L. amazonensis) and Trypanosoma cruzi (strain Y) genomic DNA were used as test samples. The specificity was defined by , where stands for amplification efficiency and is the difference in threshold cycle () values of the target and test samples [30].

Analysis and recording of results of the experiments were carried out using the QuantStudio™ Design and Analysis Software (version 1.4.3).

3. Results

3.1. Primer Design for Leishmania Spp. IGS rRNA Region Amplification

The designed primers based on L. major sequences (Section 2.1) displayed a profile demonstrated in Table 2.


Genome locationPrimerSize% C/G

L. major region 28S rRNA end28S F 5-GAGGCCTGAAATTTCATGCTC-321 bases47.62%62°C
L. major region 18S rRNA start18S R 5-GATCTGGTTGATTCTGCCAG-320 bases50%60°C

IGS—Intergenic Spacer; rRNA—ribosomal RNA; % C/G—cytosine/guanine percentage; —melting temperature.

From a GenBank search, eight species were found to have complete or partial sequences available for Chromosome 27: Leishmania infantum (CP027826. 1), Leishmania mexicana (FR799580.1), L. major (FR796423.1), Leishmania amazonensis (AF060493.2), Leishmania donovani (CP029526.1), Leishmania peruviana (LN609266.1), Leishmania panamensis (CP009396.1), and L. braziliensis (FR799002.1). The designed primers (Section 2.1) were localized in these sequences, and only their products were isolated, that is, the IGS rRNA regions, which were used as reference.

The searching for oligonucleotides in BLASTn demonstrated the possibility for isolating the IGS rRNA region from five species wherein the two primers were found. A great variety related to the quantity and size of the region among species was observed. The average size obtained for these sequences was approximately 3 kb (see Table 3).


Primers foundSpecies/IDQuantity of IGS rRNA regions foundAverage size of IGS rRNA (kb) regions

28SF and 18SRLeishmania donovani/CP02264223.22
Leishmania peruviana/LN60926611.39
Leishmania mexicana/FR79958022.03
Leishmania major/FR79642364.41
Leishmania amazonensis/AF06049312.5
28SFLeishmania braziliensis/FR799002

Legend: IGS—Intergenic Spacer; rRNA—ribosomal RNA; ID—NCBI sequence identification code; kb—kilobases; F—forward; R—reverse.

The species used for the molecular test showed a diverse band pattern (see Figure 2), in which the majority demonstrated at least one band size compatible with the estimated in silico (3 kb).

3.2. Capillary Sequencing of the IGS rRNA Region

A length average of 837.3 bases for sequenced species using the 28SF primer and a length average of 846.4 bases for sequenced species using the 18SR primer were obtained. Nine out of eleven species demonstrated a good sequence quality (Phred score: ≥30) for the reverse primer, and six for the forward primer (see Table 4). Alignment of all the sequences obtained from the 28SF and 18SR primers separately in each species was performed. It was observed that a considerable similarity among the species was presented. The sequences obtained from the 18SR primer achieved a better quality, in which the Phred scores were above 30, thus enabling the analysis of all of them by BLASTn (see Table 5).


SpecieSize (bases)
28SF18SR

Leishmania braziliensis371934
Leishmania guyanensis921524
Leishmania shawi1026942
Leishmania naiffi10081012
Leishmania lainsoni756763
Leishmania amazonensis9361000
Leishmania mexicana981
Leishmania tropica928
Leishmania donovani541

Legend: F—forward; R—reverse.

SpeciesBLAST sequence per primer
28S F (cov%/id%)Species with greater similarity18S R (cov%/id%)Species with greater similarity

Leishmania braziliensis100/99Leishmania peruviana98/99L. panamensis
Leishmania guyanensis86/99Leishmania panamensis22/99L. panamensis
Leishmania shawi99/97L. peruviana95/87L. braziliensis
Leishmania naiffi99/96L. peruviana99/89L. peruviana
Leishmania lainsoni98/97L. panamensis45/74L. braziliensis
Leishmania amazonensis100/97L. amazonensis100/99L. amazonensis
Leishmania mexicana100/99L. mexicana
Leishmania tropica100/96L. donovani
Leishmania donovani63/100L. donovani

Legend: F—forward; R—reverse; BLASTn—Basic Local Alignment Search Tool nucleotide; cov%—coverage percentage; id%—identity percentage.

It was observed that in the alignment of the sequences obtained from the 18SR primer, it was indicated that the sequence of L. braziliensis was shown to be distinct from those belonging to the different species studied, thus demonstrating that IGS rRNA is a promising region for the unique identification of this species.

3.3. In Silico Analysis of the IGSRE Region

After capillary sequencing, the repeated IGSRE region was found in sequences from the L. shawi, L. naiffi, and L. amazonensis species. Furthermore, after analysing the complete Chromosome 27 sequences, it was possible to find such region in L. braziliensis, L. peruviana, L. donovani, L. major, and L. mexicana.

It was observed that the IGSRE from L. shawi, L. naiffi, and L. peruviana species are similar. IGSRE is also similar between L. amazonensis and L. mexicana (see Table 6).


SpeciesIGSRESize (bp)

LbCTGTGGCGGCCCCCTTTGTTATGTTGTTCAGAAGCACATCCGTCGATTCCTTTTGTCTCCTTTCCGATGCC71
LpGAAGCACCACACTGCACAGCTGCGCATCGCCACCAAGACGGGTCAAAAGCAGCGGAACGCA61
LsGAAGCACCACACTGCACAGCTGCGCATAGCCGCCAAGACGGGTCAAAAGCAGCGGAACGCA61
LnGAAGCACCACACTGCACAGCTGCGCATAGCCGCCAGGACGGATCAAAAGCAGCGGAACGCA61
LaCCCAGTACTTGGACATTCCCTTTCGCCACGCGCAGGGCCGCTGGAGGCGCACTCCTTCGCGT62
LmxCCCAGTACTTGGACATTCCCTTTCGTCACGCGCAGGGCCGTCGGAGGCGCACTGGTTTGCGT62
LdTTTTCGCTGCGAGGGAGACCCTCGCGGGAGCATTGCTTCGCGCCCCAGTACTGGAACATTCCCG64
LmjCCCCAGTAGTCGAGCATTTGCGTTTCGCCACGAGGGAGGCTCTTGCAGGAGCGTTGTGTCGCG63

Legend: IGS—Intergenic Spacer; rRNA—ribosomal RNA; Ld—Leishmania donovani; Lb—Leishmania braziliensis; Lmj—Leishmania major; Lmx—Leishmania mexicana; Lp—Leishmania peruviana; Ls—Leishmania shawi; Ln—Leishmania naiffi; La—Leishmania amazonensis; bp—base pairs.

Likewise, variation in the amount of repetitions in different IGS rRNA regions of the same species was observed (see Table 7).


SpeciesNumber of repetitive regions (IGSRE) inserted in each IGS rRNA region
1st2nd3rd4th5th6th
Leishmania major81215372810
Leishmania braziliensis6143960
Leishmania donovani2320
Leishmania mexicana3430
Leishmania peruviana265

The number of repetitions of the IGS rRNA region inserted in Chromosome 27 is shown in italics. The quantity of repetitions of the IGSRE region for each IGS rRNA region, by Leishmania species, is shown in bold numbers.
3.4. Depositing Sequences to GenBank

The sequences acquired in this work were placed in the GenBank database under access numbers MK493617 and MK493618 for L. amazonensis, MK493607 and MK493608 for L. braziliensis, MK493615 and MK493616 for L. lainsoni, MK493613 and MK493614 for L. guyanensis, MK493609 and MK493610 for L. shawi, MK493620 for L. tropica, MK493619 for L. mexicana, MK493621 for L. donovani, and MK493611 and MK493612 for L. naiffi.

3.5. Design of Specific Primers for L. braziliensis

Based on L. braziliensis IGS rRNA sequence, a specific set of primers was designed for this species, in order to be applied in SYBR® Green-based qPCR. Their general characteristics are presented in Table 8.


Genome locationPrimersSize% C/G

IGS rRNALb/IGS F 5-CGCACAAAACACACACTGGT-320 bases50%59.8°C
IGS rRNALb/IGS R 5-TTCATGCTCAGGGACACACTC-321 bases52%60°C

Legend: IGS—Intergenic Spacer; rRNA—ribosomal RNA; Lb—Leishmania braziliensis; F—forward; R—reverse; % C/G—percentage of cytosine/guanine; —melting temperature.

The amplification product of 148 bp from primers Lb/IGS F and R was sequenced and submitted to BLASTn analysis. Full coverage and 100%, 99%, and 90% identity with L. braziliensis, L. peruviana, and L. panamensis were demonstrated, respectively.

3.6. Analytical Sensitivity and Specificity for the Lb/IGS System

The designed system was able to amplify L. braziliensis DNA up to 10 fg for the reaction, which is equivalent to 0.13 parasites, and the reaction efficiency was 98.08% (see Figure 3). There was a cross reaction with other species belonging only to the Viannia subgenus, with the specificity calculation being applied then, which demonstrated that the system is around 103-fold (), 104-fold (), and 105-fold () more specific for L. braziliensis than for L. naiffi, L. guyanensis, and L. shawi, respectively.

4. Discussion

There is a consensus related to the need for distinction among the Leishmania species which are harmful to man. This is due to the strong influence presented by different species in clinical manifestation developed in individuals. Thus, the development of efficient diagnostic methods and the discovery of suitable biomarkers able to detect and identify Leishmania species are necessary in order to carry out therapeutic approaches that are specie-specific, this being a vital aspect to improve the control programs related to infection caused by Leishmania sp. [31, 32].

A greater understanding acquired currently about Leishmania sp. genome brought considerable breakthroughs, which were converted into modern diagnostic methods. Several molecular targets have already been studied in order to find one that would be able to categorize the Leishmania species [6, 7]. The variation of the results among the existing methodologies lies in the inconsistency in patterns according to the markers used, the possibility of mixed infection, and the similarity between the species, especially those belonging to the subgenus Viannia. [15, 16].

Ribosomal RNA (rRNA) derivatives are among the most analyzed molecular targets for the detection of Leishmania sp., where the Small Subunit (SSU rRNA) stands out, due to their high degree of conservation [10]. For species distinction, the Internal Transcribed Spacer (ITS) is evident. It was already shown to be able to identify Leishmania spp. at the complex level, but it was able to identify only Leishmania aethiopica, Leishmania tropica, Leishmania major, and Leishmania turanica at the species level [8, 15, 3335].

The Intergenic Spacer of rRNA (IGS rRNA) demonstrated suitable sequences for differentiation between bacterial species Bacillus grandii and Bacillus atticus, which are closely related [22], besides trypanosomatids such as Trypanosoma cruzi and Trypanosoma congolense [1820]. However, there are no studies reporting the use of such region for the diagnosis or characterization of the Leishmania species [7]. In fact, there is a lack of studies focusing on this region in general, it being characterized only for the L. major [26], L. amazonensis [36], L. tarentolae, and L. hoogstraali species [25, 37]. There are no detailed studies for the Viannia subgenus.

In the present study, a set of primers flanking the IGS rRNA region was designed to fully amplify it. The IGS rRNA region size was different among the five species, which made it possible to delimit this region using the 28SF and 18SR primers, ranging approximately from 2 to 4 kbp (Table 3), diverging from literature data, which show that the minimum size for this region is about 4 kbp [25]. The repetitive IGSRE region found in the present study has the same size and sequence as those previously published for L. major, L. donovani, and L. amazonensis species [26, 36]. Furthermore, we highlight the presence of IGSRE in the sequences of five other species, with a total variation of 6-265 in the number of copies; so far this variation was between 16 and 275 repetitions [26].

The complete sequencing of several Leishmania sp. genomes opened a new era related to the diagnosis and identification of causative species of leishmaniasis. Nine species have their complete genome published, but from these, only two are from the Viannia subgenus [3845]. In the present study, part of the IGS rRNA region from eleven different species of Leishmania was sequenced, including five species of the Viannia subgenus. Among the six species belonging to the Leishmania subgenus, the one included in this analysis (L. infantum/chagasi) does not have its sequence published for such region.

In some cases, the use of methods that generate higher readings, such as Sanger sequencing, may be more suitable for repetitive region analysis [45]. In the meantime, with the results obtained in this work after Sanger sequencing, it was not possible to assemble a consensus sequence, due to the long region size and reading limitation of capillary sequencing.

Currently, there is no unique method to diagnose all of the pathogenic Leishmania species [7]. Sequencing-derived techniques (e.g., Multilocus Sequence Typing (MLST)) and PCR (e.g., the Real-Time quantitative PCR (qPCR)) come as alternatives to Multilocus Enzyme Electrophoresis, the gold standard to characterize Leishmania spp., which cannot be widespread due to some limitations [6].

A high conservation of the IGS rRNA region was observed, which demonstrates that it could not be applied as a target for characterization at species level. Nevertheless, after the alignment analysis, it was possible to observe a region in which the nucleotide sequence could be used to distinguish L. braziliensis species from others of the subgenus Viannia; L. braziliensis is the etiological agent of ACL with greater distribution in Brazil and in the Americas [2], and a molecular tool able to accurately detect and differentiate this species would be very welcome. The infections caused by L. braziliensis correspond to lesions with scarce parasites. In this case, qPCR might be useful to confirm the diagnosis, besides evaluating the parasitic load, providing advantages once infections caused by this species may evolve to mucocutaneous form, which requires differentiated clinical and therapeutic management [46].

Despite the high coverage and identity shown in the in silico analysis of the primers of the Lb/IGS system, as only Lb had 100% cob/id, we decided to carry out the experiments, with a proposal for the possible use of hybridization probes to increase specificity. The Lb/IGS primer system presented a satisfactory performance in optimization tests and exhibited a high sensitivity for the detection of L. braziliensis in assays with 98.08% analytical efficiency. These results showed a higher efficiency when compared to other similar studies [10, 46]. The cross reaction obtained only for species of the Viannia subgenus emphasizes the high genetic similarities among them. However, since the concentrations detected for the species that were not the target of the system were higher than that detected for L. braziliensis, it was possible to differentiate them by calculating specificity.

Finally, the availability of the sequences in genomic databases, such as GenBank, enables a wide view of the information generated in the present work and enables new studies to be generated on this underexplored region, such as the development or improvement of molecular diagnostic tools that are aimed at species differentiation, as carried out herein. Besides, the availability of such sequences may boost the execution of studies to acquire a better understanding related to the genome of causative species of ACL, as well as their peculiarities.

5. Conclusions

Despite the high conservation for this region, the L. braziliensis sequence appeared to distinct and became the target of a set of primers for unique identification of this species. Through the protocol based on optimized quantitative Real-Time PCR, the system can be used for diagnosis, identification, and quantification of a patient’s parasite load, supporting and guiding a more appropriate therapeutic approach for cases of infections caused by this etiological agent.

Data Availability

The dataset supporting the conclusions of this article is included within the article (and its additional file).

Conflicts of Interest

The authors declare that they have no conflict of interests.

Acknowledgments

The authors thank Dr. Maria Edileuza Felinto de Brito and Dr. Virgínia Maria Barros de Lorena from the Leishmaniose and Chagas Reference Services of the Aggeu Magalhães Institute (IAM/FIOCRUZ-PE) for the availability of the reference strains used in this study. The authors thank Dr. Viviane do Carmo from the Nucleus of Technological Platforms of the IAM/FIOCRUZ-PE for carrying out the capillary sequencing. The authors thank Dr. Gabriel Wallau, João Luiz Pitta, and Crhislanne Vasconcelos for helping with bioinformatics tools. The authors also thank the Technological Development in Health Supplies Program (PDTIS/FIOCRUZ) for allowing the use of their facilities. The reagents for the molecular assays as well as the material for sample collection were acquired through the financial support of the Fundação de Amparo à Ciência e Tecnologia de Pernambuco (FACEPE)—Programa de Excelência em Pesquisa (PROEP) (APQ: 1558-2.13/15) and the National Council of Technological and Scientific Development (CNPq) (PQ: 301223/2018-1). All authors are grateful for the financial support provided by CNPq, CAPES, and FACEPE. The authors also thank the EDITAL FACEPE 19/2015, for support to the Program of Excellence in Research (PROEP).

References

  1. R. Reithinger, J.-C. Dujardin, H. Louzir, C. Pirmez, B. Alexander, and S. Brooker, “Cutaneous leishmaniasis,” The Lancet Infectious Diseases, vol. 7, no. 9, pp. 581–596, 2007. View at: Publisher Site | Google Scholar
  2. R. Lainson and J. J. Shaw, “New World leishmaniasis,” Topley & Wilson's Microbiology and Microbial Infections, vol. 1, 2010. View at: Publisher Site | Google Scholar
  3. E. Bifeld and J. Clos, “The genetics of Leishmania virulence,” Medical Microbiology and Immunology, vol. 204, no. 6, pp. 619–634, 2015. View at: Publisher Site | Google Scholar
  4. A. Stauch, H. P. Duerr, A. Picado et al., “Model-based investigations of different vector-related intervention strategies to eliminate visceral Leishmaniasis on the Indian subcontinent,” PLoS Neglected Tropical Diseases, vol. 8, no. 4, article e2810, 2014. View at: Publisher Site | Google Scholar
  5. R. C. S. de Morais, C. N. da Costa Oliveira, S. da Cunha Gonçalves de Albuquerque et al., “Real-time PCR for Leishmania species identification: evaluation and comparison with classical techniques,” Experimental Parasitology, vol. 165, pp. 43–50, 2016. View at: Publisher Site | Google Scholar
  6. G. Van der Auwera and J.-C. Dujardin, “Species typing in dermal leishmaniasis,” Clinical Microbiology Reviews, vol. 28, no. 2, pp. 265–294, 2015. View at: Publisher Site | Google Scholar
  7. M. Akhoundi, T. Downing, J. Votýpka et al., “Leishmania infections: molecular targets and diagnosis,” Molecular Aspects of Medicine, vol. 57, pp. 1–29, 2017. View at: Publisher Site | Google Scholar
  8. H. A. El-Beshbishy, K. H. Al-Ali, and A. A. El-Badry, “Molecular characterization of cutaneous leishmaniasis in Al-Madinah Al-Munawarah province, western Saudi Arabia,” International Society for Infectious Diseases, vol. 17, no. 5, pp. e334–e338, 2013. View at: Publisher Site | Google Scholar
  9. M. E. de Almeida, F. J. Steurer, O. Koru, B. L. Herwaldt, N. J. Pieniazek, and A. J. da Silva, “Identification of Leishmania spp. by molecular amplification and DNA sequencing analysis of a fragment of rRNA internal transcribed spacer 2,” Journal of Clinical Microbiology, vol. 49, no. 9, pp. 3143–3149, 2011. View at: Publisher Site | Google Scholar
  10. M. de Paiva Cavalcanti, F. Dantas-Torres, S. da Cunha Gonçalves de Albuquerque et al., “Quantitative real time PCR assays for the detection of Leishmania (Viannia) braziliensis in animals and humans,” Molecular and Cellular Probes, vol. 27, no. 3-4, pp. 122–128, 2013. View at: Publisher Site | Google Scholar
  11. M. Jara, V. Adaui, B. M. Valencia et al., “Real-time PCR assay for detection and quantification of Leishmania (Viannia) organisms in skin and mucosal lesions: exploratory study of parasite load and clinical parameters,” Journal of Clinical Microbiology, vol. 51, no. 6, pp. 1826–1833, 2013. View at: Publisher Site | Google Scholar
  12. K. Victoire, S. De Doncker, L. Cabrera et al., “Direct identification of Leishmania species in biopsies from patients with American tegumentary leishmaniasis,” Transactions of the Royal Society of Tropical Medicine and Hygiene, vol. 97, no. 1, pp. 80–87, 2003. View at: Publisher Site | Google Scholar
  13. B. M. Valencia, N. Veland, M. Alba et al., “Non-invasive cytology brush PCR for the diagnosis and causative species identification of American cutaneous leishmaniasis in Peru,” PLoS One, vol. 7, no. 11, article e49738, 2012. View at: Publisher Site | Google Scholar
  14. J. Fraga, A. M. Montalvo, G. Van der Auwera, I. Maes, J. C. Dujardin, and J. M. Requena, “Evolution and species discrimination according to the Leishmania heat-shock protein 20 gene,” Infection, Genetics and Evolution, vol. 18, pp. 229–237, 2013. View at: Publisher Site | Google Scholar
  15. G. C. da Graça, A. C. Volpini, G. A. S. Romero et al., “Development and validation of PCR-based assays for diagnosis of American cutaneous leishmaniasis and identification of the parasite species,” Memórias do Instituto Oswaldo Cruz, vol. 107, no. 5, pp. 664–674, 2012. View at: Publisher Site | Google Scholar
  16. I. Cruz, A. Millet, E. Carrillo et al., “An approach for interlaboratory comparison of conventional and real-time PCR assays for diagnosis of human leishmaniasis,” Experimental Parasitology, vol. 134, no. 3, pp. 281–289, 2013. View at: Publisher Site | Google Scholar
  17. J. H. Roelfsema, N. Nozari, T. Herremans, L. M. Kortbeek, and E. Pinelli, “Evaluation and improvement of two PCR targets in molecular typing of clinical samples of Leishmania patients,” Experimental Parasitology, vol. 127, no. 1, pp. 36–41, 2011. View at: Publisher Site | Google Scholar
  18. P. Dietrich, M. B. Soares, M. H. T. Affonso, and L. M. Floeter-Winter, “The Trypanosoma cruzi ribosomal RNA-encoding gene: analysis of promoter and upstream intergenic spacer sequences,” Gene, vol. 125, no. 1, pp. 103–107, 1993. View at: Publisher Site | Google Scholar
  19. S. Martínez-Calvillo and R. Hernández, “Trypanosoma cruzi ribosomal DNA: mapping of a putative distal promoter,” Gene, vol. 142, no. 2, pp. 243–247, 1994. View at: Publisher Site | Google Scholar
  20. N. Downey and J. E. Donelson, “Search for promoters for the GARP and rRNA genes of Trypanosoma congolense,” Molecular and Biochemical Parasitology, vol. 104, no. 1, pp. 25–38, 1999. View at: Publisher Site | Google Scholar
  21. J. F. Elder and B. J. Turner, “Concerted Evolution of repetitive DNA Sequences in Eukaryotes,” The Quarterly Review of Biology, vol. 70, no. 3, pp. 297–320, 1995. View at: Publisher Site | Google Scholar
  22. A. Ricci, V. Scali, and M. Passamonti, “The IGS-ETS in Bacillus (Insecta Phasmida): molecular characterization and the relevance of sex in ribosomal DNA evolution,” BMC Evolutionary Biology, vol. 8, no. 1, p. 278, 2008. View at: Publisher Site | Google Scholar
  23. M. N. Schnare, J. C. Collings, D. F. Spencer, and M. W. Gray, “The 28S-18S rDNA intergenic spacer from Crithidia fasciculata: repeated sequences, length heterogeneity, putative processing sites and potential interactions between U3 small nucleolar RNA and the ribosomal RNA precursor,” Nucleic Acids Research, vol. 28, no. 18, pp. 3452–3461, 2000. View at: Publisher Site | Google Scholar
  24. B. Sollner-Webb and E. B. Mougey, “News from the nucleolus: rRNA gene expression,” Trends in Biochemical Sciences, vol. 16, no. 2, pp. 58–62, 1991. View at: Publisher Site | Google Scholar
  25. T. C. Orlando, M. A. T. Rubio, N. R. Sturm, D. A. Campbell, and L. M. Floeter-Winter, “Intergenic and external transcribed spacers of ribosomal RNA genes in lizard-infecting Leishmania: molecular structure and phylogenetic relationship to mammal-infecting Leishmania in the subgenus Leishmania (Leishmania),” Memórias do Instituto Oswaldo Cruz, vol. 97, no. 5, pp. 695–701, 2002. View at: Publisher Site | Google Scholar
  26. S. Martinez-Calvillo, S. M. Sunkin, S.-F. Yan, M. Fox, K. Stuart, and P. J. Myler, “Genomic organization and functional characterization of the Leishmania major Friedlin ribosomal RNA gene locus,” Molecular and Biochemical Parasitology, vol. 116, no. 2, pp. 147–157, 2001. View at: Publisher Site | Google Scholar
  27. M. Aslett, C. Aurrecoechea, M. Berriman et al., “TriTrypDB: a functional genomic resource for the Trypanosomatidae,” Nucleic Acids Research, vol. 38, suppl_1, pp. D457–D462, 2010. View at: Publisher Site | Google Scholar
  28. S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman, “Basic local alignment search tool,” Journal of Molecular Biology, vol. 215, no. 3, pp. 403–410, 1990. View at: Publisher Site | Google Scholar
  29. B. Ewing, L. D. Hillier, M. C. Wendl, and P. Green, “Base-Calling of Automated Sequencer Traces UsingPhred. I. Accuracy Assessment,” Genome Research, vol. 8, no. 3, pp. 175–185, 1998. View at: Publisher Site | Google Scholar
  30. M. Fetchko and A. Kitts, What is BankIt? GenBank Submissions Handbook. Bethesda (MD): National Center for Biotechnology Information (US), 2011, https://www.ncbi.nlm.nih.gov/books/NBK63590/.
  31. G. F. Medley, T. D. Hollingsworth, P. L. Olliaro, and E. R. Adams, “Health-seeking behaviour, diagnostics and transmission dynamics in the control of visceral leishmaniasis in the Indian subcontinent,” Nature, vol. 528, no. 7580, pp. S102–S108, 2015. View at: Publisher Site | Google Scholar
  32. J. Blum, D. N. J. Lockwood, L. Visser et al., “Local or systemic treatment for New World cutaneous leishmaniasis? Re-evaluating the evidence for the risk of mucosal leishmaniasis,” International Health, vol. 4, no. 3, pp. 153–163, 2012. View at: Publisher Site | Google Scholar
  33. S. Odiwuor, M. Vuylsteke, S. De Doncker et al., “Leishmania AFLP: paving the way towards improved molecular assays and markers of diversity,” Infection, Genetics and Evolution, vol. 11, no. 5, pp. 960–967, 2011. View at: Publisher Site | Google Scholar
  34. G. Schönian, L. Schnur, M. El Fari et al., “Genetic heterogeneity in the species Leishmania tropica revealed by different PCR-based methods,” Transactions of the Royal Society of Tropical Medicine and Hygiene, vol. 95, no. 2, pp. 217–224, 2001. View at: Publisher Site | Google Scholar
  35. G. Schönian, A. Nasereddin, N. Dinse et al., “PCR diagnosis and characterization of Leishmania in local and imported clinical samples,” Diagnostic Microbiology and Infectious Disease, vol. 47, no. 1, pp. 349–358, 2003. View at: Publisher Site | Google Scholar
  36. M. T. Abreu-Blanco, J. L. Ramírez, D. M. Pinto-Santini, B. Papadopoulou, and P. Guevara, “Analysis of ribosomal RNA transcription termination and 3 end processing in Leishmania amazonensis,” Gene, vol. 451, no. 1-2, pp. 15–22, 2010. View at: Publisher Site | Google Scholar
  37. M. R. S. Briones, K. Nelson, S. M. Beverley, H. T. Affonso, E. P. Camargo, and L. M. Floeter-Winter, “Leishmania tarentolae taxonomic relatedness inferred from phylogenetic analysis of the small subunit ribosomal RNA gene,” Molecular and Biochemical Parasitology, vol. 53, no. 1-2, pp. 121–127, 1992. View at: Publisher Site | Google Scholar
  38. A. C. Ivens, C. S. Peacock, E. A. Worthey et al., “The genome of the kinetoplastid parasite Leishmania major,” Science, vol. 309, no. 5733, pp. 436–442, 2005. View at: Publisher Site | Google Scholar
  39. T. Downing, H. Imamura, S. Decuypere et al., “Whole genome sequencing of multiple Leishmania donovani clinical isolates provides insights into population structure and mechanisms of drug resistance,” Genome Research, vol. 21, no. 12, pp. 2143–2156, 2011. View at: Publisher Site | Google Scholar
  40. C. S. Peacock, K. Seeger, D. Harris et al., “Comparative genomic analysis of three Leishmania species that cause diverse human disease,” Nature Genetics, vol. 39, no. 7, pp. 839–847, 2007. View at: Publisher Site | Google Scholar
  41. F. Real, R. O. Vidal, M. F. Carazzolle et al., “The genome sequence of Leishmania (Leishmania) amazonensis: functional annotation and extended analysis of gene models,” DNA Research, vol. 20, no. 6, pp. 567–581, 2013. View at: Publisher Site | Google Scholar
  42. M. B. Rogers, J. D. Hilley, N. J. Dickens et al., “Chromosome and gene copy number variation allow major structural change between species and strains of Leishmania,” Genome Research, vol. 21, no. 12, pp. 2129–2142, 2011. View at: Publisher Site | Google Scholar
  43. S. Coughlan, P. Mulhair, M. Sanders, G. Schonian, J. A. Cotton, and T. Downing, “The genome of Leishmania adleri from a mammalian host highlights chromosome fission in Sauroleishmania,” Scientific Reports, vol. 7, no. 1, pp. 1–13, 2017. View at: Publisher Site | Google Scholar
  44. F. Raymond, S. Boisvert, G. Roy et al., “Genome sequencing of the lizard parasite Leishmania tarentolae reveals loss of genes associated to the intracellular stage of human pathogenic species,” Nucleic Acids Research, vol. 40, no. 3, pp. 1131–1147, 2012. View at: Publisher Site | Google Scholar
  45. A. Llanes, C. M. Restrepo, G. Del Vecchio, F. J. Anguizola, and R. Lleonart, “The genome of Leishmania panamensis: insights into genomics of the L. (Viannia) subgenus,” Scientific Reports, vol. 5, no. 1, 2015. View at: Publisher Site | Google Scholar
  46. L. O. R. Pereira, R. B. Moreira, M. P. de Oliveira, S. O. Reis, M. P. de Oliveira Neto, and C. Pirmez, “Is Leishmania (Viannia) braziliensis parasite load associated with disease pathogenesis?” International Journal of Infectious Diseases, vol. 57, pp. 132–137, 2017. View at: Publisher Site | Google Scholar

Copyright © 2020 Tayná C. de Goes et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views483
Downloads295
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.