Oxidative Medicine and Cellular Longevity

Oxidative Medicine and Cellular Longevity / 2016 / Article
Special Issue

Modulation of Oxidative Stress: Pharmaceutical and Pharmacological Aspects

View this Special Issue

Research Article | Open Access

Volume 2016 |Article ID 8453135 | 14 pages | https://doi.org/10.1155/2016/8453135

The Role of the Exo-Xis Region in Oxidative Stress-Mediated Induction of Shiga Toxin-Converting Prophages

Academic Editor: Luciano Saso
Received11 Aug 2015
Revised22 Sep 2015
Accepted28 Sep 2015
Published20 Dec 2015

Abstract

Previous studies indicated that these genetic elements could be involved in the regulation of lysogenization and prophage induction processes. The effects were dramatic in Shiga toxin-converting phage after treatment with oxidative stress-inducing agent, hydrogen peroxide, while they were less pronounced in bacteriophage λ and in both phages irradiated with UV. The hydrogen peroxide-caused prophage induction was found to be RecA-dependent. Importantly, in hydrogen peroxide-treated E. coli cells lysogenic for either λ or , deletion of the exo-xis region resulted in a significant decrease in the levels of expression of the S.O.S. regulon genes. Moreover, under these conditions, a dramatic decrease in the levels of expression of phage genes crucial for lytic development (particularly xis, exo, N, cro, O, Q, and R) could be observed in -, but not in λ-bearing cells. We conclude that genes located in the exo-xis region are necessary for efficient expression of both host S.O.S regulon in lysogenic bacteria and regulatory genes of Shiga toxin-converting bacteriophage .

1. Introduction

Infection of humans by enterohemorrhagic Escherichia coli (EHEC) strains causes hemorrhagic colitis, and in some patients it may result in various complications, including, the most severe of them, the hemolytic-uremic syndrome and neurological dysfunctions [13]. The main causes of EHEC-mediated complications are Shiga toxins, produced by the infecting bacteria [4]. The severity of EHEC infections and significance of the medical problem related to them are exemplified by local outbreaks, occurring in various geographical regions around the world. One of the most famous of them took place in 2011 in Germany, where over 4,000 patients developed severe symptoms, and 54 died [510].

In EHEC strains, Shiga toxins are encoded by genes (called stx genes) located in genomes of prophages [11, 12]. The phages bearing stx genes are referred to as Shiga toxin-converting bacteriophages, and all of them belong to the family of lambdoid phages (with phage λ serving as a paradigm) [12]. stx genes are present between antiterminator gene and the genes coding for proteins causing cell lysis; thus, in the lysogenic state, these genes are not transcribed [1315] and Shiga toxins are not produced. Their expression is possible only after prophage induction [11, 12] which usually requires activation of the bacterial S.O.S. response, mediated by RecA protein, though RecA-independent induction of Shiga toxin-converting prophages by EDTA has also been reported [16].

During infection of human intestine by EHEC, the oxidative stress appears to be the most likely condition causing the bacterial S.O.S. response and subsequent induction of Shiga toxin-converting prophages [17]. In fact, it was demonstrated that hydrogen peroxide (which is produced by neutrophils as a response to infection) enhanced production of Shiga toxins by EHEC [18] due to oxidative stress-mediated induction of Shiga toxin-converting prophages [19, 20].

Since many antibiotics not only kill bacteria and inhibit their growth but also induce prophage lytic development, their use is not recommended when EHEC infection is confirmed or even suspected (reviewed in [12]). Therefore, there are serious problems with treatment of patients, indicating that searching for new targets of potential therapies against Shiga toxin-producing bacteria is important. One might consider that such therapies should be focused on inhibition of Shiga toxin-converting prophage induction which would impair production of the EHEC virulence factor. All lambdoid phages, including Shiga toxin-converting bacteriophages, contain the region in their genomes which is dispensable for the development under standard laboratory conditions [14, 15]. Inside this part of the phage genome, there is an evolutionarily conserved fragment, located between exo and xis genes and transcribed from promoter, called the exo-xis region (Figure 1). This region encompasses several genes and open reading frames whose functions in phage development are largely unknown, and only a few articles are available in the literature that focused on them. Nevertheless, some interesting observations have been reported. Namely, induction of expression of genes from the exo-xis region resulted in synchronization of the host cell cycle [21] and inhibition of host DNA replication [22]. Moreover, overexpression of these genes impaired lysogenization of E. coli by bacteriophage [23] and enhanced induction of prophages and (one of Shiga toxin-converting phages) [24]. Ea8.5 protein, encoded by a gene located in the exo-xis region, contains a fused homeodomain/zinc finger fold [25] which suggests a regulatory role for this protein. Interestingly, prophage induction with mitomycin C or hydrogen peroxide caused different expression patterns of genes from the exo-xis region; such differences were observed in both phages, and [26]. In this work, we used the deletion mutants to investigate the role of the exo-xis region in induction of and prophages under oxidative stress conditions.

2. Materials and Methods

2.1. Bacteria and Bacteriophages

E. coli MG1655 strain [27] and its derivatives, used in this work, are listed in Table 1. Bacteria were routinely cultured in the Luria-Bertani (LB) medium at 30°C (most experiments) or 37°C (lysogenization and recombination procedures during construction of strains and SOS ChromoTest, according to the instructions of kits’ manufacturers), under aerobic conditions. Where appropriate, the following antibiotics were added: chloramphenicol up to 20 μg/mL, kanamycin up to 50 μg/mL, and/or tetracycline up to 12.5 μg/mL.


Strain
Genotype or relevant characteristicsReference

E. coli MG1655   ilvG rfb-50 rph-1[27]
E. coli MG1655 (λ)MG1655 bearing λ prophage [24]
E. coli MG1655 (λΔexo-xis)MG1655 bearing λ prophage with deletion of all orfs and genes localized between genes exo and xisThis study, by recombination
E. coli MG1655 (λΔorfs)MG1655 bearing λ prophage with deletion of orf60a, orf63, orf61, and orf73This study, by recombination
E. coli MG1655 (λΔorf60a)MG1655 bearing λ prophage with deletion of orf60a This study, by recombination
E. coli MG1655 (λΔorf63)MG1655 bearing λ prophage with deletion of orf63 This study, by recombination
E. coli MG1655 (λΔorf61)MG1655 bearing λ prophage with deletion of orf61This study, by recombination
E. coli MG1655 (λΔorf73)MG1655 bearing λ prophage with deletion of orf73This study, by recombination
E. coli MG1655 (λΔea22)MG1655 bearing λ prophage with deletion of ea22This study, by recombination
E. coli MG1655 (λΔea8.5)MG1655 bearing λ prophage with deletion of ea8.5This study, by recombination
E. coli MG1655 (Φ)MG1655 bearing Φ prophage[24]
E. coli MG1655 (ΦΔexo-xis)MG1655 bearing Φ prophage with deletion of all orfs and genes localized between genes exo and xisThis study, by recombination
E. coli MG1655 (ΦΔorfs)MG1655 bearing Φ prophage with deletion of 4 orfs being homologues of λorf60a, λorf63, λorf61, and λorf73This study, by recombination
E. coli MG1655 (ΦΔorf60a)MG1655 bearing Φ prophage with deletion of vb__9c, the homologue of λorf60a This study, by recombination
E. coli MG1655 (ΦΔorf63)MG1655 bearing Φ prophage with deletion of vb__8c, the homologue of λorf63 This study, by recombination
E. coli MG1655 (ΦΔorf61)MG1655 bearing Φ prophage with deletion of vb__7c, the homologue of λorf61This study, by recombination
E. coli MG1655 (ΦΔorf73)MG1655 bearing Φ prophage with deletion of the sequence of putative C4 zinc finger protein, the homologue of λorf73This study, by recombination
E. coli MG1655 (ΦΔea22)MG1655 bearing Φ prophage with deletion of vb__6c, the analogue of λea22This study, by recombination
E. coli MG1655recA13MG1655 but recA13[33]
E. coli MG1655recA13 (λ)MG1655recA13 bearing λ prophage This study, by lysogenization
E. coli MG1655recA13 (λΔexo-xis)MG1655recA13 bearing λ prophage with deletion of all orfs and genes localized between genes exo and xisThis study, by lysogenization
E. coli MG1655recA13 )MG1655recA13 bearing Φ prophageThis study, by lysogenization
E. coli MG1655recA13 Δexo-xis)MG1655recA13 bearing Φ prophage with deletion of all orfs and genes localized between genes exo and xisThis study, by lysogenization
E. coli PQ37sfiA::Mud(Ap lac) cts, lacΔU169, mal+, galE, galY, PhoC, rfa, F, thr, leu, his, pyrD, thi, trp::MUC+, srl300::Tn10, rpoB, uvrA+[31]
E. coli PQ37 (λ)PQ37 bearing λ prophage This study, by lysogenization
E. coli PQ37 (λΔexo-xis)PQ37 bearing λ prophage with deletion of all orfs and genes localized between genes exo and xisThis study, by lysogenization
E. coli PQ37 (Φ)PQ37 bearing Φ prophageThis study, by lysogenization
E. coli PQ37 (ΦΔexo-xis)PQ37 bearing Φ prophage with deletion of all orfs and genes localized between genes exo and xisThis study, by lysogenization

Bacteriophages papa (from our collection) [26] and stx2::cat) [28] were employed in this study. Phage suspensions were stored in the TM buffer (10 mM Tris-HCl, 10 mM MgSO4, pH 7.2) at 4°C.

The deletion mutants were constructed as described previously [29], by using the Quick and Easy E. coli Gene Deletion Kit (from Gene Bridges). The deletion of the indicated region was performed according to the manufacturer’s protocol using primers listed in Table 2. In the first step, the targeted sequence has been replaced with the FRT-flanked kanamycin resistance cassette, and the selection marker was subsequently removed in the FLP-recombinase step, leaving only 87 nucleotides of the cassette in the place of the original sequence. Each deletion was confirmed by DNA sequencing.


Primer nameSequence (5′3′)

pF_λ_exo-xis = pF_λ_orf60a
pR_λ_exo-xis
ATATCCGGGTAGGCGCAATCACTTTCGTCTACTCCGTTACAAAGCGAGGAATTAACCCTCACTAAAGGGCG
AGGCGGCTTGGTGTTCTTTCAGTTCTTCAATTCGAATATTGGTTACGTCTTAATACGACTCACTATAGGGCTC

pF_λ_orfs = pF_λ_orf60a
pR_λ_orfs = pR_λ_orf73
ATATCCGGGTAGGCGCAATCACTTTCGTCTACTCCGTTACAAAGCGAGGAATTAACCCTCACTAAAGGGCG
ACCTCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCAACTTGCACAAGTAATACGACTCACTATAGGGCTC

pF_λ_orf60a
pR_λ_orf60a
ATATCCGGGTAGGCGCAATCACTTTCGTCTACTCCGTTACAAAGCGAGGAATTAACCCTCACTAAAGGGCG
AGATGCTTTGTGCATACAGCCCCTCGTTTATTATTTATCTCCTCAGCCAGTAATACGACTCACTATAGGGCTC

pF_λ_orf63
pR_λ_orf63
CACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCGAGATGGCACATAGAATTAACCCTCACTAAAGGGCG
TCATACCTGGTTTCTCTCATCTGCTTCTGCTTTCGCCACCATCATTTCCATAATACGACTCACTATAGGGCTC

pF_λ_orf61
pR_λ_orf61
AGAGAAACCAGGTATGACAACCACGGAATGCATTTTTCTGGCAGCGGGCTAATTAACCCTCACTAAAGGGCG
TTATCCGGAAACTGCTGTCTGGCTTTTTTTGATTTCAGAATTAGCCTGACTAATACGACTCACTATAGGGCTC

pF_λ_orf73
pR_λ_orf73
ACATCATTGATTCAGCATCAGAAATAGAAGAATTACAGCGCAACACAGCAAATTAACCCTCACTAAAGGGCG
ACCTCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCAACTTGCACAAGTAATACGACTCACTATAGGGCTC

pF_λ_ea22
pR_λ_ea22
GAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGCAGGCAATGCATGAAATTAACCCTCACTAAAGGGCG
GTCAGACATCATATGCAGATACTCACCTGCATCCTGAACCCATTGACCTCCTAATACGACTCACTATAGGGCTC

pF_λ_ea8.5
pR_λ_ea8.5
ATGAGTATCAATGAGTTAGAGTCTGAGCAAAAAGATTGGGCGTTATCAATAATTAACCCTCACTAAAGGGCG
TAATCATCTATATGTTTTGTACAGAGAGGGCAAGTATCGTTTCCACCGTATAATACGACTCACTATAGGGCTC

pF_Φ_exo-xis = pF__orf60a
pR_Φ_exo-xis
TGGTAATGAAGCATCCTCACGATAATATCCGGGTAGGCACGATCACTTTCAATTACCTCACTAAAGGGCG
TGGCAATATGCTTTTCCTTCTCAATTTCCGCTTTAATCATATGCAGTTCGTAATACGACTCACTATAGGGCTC

pF_Φ_orfs = pF_Φ_orf60a
pR_Φ_orfs = pR_Φ_orf73
TGGTAATGAAGCATCCTCACGATAATATCCGGGTAGGCACGATCACTTTCAATTACCTCACTAAAGGGCG
CTTCGAACCTCTCTGTTTACTGATAAGCTCCAGATCCTCCTGGCAACTTGTAATACGACTCACTATAGGGCTC

pF_Φ_orf60a
pR_Φ_orf60a
TGGTAATGAAGCATCCTCACGATAATATCCGGGTAGGCACGATCACTTTCAATTACCTCACTAAAGGGCG
GGAGATGCTTTGTGCATACAGCCCCTCGTTATTATTTATCTCTTCAGCCTAATACGACTCACTATAGGGCTC

pF_Φ_orf63
pR_Φ_orf63
TGCACAAAGCATCTCCTGTTGAATTAAGAACGAGTATCGGGATGGCACATAATTAACCCTCACTAAAGGGCG
CATCATTTCCAGCTTTTGTGAAAGGGATGTGGCTAACGTATGAAATTCTTTAATACGACTCACTATAGGGCTC

pF_Φ_orf61
pR_Φ_orf61
TTCTGGCAGCAGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGAAATTAACCCTCACTAAAGGGCG
CACCGTTCCTTAAAGACGCCGTTTAACATGCCGATCGCCAGACTTAAATGTACGACTCACTATAGGGCTC

pF_Φ_orf73
pR_Φ_orf73
TGGCAGACCTCATTGATTCAGCATCAGAAATTGAAGAATTACAGCGCAACAATTAACCCTCACTAAAGGGCGG
CTTCGAACCTCTCTGTTTACTGATAAGCTCCAGATCCTCCTGGCAACTTGTAATACGACTCACTATAGGGCTC

pF_Φ_ea22  
pR_Φ_ea22
ATCAGGCACTGCGTGAAAAGGCAGAGAAAGCAACTAAAGGAAGCTACATCAATTAACCCTCACTAAAGGGCG
ATCCAGTGTGACGGTTTCCACGACGCACCAGGAATTATCCACCCATCATTATACGACTCACTATAGGGCTC

Lysogenic strains were constructed according to the procedure described previously [24], with slight modifications. Briefly, host bacteria were cultured to A600 of 0.5 in LB medium supplemented with MgSO4 and CaCl2 (to final concentrations of 10 mM each) at 37°C with shaking. At this point, one milliliter of the culture was withdrawn and centrifuged (10 min, 2000 ×g). Pellet was washed twice with TCM buffer (10 mM Tris-HCl, pH 7.2, 10 mM MgSO4, 10 mM CaCl2) and then suspended in 1 mL of the same buffer. Next, bacteria were incubated for 30 min at 30°C and mixed with phage suspensions at multiplicity of infection (m.o.i.) = 5. Mixtures of bacteria and phages were incubated in TMC buffer for 30 min at 30°C; then serial dilutions were prepared in TM buffer (10 mM Tris-HCl, 10 mM MgSO4; pH 7.2), and the mixture was plated onto LB agar. Plates were incubated at 37°C overnight. Lysogens were verified by sensitivity to UV irradiation and confirmed by PCR with primers designed to amplify phage sequence (Table 3).


Primers for bacterial sequencesPrimers for phage sequences
NameSequence (5′3′)NameSequence (5′3′)

pF_recAAGATTTCGACGATACGGCCCpF_λ_intTTTGATTTCAATTTTGTCCCACT
pR_recAAACCATCTCTACCGGTTCGCpR_ λ_intACCATGGCATCACAGTATCG
pF_lexAATGGATGGTGACTTGCTGGCpF_λ_xisTACCGCTGATTCGTGGAACA
pR_lexATTCGTCATCAATACGTGCGACpR_ λ_xisGGGTTCGGGAATGCAGGATA
pF_ssbATCGAAGGTCAGCTGCGTACpF_λ_exoTGCCGTCACTGCATAAACC
pR_ssbCGACTTCTGTGGTGTAGCGApR_ λ_exoTCTATCGCGACGAAAGTATGC
pF_recFCGATACCGGCGCTATACTCCpF_λ_cIIIATTCTTTGGGACTCCTGGCTG
pR_recFTTACGAACAGCTACGCCCGpR_ λ_cIIIGTAAATTACGTGACGGATGGAAAC
pF_rpoDGAATCTGAAATCGGGCGCACpF_λ_NCTCGTGATTTCGGTTTGCGA
pR_rpoDGTCAACAGTTCAACGGTGCCpR_ λ_NAAGCAGCAAATCCCCTGTTG
pF_rpoHGCTTTGGTGGTCGCAACTTTpF_λ_cIACCTCAAGCCAGAATGCAGA
pR_rpoHTCGCCGTTCACTGGATCAAApR_ λ_cICCAAAGGTGATGCGGAGAGA
pF_rpoSTTGCTCTGCGATCTCTTCCGpF_λ_croATGCGGAAGAGGTAAAGCCC
pR_rpoSGAACGTTTACCTGCGAACCGpR_ λ_croTGGAATGTGTAAGAGCGGGG
pF_uvrAGTCCATATCCGCCACTACCGpF_λ_cIITCGCAATGCTTGGAACTGAGA
pR_uvrATTACCCAACGTCTTGCCGAGpR_ λ_cIICCCTCTTCCACCTGCTGATC
pF_ftsKACAAACCGTTTATCTGCGCGpF_λ_OAATTCTGGCGAATCCTCTGA
pR_ftsKATCTTTACCCAGCACCACGGpR_ λ_OGAATTGCATCCGGTTT
pF_16SrRNACCTTACGACCAGGGCTACACpF_λ_QTTCTGCGGTAAGCACGAAC
pR_16SrRNATTATGAGGTCCGCTTGCTCTpR_ λ_QTGCATCAGATAGTTGATAGCCTTT
pF_λ_RATCGACCGTTGCAGCAATA
pR_ λ_RGCTCGAACTGACCATAACCAG
pF_Φ_intCAGTTGCCGGTATCCCTGT
pR_ Φ_intTGAGGCTTTCTTGCTTGTCA
pF_Φ_xisTATCGCGCCGGATGAGTAAG
pR_ Φ_xisCGCACAGCTTTGTATAATTTGCG
pF_Φ_exoTGCCGTCACTGCATAAACC
pR_ Φ_exoTCTATCGCGACGAAAGTATGC
pF_Φ_cIIIATTCTTTGGGACTCCTGGCTG
pR_ Φ_cIIIGTAAATTACGTGACGGATGGAAAC
pF_Φ_NAGGCGTTTCGTGAGTACCTT
pR_ Φ_NTTACACCGCCCTACTCTAAGC
pF_Φ_cITGCTGTCTCCTTTCACACGA
pR_ Φ_cIGCGATGGGTGGCTCAAAATT
pF_Φ_croCGAAGGCTTGTGGAGTTAGC
pR_ Φ_croGTCTTAGGGAGGAAGCCGTT
pF_Φ_cIITGATCGCGCAGAAACTGATTTAC
pR_ Φ_cIIGACAGCCAATCATCTTTGCCA
pF_Φ_OAAGCGAGTTTGCCACGAT
pR_ Φ_OGAACCCGAACTGCTTACCG
pF_Φ_QGGGAGTGAGGCTTGAGATGG
pR_ Φ_QTACAGAGGTTCTCCCTCCCG
pF_Φ_RGGGTGGATGGTAAGCCTGT
pR_ Φ_RTAACCCGGTCGCATTTTTC

2.2. Phage Lytic Development after Prophage Induction

Bacteria lysogenic with tested phages were cultured in LB medium at 30°C to A600 of 0.1. Two induction agents were tested: H2O2 (1 mM) and UV irradiation (50 J/m2; this dose was achieved by 20 sec incubation of the bacterial suspensions in Petri dishes under UV lamp hanged 17 cm above the laboratory table). At indicated times after induction, samples of bacterial cultures were harvested, and 30 μL of chloroform was added to 0.5 mL of each sample. The mixture was vortexed and centrifuged for 5 min in a microcentrifuge. Then, serial dilutions were prepared in TM buffer, and phage titer (number of phages per mL) was determined by spotting 2.5 μL of each dilution of the phage lysate on a freshly prepared LB agar (1.5%) or LB agar with 2.5 μg/mL chloramphenicol (according to a procedure described previously [30]), with a poured mixture of 1 mL of the indicator E. coli MG1655 strain culture and 2 mL of 0.7% nutrient agar (prewarmed to 45°C), supplemented with MgSO4 and CaCl2 (to a final concentration of 10 mM each). When full-plate titration was used, 0.1 mL of phage lysate dilutions was plated onto LB agar. Plates were incubated at 37°C overnight. Analogous experiment but without induction agents (control experiments), which allows estimation of effects of spontaneous prophage induction, was performed with each lysogenic strain. The relative phage titer, expressed as plaque forming units (pfu)/mL, was calculated by subtracting the values obtained in the control experiment from the values determined in the main experiment, and as a consequence it represents the ratio of phage titers in induced and noninduced cultures. Each experiment was repeated three times.

2.3. The S.O.S. Assay

The S.O.S. assay was performed using the SOS-ChromoTest Kit (Environmental Bio-Detection Products Inc.), following the manufacturer’s protocol and using provided 4-nitro-quinoline oxide (4-NQO) as a positive reference standard, and 1 mM H2O2 and UV irradiation (50 J/m2) as tested inducers of the S.O.S. response [31, 32]. In the case of UV light irradiation, the production of -galactosidase was evaluated immediately after the exposure, without 2 h incubation at 37°C (recommended by the manufacturer), as, without this modification, the visual detection of the blue color was not possible due to rapid S.O.S. response after UV irradiation. Before use, the SOS-ChromoTest bacterial strain (E. coli PQ37, provided with the kit) was lysogenized by following phages: λ, λΔexo-xis, , or Δexo-xis, according to procedure described above.

2.4. Preparation of RNA and cDNA from Bacteria

For the isolation of total RNA, the previously described [26] procedure was employed. Briefly, the prophage induction was performed with 1 mM H2O2 or UV irradiation (at the dose of 50 J/m2). Following induction, the samples were withdrawn at indicated times and the growth of bacteria was inhibited by the addition of NaN3 (Sigma-Aldrich) to a final concentration of 10 mM. Total RNA was isolated from 109 bacterial cells by using the High Pure RNA Isolation Kit (Roche Applied Science). Bacterial genomic DNA carryover was removed by incubation with TURBO DNase from TURBO DNA-free Kit (Life Technologies) for 60 min at 37°C, according to the manufacturer’s guidelines. To evaluate the quality and quantity of the isolated RNA, a NanoDrop spectrophotometer was employed, considering the absorbance ratio (which should be 1.8 ≤ A260/A280 ≤ 2.0). Moreover, band patterns of total RNA were visualized by electrophoresis. The absence of DNA from RNA samples was controlled by PCR amplification and by real-time PCR amplification (all analyzed genes were tested). RNA preparations were stored at −80°C. cDNA was obtained with Transcriptor Reverse Transcriptase and random hexamer primers (Roche Applied Science), using total RNA samples (1.25 μg) as templates. cDNA reaction mixtures were diluted 10-fold for use in real-time PCR.

2.5. Real-Time PCR Assay and Data Analysis

The patterns of genes’ expression were determined by quantitative real-time reverse transcription-PCR (qRT-PCR), using the LightCycler 480 Real-Time PCR System (Roche Applied Science) and cDNA samples from lysogenic bacteria. Transcripts of tested phage and bacterial genes were compared in parallel to 16S rRNA housekeeping gene (according to a procedure described previously [34]), whose expression was found to be constant. Primers were developed by Primer3web version 4.0.0 and produced by Sigma-Aldrich or GENOMED. The transcriptional analysis of phage and bacterial genes from lysogenic strains was performed with primers presented in Table 3. Real-time PCR amplifications were carried out for 55 cycles in 20 μL reaction volume, using LightCycler 480 SYBR Green I Master (Roche Applied Science) as a fluorescent detection dye. Reactions were performed in Roche 96-well plates containing 10 μL 2x SYBR Green I Master Mix, 6.25 ng/μL cDNA, and 200 nM of each gene-specific primer (Table 3). Relative quantification assays were performed with cDNA of 16S rRNA and phage/bacterial genes multiplex assay. All templates were amplified using the following program: incubation at 95°C for 5 min, followed by 55 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 15 s. No template control was included with each run. The specificity of amplified products was examined by melting curve analysis immediately after the final PCR cycle and confirmed by gel electrophoresis. Each experiment was conducted in triplicate.

The relative changes in gene expression revealed by quantitative real-time PCR experiments were analyzed using the calibrator, normalizing relative quantification method with efficiency correction (called the E-Method). This method has been used and described in detail previously [26, 29, 35]. The values obtained at time 0 (representing the conditions of spontaneous prophage induction) were used as calibrators. Thus, the following equation was employed to calculate the final results: where is target and is reference.

2.6. In Silico Analyses

The multiple sequence alignment was performed using the ClustalW algorithm available at the website http://www.genome.jp/tools/clustalw/. The Pfam protein families database [36], available at the website http://pfam.xfam.org/, was used to identify protein domains.

3. Results and Discussion

3.1. Deletion of the Exo-Xis Region Impairs but Not Prophage Induction after Treatment with Hydrogen Peroxide

Until now, all in vivo studies on effects of the exo-xis region on host or phage development were performed with the use of strains overexpressing genes from this region [2124, 26]. In this work, we have constructed a series of bacteriophage and mutants with deletions of either the whole exo-xis region or individual genes or open reading frames (Table 1). When wild-type and prophages were induced by UV irradiation (employed in this work as positive control conditions causing effective prophage induction) or hydrogen peroxide treatment of the lysogenic cells, efficiencies of induction and further phage lytic development were comparable in both phages, though some differences were observed in the duration of the lag phase of the phage development (Figure 2). Induction of Δexo-xis mutant with UV irradiation was similar to that observed for the wild-type λ, and treatment with hydrogen peroxide caused only a slight delay in the mutant phage development. The decrease in the phage titer at later times of the experiments is characteristic for λ and most probably arises from adsorption of the progeny virions on fragments of disrupted cell envelopes [15, 24]. However, induction of Δexo-xis prophage by UV irradiation was less efficient than that of the wild-type , and induction of the mutant by hydrogen peroxide was severely impaired (Figure 2). More detailed analyses, based on the full-plate phage titration method, allowing detection of 10 pfu/mL (see Section 2 for details), indicated that the number of pfu per mL of Δexo-xis phage after induction with hydrogen peroxide was at the same range (103/mL) as that measured without specific induction (i.e., representing efficiency of spontaneous prophage induction). Nevertheless, the titer of Δexo-xis measured at 240 and 360 min after induction was and , respectively, that is, still 3-4 times higher than that without induction, which was and , respectively (note that the titer of the wild-type after prophage induction was several orders of magnitude higher than that without induction, Figure 2).

Deletions of individual genes and open reading frames from the exo-xis region in did not affect significantly the phage titer. However, such deletions resulted in delays in prophage induction by hydrogen peroxide (Table 4). Interestingly, when prophage induction was stimulated by UV irradiation, such effect was not observed, and in some cases even more rapid induction of the mutant prophages occurred. In bacteriophage λ, only slight effects of deletions of individual genes and open reading frames were detected (Table 4).


Strain The time range of the switch from lag to log phase
H2O2 (1 mM)UV (50 J/m2)

MG1655 (λ)60–90 min60 min
MG1655 (λΔexo-xis)90–120 min30–60 min
MG1655 (λΔorfs)60–90 min30–60 min
MG1655 (λΔorf60a)60–90 min30–60 min
MG1655 (λΔorf63)60–90 min30–90 min
MG1655 (λΔorf61)60–90 min30–60 min
MG1655 (λΔorf73)30–60 min0–30 min
MG1655 (λΔea22)60–90 min30–60 min
MG1655 (λΔea8.5)60–90 min30–60 min
MG1655 (Φ)60–90 min150–180 min
MG1655 (ΦΔexo-xis)a150–180 min
MG1655 (ΦΔorfs)150–180 min150–180 min
MG1655 (ΦΔorf60a)120–150 min90–120 min
MG1655 (ΦΔorf63)120–150 min30–60 min
MG1655 (ΦΔorf61)90–120 min30–60 min
MG1655 (ΦΔorf73)90–120 min120–150 min
MG1655 (ΦΔea22)120–150 min30–60 min

The value was not determined due to a very low efficiency of prophage induction under these conditions (as shown in Figure 2).

We conclude that the genes and open reading frames from the exo-xis region play important roles in the regulation of lambdoid prophage induction, as deletions of the whole region or single loci caused significant changes in efficiency and timing of this process. The effects of mutations are more pronounced in Shiga toxin-converting phage than in λ and in lysogenic E. coli cells treated with hydrogen peroxide than in UV-irradiated ones. Thus, the exo-xis region seems to be particularly important for phage under conditions of the oxidative stress, the most likely conditions causing Shiga toxin-converting prophage induction during infection with EHEC.

3.2. Hydrogen Peroxide-Mediated Prophage Induction Is a RecA-Dependent Process

Efficient induction of lambdoid prophages is a RecA-dependent process due to a molecular mimicry between the phage cI repressor and the host-encoded LexA repressor which is self-cleaved after stimulation by the activated form of RecA protein under the S.O.S. response conditions [1215]. Such a mimicry is well known for bacteriophage λ cI protein and LexA [12, 13], and we found that both domain structure and amino acid residues crucial for the self-cleavage are also conserved in cI repressor of phage (Figure 3) (note that cI sequence of is identical to that of another Shiga toxin-converting bacteriophage, 933 W [37]). Nevertheless, since RecA-independent induction of Shiga toxin-converting prophages has also been reported [16], we asked whether hydrogen peroxide-caused prophage induction depends on the activation of the S.O.S. response.

When testing H2O2- or UV-dependent induction of prophages λ, λΔexo-xis, , and Δexo-xis in recA13 mutant host, in the assays analogous to those presented in Figure 2, pfu/mL values were at the levels of those estimated for the uninduced controls (, , , and  pfu/mL for λ, λΔexo-xis, , and Δexo-xis, resp.). Therefore, we conclude that induction of the investigated prophages under conditions of the oxidative stress (treatment with hydrogen peroxide) strongly depends on RecA function. Indeed, in cells lysogenic for λ or and treated with UV light or hydrogen peroxide, efficient induction of the S.O.S. response was evident, as estimated with the SOS ChromoTest (Figure 4). Intriguingly, while induction of the S.O.S. response by hydrogen peroxide in λΔexo-xis lysogen was comparable to that in λ lysogen, the signal in the SOS ChromoTest in Δexo-xis lysogen was considerably weaker than in the analogous experiment with lysogen (Figure 4). No such difference could be observed in UV-irradiated bacteria (Figure 4).

3.3. Deletion of the Exo-Xis Region Negatively Influences Expression of Genes from the S.O.S. Regulon in Hydrogen Peroxide-Treated Lysogenic Bacteria

Since unexpected results were obtained in experiments with hydrogen peroxide-treated Δexo-xis lysogenic cells (Figure 4), we aimed to investigate the phenomenon of a less efficient induction of the S.O.S. response in more detail. Thus, expression of genes from the S.O.S. regulon was tested by reverse transcription quantitative real-time PCR in E. coli cells lysogenic for λ, λΔexo-xis, , and Δexo-xis and treated with hydrogen peroxide. In both λ and , deletion of the exo-xis region caused a significant reduction in the mRNA levels of most of the S.O.S. regulon genes relative to wild-type prophages, with exceptions of rpoS gene in both phages and ssb, uvrA, and ftsK genes in , especially at later times after the treatment (Figure 5). Interestingly, in the case of wild-type lysogenic cells, the enhanced expression of particular genes from the S.O.S. regulon persisted longer, in most cases until 16 min after induction, whereas in the deletion mutant it decreases after 4 min (Figure 5). The impairment in expression of genes from the S.O.S. regulon (in particular recA and lexA genes, encoding the main regulators of the S.O.S. response) in the absence of the exo-xis region was more pronounced in than in λ. Moreover, induction of the S.O.S. regulon occurred significantly earlier in and Δexo-xis lysogens than in cells bearing λ and λΔexo-xis prophages (Figure 5). These results might explain, at least partially, effects of deletions of exo-xis genes on prophage induction, demonstrated in Figure 2 and Table 4, particularly delayed induction of prophage devoid of certain genes and open reading frames, and less pronounced effects of their lack in λ than in .

Indications that overexpression of some genes from the exo-xis region of λ can influence host cell cycle and DNA replication have been reported previously [21, 22]. Suggestions that some genes of prophage may affect host growth were also published [38]. However, the results described in this subsection demonstrate for the first time that the exo-xis region can significantly modulate one of global cellular responses, the S.O.S. response, after treatment with hydrogen peroxide.

3.4. Expression of Crucial Phage Genes Is Dramatically Decreased after Treatment of Lysogenic Cells with Hydrogen Peroxide in the Absence of the Exo-Xis Region in Prophage

Expression of phage genes, crucial for the regulatory processes and lytic development, has been tested under the same conditions as described in the preceding subsection. The specific conditions and time after addition of hydrogen peroxide into the cell culture at which samples were withdrawn were chosen on the basis of similar experiments reported previously [26]. Interestingly, different effects of the deletion of the exo-xis region were observed for phages λ and . In λ, deletion of genes and open reading frames located between exo and xis genes did not cause considerable effects on mRNA levels for xis, exo, and Q, whereas expression of int, cIII, N, cI, cro, cII, O, and R was enhanced upon treatment with hydrogen peroxide (Figure 6). Completely different results were obtained when and Δexo-xis lysogens were studied; namely, expression of all tested genes was drastically impaired in hydrogen peroxide-treated bacteria in the absence of the exo-xis region on the prophage (Figure 6).

While negative regulation of transcription from cII-dependent promoters by overexpression of the exo-xis region has been reported previously in phage λ [23], this study demonstrated for the first time significant effects of this region on expression of a battery of phage genes under conditions of the oxidative stress. The results presented in Figure 6 for phage λ are compatible with those published previously (though obtained with different methods) [23], as overexpression of the exo-xis region had opposite effects to those observed in its absence. On the other hand, severely impaired expression of all tested phage genes in Δexo-xis was unexpected. However, these results (Figure 6) can explain a strong defect in the induction of Δexo-xis prophage (and perhaps further lytic development) by hydrogen peroxide (Figure 2). Similarly, drastic differences between effects of Δexo-xis mutations on hydrogen peroxide-mediated prophage induction between λ and (Figure 2) can be ascribed to opposite regulation of expression of phage genes in the absence of the exo-xis region.

3.5. Effects of the Exo-Xis Region on Expression of Host and Phage Gene in UV-Irradiated Lysogenic Cells

Experiments analogous to those described in two preceding subsections were performed with lysogenic cells irradiated with UV. Interestingly, in both λ and phages, deletion of the exo-xis region caused only moderate effects on expression of most genes from the S.O.S. regulon (Figure 7), contrary to hydrogen peroxide-treated bacteria where the differences were significantly higher (compare Figures 5 and 7). The exceptions in UV-irradiated cells were rpoD, rpoH, and rpoS genes in λ and rpoH and rpoS in , whose expressions were at considerably lower level in the absence of the exo-xis region (Figure 7). One should also note that the induction of the S.O.S. regulon with UV irradiation was quicker than that with hydrogen peroxide. These results indicate that the influence of the exo-xis region on the S.O.S. response is particularly well pronounced under conditions of the oxidative stress.

Unlike the S.O.S. regulon expression, levels of mRNAs of bacteriophage genes in UV-irradiated cells were affected similarly to those in hydrogen peroxide-treated lysogenic bacteria by the absence of the exo-xis region (Figure 8). Again, although some differences were observed between λ and λΔexo-xis, the differences between and Δexo-xis were dramatic. This indicates that the influence of the exo-xis region on expression of phage genes after prophage induction does not depend on the induction agent.

4. Conclusions

The exo-xis region is necessary for effective, RecA-dependent induction of Shiga toxin-converting bacteriophage under conditions of the oxidative stress. In hydrogen peroxide-treated E. coli, this region positively influences expression of the S.O.S. regulon in both and lysogens and expression of phage genes crucial for lytic development (particularly xis, exo, N, cro, O, Q, and R) in , but not in . Since the oxidative stress appears to be the major cause of induction of Shiga toxin-converting prophages during infections of human intestine by enterohemorrhagic E. coli (EHEC), the exo-xis region and/or products of its expression might be considered as potential targets for anti-EHEC drugs.

Conflict of Interests

The authors declare no conflict of interests.

Authors’ Contribution

Katarzyna Licznerska and Aleksandra Dydecka contributed equally to this work.

Acknowledgment

This work was supported by the National Science Center (Poland) Grant no. 2013/09/B/NZ2/02366 to Alicja Węgrzyn.

References

  1. C. L. Gyles, “Shiga toxin-producing Escherichia coli: an overview,” Journal of Animal Science, vol. 85, no. 13, supplement, pp. E45–E62, 2007. View at: Publisher Site | Google Scholar
  2. J. M. Hunt, “Shiga toxin-producing Escherichia coli (STEC),” Clinics in Laboratory Medicine, vol. 30, no. 1, pp. 21–45, 2010. View at: Publisher Site | Google Scholar
  3. S. Razzaq, “Hemolytic uremic syndrome: an emerging health risk,” American Family Physician, vol. 74, no. 6, pp. 991–998, 2006. View at: Google Scholar
  4. D. Law, “Virulence factors of Escherichia coli O157 and other Shiga toxin-producing E. coli,” Journal of Applied Microbiology, vol. 88, no. 5, pp. 729–745, 2000. View at: Publisher Site | Google Scholar
  5. L. Beutin and A. Martin, “Outbreak of shiga toxin-producing Escherichia coli (STEC) O104:H4 infection in Germany causes a paradigm shift with regard to human pathogenicity of STEC strains,” Journal of Food Protection, vol. 75, no. 2, pp. 408–418, 2012. View at: Publisher Site | Google Scholar
  6. S. K. Bloch, A. Felczykowska, and B. Nejman-Falenczyk, “Escherichia coli O104:H4 outbreak—have we learnt a lesson from it?” Acta Biochimica Polonica, vol. 59, no. 4, pp. 483–488, 2012. View at: Google Scholar
  7. H. Karch, E. Denamur, U. Dobrindt et al., “The enemy within us: lessons from the 2011 European Escherichia coli O104:H4 outbreak,” EMBO Molecular Medicine, vol. 4, no. 9, pp. 841–848, 2012. View at: Publisher Site | Google Scholar
  8. C. R. Laing, Y. Zhang, M. W. Gilmour et al., “A comparison of Shiga-toxin 2 bacteriophage from classical enterohemorrhagic Escherichia coli serotypes and the German E. coli O104:H4 outbreak strain,” PLoS ONE, vol. 7, no. 5, Article ID e37362, 2012. View at: Publisher Site | Google Scholar
  9. A. Mellmann, D. Harmsen, C. A. Cummings et al., “Prospective genomic characterization of the german enterohemorrhagic Escherichia coli O104:H4 outbreak by rapid next generation sequencing technology,” PLoS ONE, vol. 6, no. 7, Article ID e22751, 2011. View at: Publisher Site | Google Scholar
  10. D. Werber, G. Krause, C. Frank et al., “Outbreaks of virulent diarrheagenic Escherichia coli—are we in control?” BMC Medicine, vol. 10, article 11, 2012. View at: Publisher Site | Google Scholar
  11. H. E. Allison, “Stx-phages: drivers and mediators of the evolution of STEC and STEC-like pathogens,” Future Microbiology, vol. 2, no. 2, pp. 165–174, 2007. View at: Publisher Site | Google Scholar
  12. J. M. Loś, M. Loś, and G. Wegrzyn, “Bacteriophages carrying Shiga toxin genes: genomic variations, detection and potential treatment of pathogenic bacteria,” Future microbiology, vol. 6, no. 8, pp. 909–924, 2011. View at: Publisher Site | Google Scholar
  13. M. Ptashne, A Genetic Switch: Phage Lambda Revisited, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 3rd edition, 2004.
  14. G. Wegrzyn and A. Wegrzyn, “Genetic switches during bacteriophage λ development,” Progress in Nucleic Acid Research and Molecular Biology, vol. 79, pp. 1–48, 2005. View at: Publisher Site | Google Scholar
  15. G. Węgrzyn, K. Licznerska, and A. Węgrzyn, “Phage λ-new insights into regulatory circuits,” Advances in Virus Research, vol. 82, pp. 155–178, 2012. View at: Publisher Site | Google Scholar
  16. L. Imamovic and M. Muniesa, “Characterizing RecA-independent induction of Shiga toxin2-encoding phages by EDTA treatment,” PLoS ONE, vol. 7, no. 2, Article ID e32393, 2012. View at: Publisher Site | Google Scholar
  17. J. M. Łoś, M. Łoś, A. Węgrzyn, and G. Węgrzyn, “Altruism of Shiga toxin-producing Escherichia coli: recent hypothesis versus experimental results,” Frontiers in Cellular and Infection Microbiology, vol. 2, article 166, 2013. View at: Google Scholar
  18. P. L. Wagner, D. W. K. Acheson, and M. K. Waldor, “Human neutrophils and their products induce Shiga toxin production by enterohemorrhagic Escherichia coli,” Infection and Immunity, vol. 69, no. 3, pp. 1934–1937, 2001. View at: Publisher Site | Google Scholar
  19. J. M. Łoś, M. Łoś, G. Węgrzyn, and A. Węgrzyn, “Differential efficiency of induction of various lambdoid prophages responsible for production of Shiga toxins in response to different induction agents,” Microbial Pathogenesis, vol. 47, no. 6, pp. 289–298, 2009. View at: Publisher Site | Google Scholar
  20. J. M. Łoś, M. Łoś, A. Wȩgrzyn, and G. Wȩgrzyn, “Hydrogen peroxide-mediated induction of the Shiga toxin-converting lambdoid prophage ST2-8624 in Escherichia coli O157:H7,” FEMS Immunology and Medical Microbiology, vol. 58, no. 3, pp. 322–329, 2010. View at: Publisher Site | Google Scholar
  21. P. Kourilsky and A. Knapp, “Lysogenization by bacteriophage lambda. III.—multiplicity dependent phenomena occuring upon infection by lambda,” Biochimie, vol. 56, no. 11-12, pp. 1517–1523, 1975. View at: Publisher Site | Google Scholar
  22. K. Sergueev, D. Court, L. Reaves, and S. Austin, “E. coli cell-cycle regulation by bacteriophage λ,” Journal of Molecular Biology, vol. 324, no. 2, pp. 297–307, 2002. View at: Publisher Site | Google Scholar
  23. J. M. Łoś, M. Łoś, A. Węgrzyn, and G. Węgrzyn, “Role of the bacteriophage λexo-xis region in the virus development,” Folia Microbiologica, vol. 53, no. 5, pp. 443–450, 2008. View at: Publisher Site | Google Scholar
  24. S. Bloch, B. Nejman-Faleńczyk, J. M. Łoå et al., “Genes from the exo-xis region of λ and Shiga toxin-converting bacteriophages influence lysogenization and prophage induction,” Archives of Microbiology, vol. 195, no. 10-11, pp. 693–703, 2013. View at: Publisher Site | Google Scholar
  25. J. J. Kwan, E. Smirnova, S. Khazai, F. Evanics, K. L. Maxwell, and L. W. Donaldson, “The solution structures of two prophage homologues of the bacteriophage λ Ea8.5 protein reveal a newly discovered hybrid homeodomain/zinc-finger fold,” Biochemistry, vol. 52, no. 21, pp. 3612–3614, 2013. View at: Publisher Site | Google Scholar
  26. S. Bloch, B. Nejman-Faleńczyk, A. Dydecka et al., “Different expression patterns of genes from the Exo-Xis region of bacteriophage λ and Shiga toxin-converting bacteriophage Φ24B following infection or prophage induction in Escherichia coli,” PLoS ONE, vol. 9, no. 10, Article ID e108233, 2014. View at: Publisher Site | Google Scholar
  27. K. F. Jensen, “The Escherichia coli K-12 ‘wild types’ W3110 and MG1655 have an rph frameshift mutation that leads to pyrimidine starvation due to low pyrE expression levels,” Journal of Bacteriology, vol. 175, no. 11, pp. 3401–3407, 1993. View at: Google Scholar
  28. H. E. Allison, M. J. Sergeant, C. E. James et al., “Immunity profiles of wild-type and recombinant Shiga-like toxin-encoding bacteriophages and characterization of novel double lysogens,” Infection and Immunity, vol. 71, no. 6, pp. 3409–3418, 2003. View at: Publisher Site | Google Scholar
  29. B. Nejman-Faleńczyk, S. Bloch, K. Licznerska et al., “A small, microRNA-size, ribonucleic acid regulating gene expression and development of Shiga toxin-converting bacteriophage Φ24B,” Scientific Reports, vol. 5, Article ID 10080, 2015. View at: Publisher Site | Google Scholar
  30. J. M. Łoś, P. Golec, G. Wȩgrzyn, A. Wȩgrzyn, and M. Łoś, “Simple method for plating Escherichia coli bacteriophages forming very small plaques or no plaques under standard conditions,” Applied and Environmental Microbiology, vol. 74, no. 16, pp. 5113–5120, 2008. View at: Publisher Site | Google Scholar
  31. P. Quillardet, O. Huisman, R. D'Ari, and M. Hofnung, “SOS chromotest, a direct assay of induction of an SOS function in Escherichia coli K-12 to measure genotoxicity,” Proceedings of the National Academy of Sciences of the United States of America, vol. 79, no. 19, pp. 5971–5975, 1982. View at: Publisher Site | Google Scholar
  32. F. Fish, I. Lampert, and A. Halachmi, “The SOS chromotest kit: a rapid method for the detection of genotoxicity,” Toxicity Assessment, vol. 2, no. 2, pp. 135–147, 1987. View at: Google Scholar
  33. A. Herman-Antosiewicz and G. Wȩgrzyn, “Regulation of copy number and stability of phage λ derived pTCλ1 plasmid in the light of the dimer/multimer catastrophe hypothesis,” FEMS Microbiology Letters, vol. 176, no. 2, pp. 489–493, 1999. View at: Publisher Site | Google Scholar
  34. E. Strauch, J. A. Hammerl, A. Konietzny et al., “Bacteriophage 2851 is a prototype phage for dissemination of the Shiga toxin variant gene 2c in Escherichia coli O157:H7,” Infection and Immunity, vol. 76, no. 12, pp. 5466–5477, 2008. View at: Publisher Site | Google Scholar
  35. D. Nowicki, S. Bloch, B. Nejman-Faleńczyk, A. Szalewska-Pałasz, A. Węgrzyn, and G. Węgrzyn, “Defects in RNA polyadenylation impair both lysogenization by and lytic development of Shiga toxin-converting bacteriophages,” Journal of General Virology, vol. 96, no. 7, pp. 1957–1968, 2015. View at: Publisher Site | Google Scholar
  36. R. D. Finn, A. Bateman, J. Clements et al., “Pfam: the protein families database,” Nucleic Acids Research, vol. 42, no. 1, pp. D222–D230, 2014. View at: Publisher Site | Google Scholar
  37. A. P. Koudelka, L. A. Hufnagel, and G. B. Koudelka, “Purification and characterization of the repressor of the shiga toxin-encoding bacteriophage 933W: DNA binding, gene regulation, and autocleavage,” Journal of Bacteriology, vol. 186, no. 22, pp. 7659–7669, 2004. View at: Publisher Site | Google Scholar
  38. L. M. Riley, M. Veses-Garcia, J. D. Hillman, M. Handfield, A. J. McCarthy, and H. E. Allison, “Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B,” BMC Microbiology, vol. 12, article 42, 2012. View at: Publisher Site | Google Scholar

Copyright © 2016 Katarzyna Licznerska et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

969 Views | 492 Downloads | 6 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.